Distrofia de bastones cónicos

Se trata de un raro trastorno genético hereditario aislado de la retina que se caracteriza por una degeneración primaria de los conos con una importante afectación secundaria de los bastones, con un aspecto variable del fondo de ojo. La presentación típica incluye disminución de la agudeza visual, escotoma central, fotofobia, alteración de la visión del color, seguida de ceguera nocturna y pérdida del campo visual periférico.


La distrofia de conos y bastones (DRC) se caracteriza por la afectación primaria de los conos o, en ocasiones, por la pérdida concomitante de conos y bastones, lo que explica los síntomas predominantes de la DRC: disminución de la agudeza visual, defectos en la visión de los colores, fotoversión y disminución de la sensibilidad en el campo visual central, seguidos posteriormente de una pérdida progresiva de la visión periférica y ceguera nocturna. El aspecto del fondo de ojo es variable y va desde la normalidad en las primeras fases, con sólo una sutil palidez temporal del nervio óptico, migración y atrofia del pigmento macular o una maculopatía en forma de ojo de buey, hasta la atrofia del epitelio pigmentario de la retina periférica, la migración de la pigmentación intra-retiniana, la atenuación arteriolar y la palidez del disco óptico a medida que la enfermedad progresa. La distrofia de conos y bastones (CRD) debe distinguirse de la distrofia de bastones y bastones (RCD), también conocida como retinitis pigmentaria. A diferencia de la DCR, que suele comenzar con ceguera nocturna y constricción progresiva del campo visual, mientras que la visión central se conserva hasta fases avanzadas, la DCR se caracteriza por una disminución primaria de la visión central que conduce a una ceguera legal más temprana. Sin embargo, en la fase final, las CRD no se diferencian de las RCD en fase final. Las DRC no suelen ser sindrómicas, pero también pueden formar parte de varios síndromes, como el síndrome de Alström, el síndrome de Bardet-Biedl y la ataxia espinocerebelosa de tipo 7.

NO ES RARO EN EUROPA: Degeneración macular asociada a la edad

La degeneración macular asociada a la edad-2 (DMAE2) es un trastorno complejo caracterizado por la acumulación de drusas dentro y debajo del epitelio pigmentario de la retina (EPR) y la atrofia progresiva del EPR macular. Estos cambios provocan la pérdida de la función de los fotorreceptores y el deterioro de la visión. Los factores de riesgo ambientales son el tabaquismo, la dieta y el nivel de colesterol.



Retinitis pigmentaria

La retinosis pigmentaria (RP) es una distrofia hereditaria de la retina que conduce a la pérdida progresiva de los fotorreceptores y del epitelio pigmentario de la retina y que provoca la ceguera generalmente después de varias décadas.


La retinosis pigmentaria es lentamente progresiva pero implacable. Sin embargo, existe una amplia variabilidad en la edad de inicio, la tasa de progresión y las manifestaciones clínicas secundarias. Los individuos afectados suelen desarrollar primero ceguera nocturna (nictalopía) debido a la pérdida de la función de los bastones, a menudo en la adolescencia o antes. A continuación, desarrollan un deterioro del campo visual periférico y, con el tiempo, la pérdida de la visión central, normalmente en etapas tardías, a menudo en torno a la mediana edad. La pérdida de agudeza visual central puede producirse a cualquier edad como resultado de un edema macular cistoide o de la pérdida de fotorreceptores. Las cataratas subcapsulares posteriores son frecuentes y su gravedad depende de la edad. También puede encontrarse una reducción de la visión de los colores. El examen del fondo de ojo revela depósitos de pigmento de espícula ósea, vasos retinianos atenuados, atrofia de la retina y palidez del nervio óptico. La gravedad está parcialmente correlacionada con el patrón de herencia: los casos ligados al cromosoma X son los más graves, los casos autosómicos recesivos y de ocurrencia única tienen una gravedad intermedia, y los autosómicos dominantes son los más favorables.

Enfermedad de Stargardt

Es un trastorno oftálmico poco frecuente que suele caracterizarse por una pérdida progresiva de la visión central asociada a motas irregulares maculares y perimaculares de color blanco amarillento en el fondo de ojo, y a una lesión macular central atrófica denominada ''bronce batido''.


La enfermedad suele presentarse en las dos primeras décadas de vida, aunque los síntomas también pueden aparecer durante la edad adulta y hasta la séptima década. Aunque la progresión y la gravedad de la enfermedad varían mucho, la enfermedad de Stargardt (STGD1) suele caracterizarse por una pérdida progresiva de la visión central que provoca visión borrosa y, ocasionalmente, una creciente dificultad para adaptarse en la oscuridad. La visión periférica suele ser normal. La mayoría de los individuos afectados también tienen una visión del color deteriorada. Puede haber fotofobia.


c.1755del ; NM_000350.2(ABCA4):c.1804C>T ; NM_000350.2(ABCA4):c.5819T>C ; NM_000350.2(ABCA4):c.52C>T ; c.5512del ; NM_000350.2(ABCA4):c.3106G>A ; c.6394G>T ; c.1771del ; NM_000350.2(ABCA4):c.4793C>A ; NM_000350.2(ABCA4):c.763C>T ; NM_000350.2(ABCA4):c.5882G>A ; NM_000350.2(ABCA4):c.4469G>A ; NM_000350.2(ABCA4):c.6118C>T ; NM_000350.2(ABCA4):c.2300T>A ; NM_000350.2(ABCA4):c.3210_3211dupGT ; NM_000350.2(ABCA4):c.1848del ; NM_000350.2(ABCA4):c.3322C>T ; NM_000350.2(ABCA4):c.1018T>G ; NM_000350.2(ABCA4):c.1222C>T ; NM_000350.2(ABCA4):c.634C>T ; NM_000350.2(ABCA4):c.6089G>A ; NM_000350.2(ABCA4):c.5461-10T>C ; NM_000350.2(ABCA4):c.4457C>T ; NM_000350.2(ABCA4):c.6449G>A ; NM_000350.2(ABCA4):c.3083C>T ; NM_000350.2(ABCA4):c.2616_2617delCT ; NM_000350.2(ABCA4):c.5881G>A ; NM_000350.2(ABCA4):c.4429C>T ; NM_000350.2(ABCA4):c.1938-1G>A ; NM_000350.2(ABCA4):c.2160+1G>T ; NM_000350.2(ABCA4):c.5912T>G ; NM_000350.2(ABCA4):c.5714+5G>A ; NM_000350.2(ABCA4):c.67-2A>G ; NM_000350.2(ABCA4):c.3539_3554del16 ; NM_000350.2(ABCA4):c.1225del ; NM_000350.2(ABCA4):c.3364G>A ; NM_000350.2(ABCA4):c.4139C>T ; NM_000350.2(ABCA4):c.1964T>G ; c.1755del ; NM_000350.2(ABCA4):c.1804C>T ; NM_000350.2(ABCA4):c.5819T>C ; NM_000350.2(ABCA4):c.52C>T ; c.5512del ; NM_000350.2(ABCA4):c.3106G>A ; c.6394G>T ; c.1771del ; NM_000350.2(ABCA4):c.4793C>A ; NM_000350.2(ABCA4):c.763C>T ; NM_000350.2(ABCA4):c.5882G>A ; NM_000350.2(ABCA4):c.4469G>A ; NM_000350.2(ABCA4):c.6118C>T ; NM_000350.2(ABCA4):c.2300T>A ; NM_000350.2(ABCA4):c.3210_3211dupGT ; NM_000350.2(ABCA4):c.1848del ; NM_000350.2(ABCA4):c.3322C>T ; NM_000350.2(ABCA4):c.1018T>G ; NM_000350.2(ABCA4):c.1222C>T ; NM_000350.2(ABCA4):c.634C>T ; NM_000350.2(ABCA4):c.6089G>A ; NM_000350.2(ABCA4):c.5461-10T>C ; NM_000350.2(ABCA4):c.4457C>T ; NM_000350.2(ABCA4):c.6449G>A ; NM_000350.2(ABCA4):c.3083C>T ; NM_000350.2(ABCA4):c.2616_2617delCT ; NM_000350.2(ABCA4):c.5881G>A ; NM_000350.2(ABCA4):c.4429C>T ; NM_000350.2(ABCA4):c.1938-1G>A ; NM_000350.2(ABCA4):c.2160+1G>T ; NM_000350.2(ABCA4):c.5912T>G ; NM_000350.2(ABCA4):c.5714+5G>A ; NM_000350.2(ABCA4):c.67-2A>G ; NM_000350.2(ABCA4):c.3539_3554del16 ; NM_000350.2(ABCA4):c.1225del ; NM_000350.2(ABCA4):c.3364G>A ; NM_000350.2(ABCA4):c.4139C>T ; NM_000350.2(ABCA4):c.1964T>G



Deficiencia de acil-CoA deshidrogenasa 9

Trastorno raro caracterizado por disfunción neurológica, insuficiencia hepática y cardiomiopatía debido a una deficiencia del complejo I de la cadena respiratoria.


Los pacientes presentan predominantemente una enfermedad neurológica, hepática y/o cardiomiopatía con deficiencia aislada de NADH-CoQ reductasa (ver este término). Las manifestaciones incluyen retraso en el crecimiento, cardiomiopatía hipertrófica, intolerancia al ejercicio, enfermedad hepática y disfunción neurológica de leve a grave.


c.453+1G>A ; NM_014049.4(ACAD9):c.1240C>T ; c.23del ; NM_014049.4(ACAD9):c.359delT ; NM_014049.4(ACAD9):c.797G>A ; NM_014049.4(ACAD9):c.130T>A ; NM_014049.4(ACAD9):c.1594C>T ; NM_014049.4(ACAD9):c.1249C>T ; NM_014049.4(ACAD9):c.976G>C ; c.453+1G>A ; NM_014049.4(ACAD9):c.1240C>T ; c.23del ; NM_014049.4(ACAD9):c.359delT ; NM_014049.4(ACAD9):c.797G>A ; NM_014049.4(ACAD9):c.130T>A ; NM_014049.4(ACAD9):c.1594C>T ; NM_014049.4(ACAD9):c.1249C>T ; NM_014049.4(ACAD9):c.976G>C



Deficiencia de acil-CoA deshidrogenasa de cadena media

La deficiencia de acil-CoA deshidrogenasa de cadena media (MCAD) es un error congénito de la oxidación mitocondrial de los ácidos grasos que se caracteriza por una crisis metabólica rápidamente progresiva, que a menudo se presenta como hipoglucemia hipocetósica, letargo, vómitos, convulsiones y coma, y que puede ser mortal en ausencia de una intervención médica urgente.


La MCADD suele presentarse entre 3 y 24 meses después del nacimiento en bebés previamente sanos. Sin embargo, las presentaciones neonatales están bien descritas, al igual que las de los adultos, si se produce un estrés metabólico suficiente (como una ingesta importante de alcohol). No obstante, muchos individuos afectados permanecen asintomáticos durante toda su vida. Normalmente, la hipoglucemia hipocetósica, el letargo y los vómitos se desencadenan por una infección, un ayuno o una intervención quirúrgica. Sin embargo, algunos pacientes pueden presentar una crisis metabólica progresiva a pesar de la cetosis y la glucemia normal. En raras ocasiones, los pacientes pueden presentar una crisis con una cetosis "paradójicamente" grave. Durante una crisis, el paciente puede manifestarse con letargo, emesis, parada respiratoria, convulsiones, hepatomegalia y una rápida progresión hacia la parada cardíaca a menos que se aplique un tratamiento de emergencia. Las posibles lesiones cerebrales que se produzcan durante estos episodios pueden suponer un mayor riesgo de daño neurológico a largo plazo. La muerte súbita inexplicada puede ser a veces la primera manifestación de esta enfermedad. Históricamente, alrededor del 25% de los pacientes no diagnosticados mueren durante la primera presentación de una crisis.


NM_000016.5(ACADM):c.250C>T ; NM_000016.5(ACADM):c.797A>G ; NM_000016.5(ACADM):c.449_452delCTGA ; NM_000016.5(ACADM):c.447G>A ; NM_000016.5(ACADM):c.799G>A ; NM_000016.5(ACADM):c.734C>T ; NM_000016.5(ACADM):c.616C>T ; NM_000016.5(ACADM):c.817_829del ; NM_000016.5(ACADM):c.984del ; NM_000016.5(ACADM):c.617G>A ; NM_000016.5(ACADM):c.287-2A>G ; NM_000016.5(ACADM):c.1102_1105delTTAG ; NM_000016.5(ACADM):c.250C>T ; NM_000016.5(ACADM):c.797A>G ; NM_000016.5(ACADM):c.449_452delCTGA ; NM_000016.5(ACADM):c.447G>A ; NM_000016.5(ACADM):c.799G>A ; NM_000016.5(ACADM):c.734C>T ; NM_000016.5(ACADM):c.616C>T ; NM_000016.5(ACADM):c.817_829del ; NM_000016.5(ACADM):c.984del ; NM_000016.5(ACADM):c.617G>A ; NM_000016.5(ACADM):c.287-2A>G ; NM_000016.5(ACADM):c.1102_1105delTTAG



Deficiencia de acil-CoA deshidrogenasa de cadena corta

La deficiencia de acil-CoA deshidrogenasa de cadena corta (SCAD) es un error congénito muy raro de la oxidación mitocondrial de los ácidos grasos que se caracteriza por manifestaciones variables que van desde individuos asintomáticos (en la mayoría de los casos) hasta aquellos con retraso en el crecimiento, hipotonía, convulsiones, retraso en el desarrollo y miopatía progresiva.


La mayoría de los niños con deficiencia de SCAD identificados a través de los programas de cribado neonatal han estado bien en el momento del diagnóstico y la mayoría han permanecido asintomáticos. En los individuos afectados, las manifestaciones incluyen convulsiones, retraso en el desarrollo (retraso en sentarse/caminar y/o en el habla/interacción social), retraso en el crecimiento con mala alimentación, y normalmente debilidad muscular e hipotonía.


NM_000017.4(ACADS):c.417G>C ; c.561_568del ; NM_000017.4:c.319C>T ; NM_000017.3(ACADS):c.529T>C ; NM_000017.3(ACADS):c.1147C>T ; NM_000017.3(ACADS):c.136C>T ; NM_000017.4(ACADS):c.417G>C ; c.561_568del ; NM_000017.4:c.319C>T ; NM_000017.3(ACADS):c.529T>C ; NM_000017.3(ACADS):c.1147C>T ; NM_000017.3(ACADS):c.136C>T



Deficiencia de 2-metilbutiril-CoA deshidrogenasa

La deficiencia de la 2-metilbutiril-CoA deshidrogenasa es un trastorno metabólico autosómico recesivo de la degradación de la isoleucina. La mayoría de las veces se detecta a través del cribado de los recién nacidos y suele ser clínicamente asintomática, aunque se ha informado de que algunos pacientes presentan un retraso en el desarrollo y signos neurológicos. Por lo tanto, la relevancia clínica de la deficiencia no está clara.


La PNPOD es un error congénito del metabolismo, autosómico y recesivo, que da lugar a una deficiencia de vitamina B6 que se manifiesta con convulsiones graves de inicio neonatal y posterior encefalopatía. Los pacientes con mutaciones PNPO tienden a responder mejor al tratamiento con fosfato de piridoxal 5-prima (PLP) que con piridoxina.


NM_001609.3(ACADSB):c.303+1G>A ; NM_001609.3(ACADSB):c.763C>T ; NM_001609.3(ACADSB):c.303+1G>A ; NM_001609.3(ACADSB):c.763C>T



Deficiencia de acil-CoA deshidrogenasa de cadena muy larga

La deficiencia de acil-CoA deshidrogenasa de cadena muy larga (VLCAD) es un trastorno hereditario de la oxidación mitocondrial de ácidos grasos de cadena larga con una presentación variable que incluye: cardiomiopatía, hipoglucemia hipocetósica, enfermedad hepática, intolerancia al ejercicio y rabdomiólisis.


La VLCADD es una enfermedad clínicamente heterogénea, con 3 fenotipos principales. La VLCADD infantil grave tiene un inicio precoz, normalmente en los primeros 3-12 meses de vida y ya en el periodo neonatal, con una elevada mortalidad y una alta incidencia de hipoglucemia hipocetósica, enfermedad hepática, arritmias cardíacas y miocardiopatía. También se ha descrito un derrame pericárdico. La VLCADD infantil moderadamente grave tiene un inicio más tardío (desde el periodo neonatal hasta la primera infancia) y suele presentarse con hipoglucemia hipocetósica, menor mortalidad y raramente cardiomiopatía. La VLCADD miopática de inicio tardío se presenta en niños mayores y adultos jóvenes (normalmente >10 años de edad) con afectación aislada del músculo esquelético, intolerancia al ejercicio, mialgia, rabdomiólisis y mioglobinuria, generalmente desencadenada por el ejercicio, el ayuno, el frío/calor y/o el estrés, pero la infección viral también puede precipitar/exacerbar esta presentación. En raras ocasiones puede conducir a una insuficiencia renal y puede ser mortal. Algunos pacientes que presentan la enfermedad miopática pueden tener una historia previa de hipoglucemia en la infancia.


NM_000018.3(ACADVL):c.1389dupG ; NM_000018.2(ACADVL):c.1182+1G>A ; c.1309dup ; NM_000018.4:c.1096C>T ; NM_000018.3(ACADVL):c.343delG ; NM_000018.3(ACADVL):c.1106T>C ; c.334C>T ; NM_000018.3(ACADVL):c.848T>C ; NM_000018.3(ACADVL):c.753-2A>C ; NM_000018.3(ACADVL):c.1406G>A ; c.411+1G>C ; NM_000018.3(ACADVL):c.298_299delCA ; NM_000018.3(ACADVL):c.1837C>T ; NM_000018.3(ACADVL):c.1843C>T ; c.212-1G>A ; NM_000018.3(ACADVL):c.1532+1G>A ; NM_000018.3(ACADVL):c.1357C>T ; NM_000018.3(ACADVL):c.685C>T ; NM_000018.4(ACADVL):c.1097G>A ; NM_000018.4(ACADVL):c.520G>A ; NM_000018.3(ACADVL):c.1141_1143delGAG ; c.1816del ; NM_000018.3(ACADVL):c.1389dupG ; NM_000018.2(ACADVL):c.1182+1G>A ; c.1309dup ; NM_000018.4:c.1096C>T ; NM_000018.3(ACADVL):c.343delG ; NM_000018.3(ACADVL):c.1106T>C ; c.334C>T ; NM_000018.3(ACADVL):c.848T>C ; NM_000018.3(ACADVL):c.753-2A>C ; NM_000018.3(ACADVL):c.1406G>A ; c.411+1G>C ; NM_000018.3(ACADVL):c.298_299delCA ; NM_000018.3(ACADVL):c.1837C>T ; NM_000018.3(ACADVL):c.1843C>T ; c.212-1G>A ; NM_000018.3(ACADVL):c.1532+1G>A ; NM_000018.3(ACADVL):c.1357C>T ; NM_000018.3(ACADVL):c.685C>T ; NM_000018.4(ACADVL):c.1097G>A ; NM_000018.4(ACADVL):c.520G>A ; NM_000018.3(ACADVL):c.1141_1143delGAG ; c.1816del



Deficiencia de beta-cetotiolasa

Se trata de una aciduria orgánica genética poco frecuente que afecta al metabolismo de los cuerpos cetónicos y al catabolismo de la isoleucina y que se caracteriza por episodios cetoacidóticos intermitentes asociados a vómitos, disnea, taquipnea, hipotonía, letargo y coma, con un inicio durante la infancia y que suele cesar en la adolescencia.


Los niños suelen tener una apariencia normal al nacer y la enfermedad se presenta normalmente entre los 5 meses y los 2 años de edad; sin embargo, la presentación puede ocurrir en cualquier momento entre el nacimiento y la infancia. La aparición de los síntomas suele producirse en forma de crisis cetoacidótica, provocada en la mayoría de los casos por el estrés, el ayuno, las enfermedades y/o infecciones agudas (por ejemplo, la gastroenteritis), y rara vez por el aumento de la ingesta de proteínas en la dieta. Un olor a acetona o a fruta en el aliento suele indicar una cetoacidosis. Estos episodios se asocian a vómitos, disnea, letargo e inconsciencia, y pueden conducir al coma y a la muerte si no se tratan. Las secuelas neurológicas (como el retraso en el desarrollo) tras los episodios graves son frecuentes. En raras ocasiones, los pacientes presentan signos de encefalopatía metabólica (hipotonía, disartria, corea, retraso del desarrollo). Sin embargo, la aparición de retraso en el desarrollo o de manifestaciones neurológicas antes de una primera crisis cetoacidótica es rara. La frecuencia de los episodios disminuye con la edad y acaba por detenerse antes de la adolescencia. Entre los episodios, los pacientes suelen ser asintomáticos.


NM_000019.3(ACAT1):c.1033_1035del ; c.412_419del ; NM_000019.3(ACAT1):c.2T>A ; NM_000019.3(ACAT1):c.547G>A ; NM_000019.3(ACAT1):c.622C>T ; NM_000019.3(ACAT1):c.1138G>A ; NM_000019.3(ACAT1):c.905delA ; NM_000019.4(ACAT1):c.1083dup ; NM_000019.3(ACAT1):c.1136G>T ; NM_000019.3(ACAT1):c.1033_1035del ; c.412_419del ; NM_000019.3(ACAT1):c.2T>A ; NM_000019.3(ACAT1):c.547G>A ; NM_000019.3(ACAT1):c.622C>T ; NM_000019.3(ACAT1):c.1138G>A ; NM_000019.3(ACAT1):c.905delA ; NM_000019.4(ACAT1):c.1083dup ; NM_000019.3(ACAT1):c.1136G>T



Deficiencia de acil-CoA oxidasa peroxisomal

La deficiencia de acil-CoA oxidasa peroxisomal es un trastorno neurodegenerativo poco frecuente que pertenece al grupo de trastornos peroxisomales heredados y se caracteriza por hipotonía y convulsiones en el periodo neonatal y regresión neurológica en la primera infancia.


La deficiencia de acil-CoA oxidasa peroxisomal es un trastorno de la beta-oxidación de los ácidos grasos peroxisomales. Véase también la deficiencia de la proteína D-bifuncional, causada por una mutación en el gen HSD17B4 del cromosoma 5q2. Las manifestaciones clínicas de estas dos deficiencias son similares a las de los trastornos del ensamblaje peroxisomal, incluyendo el síndrome cerebrohepatorrenal de Zellweger y la adrenoleucodistrofia neonatal: hipotonía neonatal, convulsiones, episodios de apnea, retraso en el desarrollo psicomotor y regresión neurológica después de los 2 años. Las imágenes cerebrales muestran una desmielinización progresiva de la sustancia blanca sin malformaciones corticales. Los análisis bioquímicos muestran una acumulación de ácidos grasos de cadena muy larga (VLCFA) resultante de una deficiencia aislada de la acil-CoA oxidasa peroxisomal.


c.591del ; NM_004035.6(ACOX1):c.832A>G ; NM_004035.6(ACOX1):c.532G>T ; c.591del ; NM_004035.6(ACOX1):c.832A>G ; NM_004035.6(ACOX1):c.532G>T



Síndrome de Omenn

El síndrome de Omenn (OS) es una enfermedad inflamatoria caracterizada por eritrodermia, descamación, alopecia, diarrea crónica, retraso en el desarrollo, linfadenopatía y hepatoesplenomegalia, asociada a una inmunodeficiencia combinada grave (SCID; véase este término).


El OS se presenta durante el primer año de vida con características de SCID, incluyendo diarrea crónica, neumonitis y retraso en el crecimiento. Además, los pacientes presentan síntomas inflamatorios que incluyen linfadenopatía, hepatoesplenomegalia y eritrodermia generalizada, que a menudo puede causar alopecia y pérdida de cejas y pestañas; la pérdida de proteínas puede provocar edema generalizado y alteraciones metabólicas. Los signos y síntomas del OS pueden evolucionar con el tiempo y pueden no aparecer simultáneamente. Algunos pacientes presentan algunos de estos síntomas, pero no todos, y pueden describirse como síndrome de Omenn atípico. El OS también puede estar asociado a trastornos sindrómicos, como la hipoplasia cartilaginosa (CHH), la deficiencia de adenosina deaminasa (ADA), la monosomía 22q11, el coloboma ocular, el síndrome CHARGE y la deficiencia de ligasa 4 (consulte estos términos).

Inmunodeficiencia combinada severa por deficiencia de adenosina deaminasa

La inmunodeficiencia combinada grave (IDCG) por deficiencia de adenosina deaminasa (ADA) es una forma de IDCG caracterizada por una linfopenia profunda y niveles muy bajos de inmunoglobulinas de todos los isotipos, lo que provoca infecciones oportunistas graves y recurrentes.


La IDCG por déficit de ADA tiene una presentación clínica variable. La forma más común se presenta en la infancia con infecciones oportunistas graves y recurrentes (incluyendo infecciones del tracto respiratorio y candidiasis), retraso en el desarrollo, y generalmente resulta en una muerte temprana. Entre el 10 y el 15% de los pacientes tienen un inicio clínico retrasado a la edad de 6-24 meses, y un porcentaje menor tiene una forma parcial de deficiencia de ADA con un inicio más tardío entre los 4 años y la edad adulta; ambos tipos muestran infecciones menos graves y un deterioro inmunológico gradual. Los pacientes también pueden presentar manifestaciones extrainmunes (incluyendo déficits del neurodesarrollo, trastornos del comportamiento, sordera neurosensorial y anomalías esqueléticas y hepáticas) como resultado de la naturaleza sistémica de la expresión de ADA.




Dermatosparaxis Síndrome de Ehlers-Danlos

Una forma del síndrome de Ehlers-Danlos (EDS) que se caracteriza por una extrema fragilidad y laxitud de la piel, una prominente gestualidad facial, excesivos hematomas y, en ocasiones, importantes complicaciones debidas a la fragilidad visceral y vascular.




NM_014244.4(ADAMTS2):c.2384G>A ; NM_014244.4(ADAMTS2):c.2384G>A




Enfermedad de almacenamiento lisosómico autosómica recesiva perteneciente al grupo de las oligosacaridosis (también llamada glucoproteinosis).


Los trastornos del ciclo de la urea se caracterizan por la tríada de hiperamonemia, encefalopatía y alcalosis respiratoria. Se han descrito cinco trastornos que implican diferentes defectos en la biosíntesis de las enzimas del ciclo de la urea: deficiencia de ornitina transcarbamilasa (311250), deficiencia de carbamil fosfato sintetasa (237300), deficiencia de argininosuccinato sintetasa o citrulinemia (215700), deficiencia de argininosuccinato liasa (207900) y deficiencia de arginasa.


NM_000027.3(AGA):c.755G>A ; NM_000027.3(AGA):c.302C>T ; NM_000027.4(AGA):c.800dup ; NM_000027.3(AGA):c.904G>A ; NM_000027.3(AGA):c.488G>C ; NM_000027.3(AGA):c.214T>C ; NM_000027.3(AGA):c.755G>A ; NM_000027.3(AGA):c.302C>T ; NM_000027.4(AGA):c.800dup ; NM_000027.3(AGA):c.904G>A ; NM_000027.3(AGA):c.488G>C ; NM_000027.3(AGA):c.214T>C



Enfermedad por almacenamiento de glucógeno debida a la deficiencia de la enzima desramificadora del glucógeno

La deficiencia de la enzima de desramificación del glucógeno (GDE), o enfermedad por almacenamiento de glucógeno tipo 3 (GSD 3), es una forma de enfermedad por almacenamiento de glucógeno caracterizada por una debilidad muscular grave y hepatopatía.


La EAG 3 suele aparecer en la primera infancia. Los niños presentan hepatomegalia, retraso en el crecimiento y convulsiones ocasionales relacionadas con la hipoglucemia. La hepatomegalia puede desaparecer con la edad adulta. La debilidad muscular es lentamente progresiva. Otros signos frecuentemente asociados son la hipotonía muscular y la cardiomiopatía hipertrófica. Los síntomas suelen mejorar en la pubertad, excepto en los pocos casos en los que aparece cirrosis o miopatía. Los hallazgos biológicos incluyen hipoglucemia sin acidosis, hipertrigliceridemia e hipertransaminasemia durante la infancia.


NM_000642.2(AGL):c.1222C>T ; NM_000642.2(AGL):c.1485delT ; NM_000642.2(AGL):c.3216_3217delGA ; NM_000642.2(AGL):c.4342G>C ; NM_000642.3:c.4456delT ; NM_000642.2(AGL):c.294-2A>T ; NM_000642.2(AGL):c.2590C>T ; NM_000642.2(AGL):c.4529dupA ; NM_000642.2(AGL):c.18_19delGA ; NM_000642.2(AGL):c.2039G>A ; NM_000642.2(AGL):c.16C>T ; NM_000642.2(AGL):c.4260-12A>G ; NM_000642.2(AGL):c.1999del ; NM_000642.2(AGL):c.3980G>A ; c.1783C>T ; c.4260-1G>T ; NM_000642.2(AGL):c.1222C>T ; NM_000642.2(AGL):c.1485delT ; NM_000642.2(AGL):c.3216_3217delGA ; NM_000642.2(AGL):c.4342G>C ; NM_000642.3:c.4456delT ; NM_000642.2(AGL):c.294-2A>T ; NM_000642.2(AGL):c.2590C>T ; NM_000642.2(AGL):c.4529dupA ; NM_000642.2(AGL):c.18_19delGA ; NM_000642.2(AGL):c.2039G>A ; NM_000642.2(AGL):c.16C>T ; NM_000642.2(AGL):c.4260-12A>G ; NM_000642.2(AGL):c.1999del ; NM_000642.2(AGL):c.3980G>A ; c.1783C>T ; c.4260-1G>T



Condrodisplasia punctata rizomélica tipo 3

Una rara displasia ósea primaria caracterizada por un acortamiento rizomélico de las extremidades, calcificaciones punteadas en el cartílago con anomalías epifisarias y metafisarias (condrodisplasia punctata) y vértebras con hendidura coronal asociadas a una profunda deficiencia de crecimiento postnatal, cataratas de aparición temprana, discapacidad intelectual grave y convulsiones.


La presentación es al nacimiento con contracturas articulares graves; las cataratas pueden estar presentes o aparecer en los primeros meses de vida. Tras el nacimiento, es frecuente observar dificultades respiratorias y de alimentación. Mientras que los parámetros de nacimiento (peso, longitud y perímetro cefálico) están en el rango inferior de lo normal, se produce un profundo retraso del crecimiento postnatal. El acortamiento rizomélico de las extremidades suele ser mayor en el húmero que en el fémur. Otras anomalías esqueléticas incluyen calcificaciones puntuales en el cartílago con anomalías epifisarias y metafisarias (condrodisplasia punctata) y vértebras con hendidura coronal. La discapacidad intelectual es grave y la mayoría de los niños desarrollan convulsiones.


NM_003659.3(AGPS):c.926C>T ; NM_003659.3(AGPS):c.1406T>C ; NM_003659.3(AGPS):c.1703C>T ; NM_003659.3(AGPS):c.1256G>A ; NM_003659.3(AGPS):c.926C>T ; NM_003659.3(AGPS):c.1406T>C ; NM_003659.3(AGPS):c.1703C>T ; NM_003659.3(AGPS):c.1256G>A



Hiperoxaluria primaria tipo 1

Se trata de un trastorno del metabolismo del glioxilato que se caracteriza por un exceso de oxalato que provoca cálculos renales, nefrocalcinosis y, en última instancia, insuficiencia renal y oxalosis sistémica. Existen 3 tipos de PH, los tipos 1-3, todos ellos causados por defectos enzimáticos específicos del hígado.


La hiperoxaluria puede provocar cálculos renales, nefrocalcinosis y, en última instancia, insuficiencia renal y oxalosis sistémica. Los síntomas pueden aparecer a cualquier edad y pueden variar desde el retraso en el desarrollo infantil y la nefrocalcinosis cortical con insuficiencia renal hasta la hematuria, la nefrocalcinosis medular o la litiasis esporádica, incluso dentro de una misma familia. La PH1 es la forma más grave; en general, más del 70% de los pacientes con PH1 desarrollan una enfermedad renal terminal con el tiempo; esto puede ocurrir incluso en pacientes con enfermedad de cálculos esporádica. El almacenamiento de oxalato se produce en la insuficiencia renal grave y puede afectar a los huesos, los ojos, el corazón, las arterias y los nervios periféricos (oxalosis sistémica). La PH2 tiene un curso más benigno; no se ha descrito ninguna oxalosis infantil y la enfermedad renal terminal se produce a una edad relativamente tardía en aproximadamente el 20% de los pacientes. La PH3 es más benigna y hasta ahora sólo se han descrito algunos casos de insuficiencia renal y ninguna enfermedad renal terminal.


NM_000030.2(AGXT):c.454T>A ; NM_000030.2(AGXT):c.698G>A ; NM_000030.2(AGXT):c.33dupC ; NM_000030.2(AGXT):c.248A>G ; NM_000030.2(AGXT):c.322T>C ; NM_000030.2(AGXT):c.560C>T ; NM_000030.2(AGXT):c.245G>A ; NM_000030.2(AGXT):c.508G>A ; NM_000030.2(AGXT):c.613T>C ; NM_000030.2(AGXT):c.738G>A ; NM_000030.3:c.121G>A ; NM_000030.2(AGXT):c.731T>C ; NM_000030.2(AGXT):c.697C>T ; NM_000030.2(AGXT):c.466G>A ; c.166-2A>G ; NM_000030.2(AGXT):c.454T>A ; NM_000030.2(AGXT):c.698G>A ; NM_000030.2(AGXT):c.33dupC ; NM_000030.2(AGXT):c.248A>G ; NM_000030.2(AGXT):c.322T>C ; NM_000030.2(AGXT):c.560C>T ; NM_000030.2(AGXT):c.245G>A ; NM_000030.2(AGXT):c.508G>A ; NM_000030.2(AGXT):c.613T>C ; NM_000030.2(AGXT):c.738G>A ; NM_000030.3:c.121G>A ; NM_000030.2(AGXT):c.731T>C ; NM_000030.2(AGXT):c.697C>T ; NM_000030.2(AGXT):c.466G>A ; c.166-2A>G



Intolerancia hereditaria a la fructosa

La intolerancia hereditaria a la fructosa (HFI) es un trastorno autosómico recesivo del metabolismo de la fructosa (véase este término), que resulta de una deficiencia de la actividad de la fructosa-1-fosfato aldolasa hepática y que provoca trastornos gastrointestinales e hipoglucemia postprandial tras la ingestión de fructosa. La HFI es una enfermedad benigna cuando se trata, pero es potencialmente mortal si no se trata.


La HFI suele presentarse en la infancia en el momento del destete (cuando se añade fructosa a la dieta), manifestándose con hipoglucemia, acidosis láctica, cetosis con vómitos recurrentes, dolor abdominal y manifestaciones sistémicas tras el consumo de alimentos que contienen fructosa. La ingestión persistente de fructosa y azúcares afines (como la sacarosa y el sorbitol) puede provocar un retraso del crecimiento, hepatomegalia, disfunción tubular proximal, insuficiencia hepática y renal, convulsiones, coma y riesgo de muerte. Todos los pacientes llegan a la edad adulta, desarrollan una aversión natural a la fruta/dulce y refieren una historia de vómitos e hipoglucemia de por vida tras la ingestión de fructosa. La caries dental está ausente en una proporción significativa de la población adulta con HFI (lo que puede dar una pista para el diagnóstico). A veces, el diagnóstico puede hacerse en un adulto que, debido a su aversión a la fructosa, ha excluido desde la infancia todos los alimentos que contienen fructosa.


NM_000035.4(ALDOB):c.1013C>T ; NM_000035.4(ALDOB):c.720C>A ; NM_000035.4(ALDOB):c.442T>C ; c.1067C>A ; NM_000035.4(ALDOB):c.178C>T ; NM_000035.3(ALDOB):c.113-1_115delGGTA ; NM_000035.4(ALDOB):c.1005C>G ; NM_000035.4(ALDOB):c.10C>T ; NM_000035.3(ALDOB):c.360_363delCAAA ; NM_000035.4(ALDOB):c.448G>C ; NM_000035.4(ALDOB):c.524C>A ; c.2T>C ; NM_000035.4(ALDOB):c.612T>A ; NM_000035.4(ALDOB):c.1013C>T ; NM_000035.4(ALDOB):c.720C>A ; NM_000035.4(ALDOB):c.442T>C ; c.1067C>A ; NM_000035.4(ALDOB):c.178C>T ; NM_000035.3(ALDOB):c.113-1_115delGGTA ; NM_000035.4(ALDOB):c.1005C>G ; NM_000035.4(ALDOB):c.10C>T ; NM_000035.3(ALDOB):c.360_363delCAAA ; NM_000035.4(ALDOB):c.448G>C ; NM_000035.4(ALDOB):c.524C>A ; c.2T>C ; NM_000035.4(ALDOB):c.612T>A




Se trata de una forma de trastornos congénitos de la glicosilación ligada a N que se caracteriza por problemas de alimentación, afectación neurológica de leve a moderada con hipotonía, mal control de la cabeza, retraso del desarrollo, ataxia, estrabismo y convulsiones, que van desde convulsiones febriles hasta epilepsia. También se ha informado de degeneración de la retina. Una minoría de pacientes presenta otras manifestaciones, especialmente intestinales (como enteropatía con pérdida de proteínas) y hepáticas. La enfermedad está causada por mutaciones de pérdida de función del gen ALG6 (1p31.3).


Se trata de una forma de trastornos congénitos de la glicosilación ligada al N que se caracteriza por problemas de alimentación, afectación neurológica de leve a moderada con hipotonía, mal control de la cabeza, retraso del desarrollo, ataxia, estrabismo y convulsiones, que van desde las convulsiones febriles hasta la epilepsia. También se ha informado de degeneración de la retina. Una minoría de pacientes presenta otras manifestaciones, especialmente intestinales (como enteropatía con pérdida de proteínas) y hepáticas. La enfermedad está causada por mutaciones de pérdida de función del gen ALG6 (1p31.3).


NM_013339.4(ALG6):c.1432T>C ; NM_013339.4(ALG6):c.998C>T ; NM_013339.3(ALG6):c.897_899del ; c.316C>T ; NM_013339.4(ALG6):c.1432T>C ; NM_013339.4(ALG6):c.998C>T ; NM_013339.3(ALG6):c.897_899del ; c.316C>T



Síndrome de Alstr�m

Un raro trastorno multisistémico caracterizado por distrofia de conos, pérdida de audición, obesidad, resistencia a la insulina e hiperinsulinemia, diabetes mellitus de tipo 2, cardiomiopatía dilatada (MCD) y disfunción hepática y renal progresiva.


Las características clínicas, la edad de aparición y la gravedad pueden variar mucho entre las familias y dentro de ellas. La distrofia de la retina de conos suele desarrollarse a las pocas semanas de nacer, siendo los primeros síntomas el nistagmo y la extrema fotodisforia o sensibilidad a la luz. Es progresiva y conduce a la ceguera, normalmente en la segunda década de vida. La mayoría de los pacientes desarrollan una pérdida de audición neurosensorial bilateral de leve a moderada y lentamente progresiva. Hay indicios de fibrosis multiorgánica en la EA. La MCD se manifiesta en aproximadamente 2/3 de los pacientes, ya sea en la infancia o en la adolescencia. Los pacientes corren el riesgo de sufrir una insuficiencia cardíaca congestiva repentina a cualquier edad. La obesidad con hiperfagia, la resistencia a la insulina y la hiperinsulinemia son características tempranas y constantes. La disfunción hepática suele comenzar en la infancia con esteatosis (hígado graso). En algunos casos, puede producirse cirrosis, hipertensión portal e insuficiencia hepática. Son frecuentes las enfermedades respiratorias crónicas (bronquitis/neumonía), la hipertensión pulmonar, la otitis media recurrente y la hipertrigliceridemia. La nefropatía lentamente progresiva puede conducir a una insuficiencia renal terminal. Los pacientes tienen características faciales distintivas (pelo fino, calvicie frontal prematura, ojos hundidos con cara redonda y orejas gruesas). La mayoría de los niños tienen los característicos pies anchos, gruesos y planos, y dedos de las manos y los pies cortos y rechonchos, sin polidactilia ni sindactilia. También se ha informado de hipogonadismo en los hombres/hiperandrogenismo en las mujeres. La mayoría de los pacientes tienen una inteligencia normal, aunque algunos informes han indicado un retraso en el desarrollo global y una discapacidad intelectual. Como algunos fenotipos se desarrollan lentamente a lo largo del tiempo, también se han notificado presentaciones no clásicas.


ENST00000613296.5:c.888_904del ; NM_015120.4(ALMS1):c.11618_11619delCT ; NM_015120.4(ALMS1):c.8383C>T ; ENST00000613296.5:c.11608_11609del ; ENST00000613296.5:c.11449dup ; NM_015120.4(ALMS1):c.11316_11319delAGAG ; NM_015120.4(ALMS1):c.11449C>T ; ENST00000613296.5:c.1571_1573delinsT ; ENST00000613296.5:c.10576_10577del ; NM_015120.4(ALMS1):c.8164C>T ; NM_015120.4(ALMS1):c.10775delC ; ENST00000613296.5:c.9908-1G>A ; ENST00000613296.5:c.888_904del ; NM_015120.4(ALMS1):c.11618_11619delCT ; NM_015120.4(ALMS1):c.8383C>T ; ENST00000613296.5:c.11608_11609del ; ENST00000613296.5:c.11449dup ; NM_015120.4(ALMS1):c.11316_11319delAGAG ; NM_015120.4(ALMS1):c.11449C>T ; ENST00000613296.5:c.1571_1573delinsT ; ENST00000613296.5:c.10576_10577del ; NM_015120.4(ALMS1):c.8164C>T ; NM_015120.4(ALMS1):c.10775delC ; ENST00000613296.5:c.9908-1G>A



Hipofosfatasia adulta

Forma moderada de hipofosfatasia (HPP) caracterizada por osteomalacia de inicio en la edad adulta, condrocalcinosis, osteoartropatía, fracturas por estrés y anomalías dentales.


La HPP en adultos es clínicamente muy heterogénea. En su forma más leve es la forma menos grave de hipofosfatasia (HPP), caracterizada por síntomas inespecíficos en edades avanzadas, como osteoporosis, dolor musculoesquelético, condrocalcinosis. La mayoría de los pacientes presentan rasgos durante la mediana edad, pero algunos pueden haber tenido una historia de raquitismo leve u otras manifestaciones musculoesqueléticas en la infancia. Los rasgos cardinales son las fracturas por estrés y las pseudofracturas de las extremidades inferiores, junto con el dolor de pies, muslos y caderas. Los tipos de fracturas más comunes son las metatarsales y las pseudofracturas de tibia y fémur. Con la edad pueden aparecer osteomalacia, condrocalcinosis y osteoartropatía. Algunos pacientes informan de la pérdida temprana de la dentición primaria. La pérdida de la dentición permanente también es frecuente y se describen algunos casos de hipoplasia del esmalte y movilidad dental. Los pacientes con la forma adulta de HPP pueden haber tenido algunas manifestaciones en los primeros años de vida, entre el periodo prenatal y la infancia (HPP benigna prenatal o HPP infantil). La presencia de síntomas óseos (osteomalacia, fracturas) distingue la HPP adulta de la odontohipofosfatasia.

Hipofosfatasia infantil

Una forma rara y moderada de hipofosfatasia (HPP) caracterizada por la aparición después de los seis meses de edad y características clínicas muy variables, desde una baja densidad mineral ósea para la edad, hasta fracturas inexplicables, deformidades esqueléticas y raquitismo con baja estatura y marcha de pato.


Los pacientes desarrollan manifestaciones después de los seis meses de edad y generalmente antes de los cinco años. Las manifestaciones clínicas cubren un amplio espectro. Por lo general, los pacientes presentan raquitismo, lo que da lugar a una baja estatura, con un retraso en la marcha y un paso de pato, así como dolores óseos y articulares. Las deformidades esqueléticas pueden incluir un cráneo dolicocéfalo y articulaciones agrandadas. Otras características comunes son los signos de hipertensión intracraneal y el retraso en el crecimiento. Son frecuentes las fracturas diafisarias y metafisarias. Algunos niños afectados presentan una pérdida prematura de los dientes deciduos, empezando por los incisivos y luego la pérdida de otros dientes con raíces intactas, antes de los cinco años de edad. La enfermedad puede seguir un curso intermitente con remisión y recurrencia en etapas posteriores de la vida. Puede haber cierto solapamiento clínico entre la HPP de inicio en la infancia y la HPP infantil moderadamente grave.


Una forma rara, grave y genética de hipofosfatasia (HPP) caracterizada por raquitismo infantil sin actividad elevada de la fosfatasa alcalina (ALP) sérica y una amplia gama de manifestaciones clínicas debidas a la hipomineralización.


Los individuos con HPP infantil pueden ser normales al nacer. Los signos clínicos que se asemejan al raquitismo se encuentran generalmente entre el nacimiento y los seis meses de edad. Las manifestaciones iniciales pueden incluir irritabilidad, mala alimentación, retraso en el crecimiento, hipotonía y, más raramente, convulsiones. Otros rasgos clínicos son el retraso del crecimiento, la baja estatura, las escleróticas azules, la hipomineralización ósea (reblandecimiento o adelgazamiento del cráneo, costillas raquíticas, escoliosis, engrosamiento de muñecas y tobillos y arqueamiento de los huesos largos), craneosinostosis (posiblemente con aumento de la presión intracraneal), ligamentos laxos e hipercalciuria/hipercalcemia. Algunos pacientes presentan una pérdida prematura de los dientes de leche. En algunos niños mayores se han registrado daños renales (nefrocalcinosis por hipercalciuria). La gravedad es variable, pero muchos pacientes afectados corren el riesgo de padecer insuficiencia respiratoria debido a las deformidades raquíticas del tórax durante el primer año de vida. Puede haber cierto solapamiento clínico con la forma moderada, clasificada como HPP de inicio en la infancia.

Hipofosfatasia odontogénica

Una forma particular de hipofosfatasia (HPP) caracterizada por una actividad reducida de la fosfatasa alcalina sérica no fraccionada, exfoliación prematura de los dientes primarios y/o permanentes y/o caries dental grave, en ausencia de anomalías del sistema esquelético.


La característica principal de la odontofosfatasia es la exfoliación prematura de los dientes primarios completamente enraizados y/o la caries dental severa. Los dientes anteriores caducos son los más afectados, junto con los incisivos. Las radiografías revelan una reducción del hueso alveolar, una disminución del grosor de la dentina y un aumento de las cámaras pulpares y de los conductos radiculares. Los pacientes con otras formas de HPP suelen tener manifestaciones dentales, pero éstas siempre están asociadas a anomalías esqueléticas y otras manifestaciones.

Hipofosfatasia letal perinatal

Una forma rara y genética de hipofosfatasia (HPP) caracterizada por una marcada alteración de la mineralización ósea en el útero debido a una actividad reducida de la fosfatasa alcalina (ALP) sérica y que provoca el nacimiento de un bebé muerto o una insuficiencia respiratoria a los pocos días de nacer.


Los bebés afectados pueden presentar unos característicos espolones osteocondrales cubiertos de piel que sobresalen de los antebrazos o las piernas y, a menudo, una pequeña cavidad torácica. Pueden presentar hipercalcemia asociada a apnea o convulsiones, y un marcado acortamiento de los huesos largos. Los pacientes rara vez sobreviven más de unos días debido al tamaño inadecuado del tórax, los pulmones hipoplásicos y las deformidades raquíticas, que conducen a la insuficiencia respiratoria.

Hipofosfatasia prenatal benigna

Una forma muy rara de hipofosfatasia caracterizada por manifestaciones esqueléticas prenatales (acortamiento y arqueamiento de las extremidades) que se resuelven lentamente de forma espontánea y que más tarde pueden evolucionar hacia las formas moderadas de la enfermedad en la infancia o en la edad adulta.


La PB-HPP puede identificarse en el examen ecográfico prenatal. Los pacientes manifiestan un acortamiento y arqueamiento variable de las extremidades y a menudo presentan hoyuelos que se superponen a las deformidades de los huesos largos. Tras el nacimiento, las manifestaciones esqueléticas se resuelven lentamente y los pacientes acaban desarrollando manifestaciones correspondientes a otras formas no letales de HPP (hipofosfatasia de inicio en la infancia, en la edad adulta u odontofosfatasia). Las pacientes presentan una mejora progresiva de las anomalías esqueléticas y de la mineralización durante el tercer trimestre del embarazo y después del nacimiento. Las madres de los bebés afectados suelen tener pruebas bioquímicas de hipofosfatasia pero no presentan manifestaciones clínicas.


NM_000478.5(ALPL):c.211C>T ; NM_000478.5(ALPL):c.814C>T ; NM_000478.5(ALPL):c.98C>T ; NM_000478.4(ALPL):c.571G>A ; NM_000478.6(ALPL):c.407G>A ; NM_000478.5(ALPL):c.1366G>A ; NM_000478.5(ALPL):c.1250A>G ; NM_000478.4(ALPL):c.1133A>T ; NM_000478.5(ALPL):c.1001G>A ; NM_000478.5(ALPL):c.620A>C ; NM_000478.5(ALPL):c.881A>C ; NM_000478.5(ALPL):c.535G>A ; NM_000478.5(ALPL):c.526G>A ; NM_000478.5(ALPL):c.1306T>C ; NM_000478.5(ALPL):c.892G>A ; NM_000478.5(ALPL):c.212G>C ; NM_000478.5(ALPL):c.323C>T ; NM_000478.4(ALPL):c.346G>A ; NM_000478.5(ALPL):c.211C>T ; NM_000478.5(ALPL):c.814C>T ; NM_000478.5(ALPL):c.98C>T ; NM_000478.4(ALPL):c.571G>A ; NM_000478.6(ALPL):c.407G>A ; NM_000478.5(ALPL):c.1366G>A ; NM_000478.5(ALPL):c.1250A>G ; NM_000478.4(ALPL):c.1133A>T ; NM_000478.5(ALPL):c.1001G>A ; NM_000478.5(ALPL):c.620A>C ; NM_000478.5(ALPL):c.881A>C ; NM_000478.5(ALPL):c.535G>A ; NM_000478.5(ALPL):c.526G>A ; NM_000478.5(ALPL):c.1306T>C ; NM_000478.5(ALPL):c.892G>A ; NM_000478.5(ALPL):c.212G>C ; NM_000478.5(ALPL):c.323C>T ; NM_000478.4(ALPL):c.346G>A



Encefalopatía atípica por glicina

Una forma rara de encefalopatía por glicina que presenta un inicio de la enfermedad o manifestaciones clínicas que difieren de la encefalopatía por glicina neonatal o infantil.


Los síntomas son en su mayoría inespecíficos y no son similares a los síntomas neurológicos graves observados en la GE neonatal e infantil (ver estos términos). Algunos pacientes tienen una enfermedad más leve con un inicio desde la infancia tardía hasta la edad adulta, mientras que otros tienen una enfermedad grave rápidamente progresiva a menudo de inicio tardío. También incluye a los pacientes con hiperglicinemia transitoria, cuyos síntomas en el periodo neonatal se asemejan a los de la forma neonatal. Las manifestaciones incluyen el deterioro cognitivo, los trastornos del comportamiento, la ataxia, la neuropatía periférica y la atrofia óptica.

Encefalopatía glicínica infantil

La encefalopatía infantil por glicina es una forma de leve a grave de la encefalopatía por glicina (GE; véase este término), caracterizada por hipotonía temprana, retraso en el desarrollo y convulsiones.


Los pacientes presentan convulsiones de inicio infantil y un retraso psicomotor variable tras un desarrollo inicialmente normal, y a menudo tienen una historia relativamente larga de hipotonía. En menos de la mitad de los pacientes se producen convulsiones de cualquier tipo y algunos desarrollan coreoatetosis. El retraso del desarrollo afecta sobre todo al lenguaje y a veces se encuentran problemas de comportamiento, como rabietas, irritabilidad, agresividad y rabia. A veces también se encuentra el trastorno por déficit de atención e hiperactividad (TDAH). Los pacientes no presentan letargo o coma en el periodo neonatal, a diferencia de los que padecen GE neonatal. El curso puede ser leve o grave (50% de los pacientes en cada caso).

Encefalopatía neonatal por glicina

La encefalopatía neonatal por glicina es una forma frecuente y generalmente grave de encefalopatía por glicina (GE; véase este término) que se caracteriza por coma, apnea, hipotonía, convulsiones y sacudidas mioclónicas en el periodo neonatal, y un posterior retraso en el desarrollo.


Los pacientes desarrollan manifestaciones de la enfermedad en las primeras horas o días de vida. Los síntomas incluyen letargia progresiva, hipotonía, sacudidas mioclónicas que conducen a la apnea. En ausencia de intubación y ventilación, la apnea puede ser mortal. Con medidas de apoyo, la mayoría de los pacientes recuperan la respiración espontánea y algunos muestran una mejora del estado de alerta con el tiempo. Posteriormente, presentan un profundo déficit intelectual y convulsiones cada vez más intratables durante el primer año de vida, que a menudo requieren múltiples anticonvulsivos. En la gran mayoría de los casos (85%), el curso es grave, pero algunos pacientes tienen un curso más leve y un resultado clínico menos grave. En los casos graves, los pacientes progresan poco en su desarrollo y tienen una interacción limitada con su entorno. También se ha informado de espasticidad temprana, escoliosis y pies zambos. En los casos más leves, el progreso del desarrollo es considerablemente mayor y los pacientes aprenden a caminar y a interactuar, y las convulsiones suelen ser más fáciles de tratar.


NM_000481.3(AMT):c.259-1G>C ; NM_000481.3(AMT):c.574C>T ; NM_000481.3(AMT):c.959G>A ; NM_000481.3(AMT):c.826G>C ; NM_000481.3(AMT):c.806G>A ; NM_000481.4:c.125A>G ; NM_000481.3(AMT):c.259-1G>C ; NM_000481.3(AMT):c.574C>T ; NM_000481.3(AMT):c.959G>A ; NM_000481.3(AMT):c.826G>C ; NM_000481.3(AMT):c.806G>A ; NM_000481.4:c.125A>G



Síndrome de insensibilidad completa a los andrógenos

El síndrome de insensibilidad completa a los andrógenos (CAIS) es una forma del síndrome de insensibilidad a los andrógenos (AIS; véase este término), un trastorno del desarrollo sexual (DSD), caracterizado por la presencia de genitales externos femeninos en un individuo 46,XY con un desarrollo testicular normal pero con testículos no descendidos y sin respuesta a los niveles de andrógenos apropiados para su edad.


La presentación típica es la amenorrea primaria en una mujer adolescente. El CAIS también puede presentarse en la infancia o en la niñez con una hernia inguinal o una inflamación labial que contiene un testículo. El desarrollo de las mamas en la pubertad es normal, pero el vello púbico y axilar está ausente o es escaso. Los genitales externos son normales en la mujer, pero los internos están ausentes. Los pacientes adultos son altos. Otras presentaciones pueden ser fortuitas, debido a un desajuste en el sexado prenatal (XY) y el fenotipo femenino al nacer, la historia de una reparación de hernia inguinal en una hermana mayor, o el desarrollo de un tumor pélvico en la vida adulta posterior.

Enfermedad de Kennedy

La enfermedad de Kennedy, también conocida como atrofia muscular bulboespinal (BSMA), es una rara enfermedad de la neurona motora recesiva ligada al cromosoma X que se caracteriza por el desgaste muscular proximal y bulbar.


El inicio de la enfermedad se produce entre los 30-60 años de edad. Las manifestaciones clínicas iniciales incluyen temblores, calambres musculares, espasmos musculares, fatiga y dificultad para hablar. Con la progresión de la enfermedad, los pacientes desarrollan además debilidad y desgaste de las extremidades y de los músculos bulbares, que se manifiestan como disartria, disfonía, mandíbula colgante, desgaste de la lengua, dificultad para masticar y deterioro de la movilidad. El deterioro intelectual es mínimo o nulo. En las fases terminales de la enfermedad, algunos pacientes pueden ser incapaces de tragar o respirar. Las manifestaciones no neurológicas incluyen la ginecomastia, el hipogonadismo (que conduce a la infertilidad y la impotencia) y, en casos raros, la contractura de Dupuytren o la hernia inguinal.

Síndrome de insensibilidad parcial a los andrógenos

Un trastorno del desarrollo sexual (DSD) distinto del AIS completo (CAIS) caracterizado por la presencia de un desarrollo genital anormal en un individuo 46,XY con un desarrollo testicular normal y una respuesta parcial a los niveles de andrógenos apropiados para la edad.


Los pacientes tienen un aspecto genital muy variable. La forma prototípica de presentación es una hipospadias severa, micropene y escroto bífido en el que los testículos pueden o no estar descendidos. En la forma más grave de PAIS, los pacientes tienen genitales externos femeninos con clitoromegalia, fusión labial parcial e hinchazón labial que comprende los testículos. En el extremo más leve del espectro, denominado MAIS (AIS leve o mínimo), se trata de un varón con ginecomastia en la pubertad o un adulto que presenta infertilidad por factor masculino.

Hipospadias posterior

Malformación congénita del tracto urogenital, rara y no sindrómica, que afecta a los varones y se caracteriza por el desplazamiento penoscópico, escrotal o perineal del meato uretral, y se asocia habitualmente a la curvatura del pene. El escroto puede parecer bífido en los casos graves, y el niño también puede tener un micropene.


Las consecuencias de la hipospadias, además de su aspecto, incluyen la pulverización del chorro urinario, la incapacidad de orinar en posición de pie y, más adelante, la curvatura, que si no se corrige, provoca dificultades durante el coito. Son más frecuentes los problemas de fertilidad y la disminución de la satisfacción con el aspecto genital. La hipospadias grave y los testículos no descendidos concomitantes se consideran un trastorno del desarrollo sexual (DSD) y deben remitirse a equipos multidisciplinarios especiales para una evaluación molecular y hormonal.


NM_000044.4(AR):c.2567G>A ; NM_000044.4(AR):c.2395C>G ; NM_000044.4(AR):c.1771A>T ; NM_000044.4(AR):c.2391G>A ; c.340C>T ; NM_000044.4(AR):c.2650A>T ; NM_000044.4(AR):c.2323C>T ; NM_000044.4(AR):c.2567G>A ; NM_000044.4(AR):c.2395C>G ; NM_000044.4(AR):c.1771A>T ; NM_000044.4(AR):c.2391G>A ; c.340C>T ; NM_000044.4(AR):c.2650A>T ; NM_000044.4(AR):c.2323C>T




Un raro trastorno autosómico recesivo del metabolismo de los aminoácidos caracterizado clínicamente por grados variables de hiperamonemia, que se desarrolla a partir de los 3 años de edad aproximadamente, y que conduce a la pérdida progresiva de los hitos del desarrollo y a la espasticidad en ausencia de tratamiento.


Trastorno raro del metabolismo de los aminoácidos, autosómico y recesivo, caracterizado clínicamente por grados variables de hiperamonemia, que se desarrolla a partir de los 3 años de edad aproximadamente, y que conduce a la pérdida progresiva de los hitos del desarrollo y a la espasticidad en ausencia de tratamiento.


NM_000045.3(ARG1):c.869C>G ; NM_000045.3(ARG1):c.32T>C ; NM_000045.3(ARG1):c.703G>C ; NM_000045.3(ARG1):c.365G>A ; NM_000045.3(ARG1):c.413G>T ; NM_000045.3(ARG1):c.61C>T ; NM_000045.3(ARG1):c.871C>T ; NM_000045.3(ARG1):c.869C>G ; NM_000045.3(ARG1):c.32T>C ; NM_000045.3(ARG1):c.703G>C ; NM_000045.3(ARG1):c.365G>A ; NM_000045.3(ARG1):c.413G>T ; NM_000045.3(ARG1):c.61C>T ; NM_000045.3(ARG1):c.871C>T



Leucodistrofia metacromática, forma adulta

Un subtipo de leucodistrofia metacromática caracterizado por una regresión psicomotriz progresiva con un inicio insidioso después de los 16 años, que suele comenzar con cambios intelectuales y de comportamiento, como déficits de memoria o inestabilidad emocional. El cuadro clínico está dominado por un declive cognitivo gradual, y más tarde también motor, que sigue un curso prolongado con períodos de crecimiento y decadencia. La decadencia y la muerte se producen décadas después del inicio de la enfermedad.


Un subtipo de leucodistrofia metacromática caracterizado por una regresión psicomotriz progresiva con un inicio insidioso después de los 16 años, que suele comenzar con cambios intelectuales y de comportamiento, como déficits de memoria o inestabilidad emocional. El cuadro clínico está dominado por un declive cognitivo gradual, y más tarde también motor, que sigue un curso prolongado con períodos de aumento y disminución. La decadencia y la muerte se producen décadas después del inicio de la enfermedad.

Leucodistrofia metacromática, forma juvenil

Un subtipo de leucodistrofia metacromática que se caracteriza por una regresión psicomotriz progresiva con un inicio entre los 30 meses y los 16 años de edad, que suele comenzar con anomalías de comportamiento o deterioro del rendimiento escolar. Otras manifestaciones son la ataxia, los trastornos de la marcha, la reducción de los reflejos tendinosos profundos, la espasticidad, las convulsiones, la parálisis, la demencia y la pérdida del habla, de la visión y de la audición, que acaban provocando la pérdida completa de las capacidades motoras y cognitivas y la descerebración. El ritmo de deterioro es variable, con una posible supervivencia hasta la tercera década de vida.


Un subtipo de leucodistrofia metacromática que se caracteriza por una regresión psicomotriz progresiva con un inicio entre los 30 meses y los 16 años de edad, que suele comenzar con anomalías de comportamiento o deterioro del rendimiento escolar. Otras manifestaciones son la ataxia, los trastornos de la marcha, la reducción de los reflejos tendinosos profundos, la espasticidad, las convulsiones, la parálisis, la demencia y la pérdida del habla, de la visión y de la audición, que acaban provocando la pérdida completa de las capacidades motoras y cognitivas y la descerebración. El ritmo de deterioro es variable, con una posible supervivencia hasta la tercera década de vida.

Leucodistrofia metacromática, forma infantil tardía

Subtipo de leucodistrofia metacromática que se caracteriza por una regresión psicomotriz rápidamente progresiva con un inicio antes de los 30 meses de edad tras un periodo de desarrollo aparentemente normal. Las manifestaciones que se desarrollan durante el curso de la enfermedad son alteraciones de la alimentación y la deglución debido a parálisis pseudobulbares, convulsiones, espasmos dolorosos, debilidad muscular, ataxia, parálisis, demencia y pérdida del habla, la visión y la audición, que rápidamente desembocan en la pérdida completa de las habilidades motoras y cognitivas y en la descerebración. La muerte se produce en la primera década de vida.


Subtipo de leucodistrofia metacromática que se caracteriza por una regresión psicomotriz rápidamente progresiva con un inicio antes de los 30 meses de edad tras un periodo de desarrollo aparentemente normal. Las manifestaciones que se desarrollan durante el curso de la enfermedad son alteraciones de la alimentación y la deglución debido a parálisis pseudobulbares, convulsiones, espasmos dolorosos, debilidad muscular, ataxia, parálisis, demencia y pérdida del habla, la visión y la audición, que rápidamente desembocan en la pérdida completa de las habilidades motoras y cognitivas y en la descerebración. La muerte se produce en la primera década de vida.

NO RARA EN EUROPA: Deficiencia de pseudoarilsulfatasa A

Las leucodistrofias metacromáticas comprenden varios trastornos alélicos. Kihara (1982) reconoció 5 formas alélicas de LDM: formas infantiles tardías, juveniles y adultas, deficiencia parcial de cerebrosulfato y deficiencia de pseudoarilsulfatasa A; y 2 formas no alélicas: leucodistrofia metacromática por deficiencia de saposina B y deficiencia múltiple de sulfatasa o sulfatidosis juvenil, un trastorno que combina características de una mucopolisacaridosis con las de la leucodistrofia metacromática.


La deficiencia de pseudoarilsulfatasa A se refiere a una condición de aparente deficiencia de la enzima ARSA en personas sin anormalidades neurológicas. Dubois et al. (1977) describieron actividades muy bajas de arilsulfatasa A y cerebrósido sulfatasa en leucocitos de miembros sanos de una familia con leucodistrofia metacromática. Langenbeck et al. (1977) propusieron una hipótesis de un locus y múltiples alelos para explicar los hallazgos peculiares en esa familia


NM_000487.5(ARSA):c.1108-2A>G ; NM_000487.5(ARSA):c.991G>T ; NM_000487.5(ARSA):c.763G>A ; NM_000487.5(ARSA):c.542T>G ; NM_000487.5(ARSA):c.979G>A ; NM_000487.5(ARSA):c.302G>A ; NM_000487.5(ARSA):c.257G>A ; NM_000487.5(ARSA):c.293C>T ; NM_000487.5(ARSA):c.1125_1126delCT ; NM_000487.5(ARSA):c.346C>T ; NM_000487.5(ARSA):c.1210+1G>A ; c.1401_1411del ; NM_000487.5(ARSA):c.883G>A ; NM_000487.5(ARSA):c.465+1G>A ; NM_000487.5(ARSA):c.739G>A ; c.854+1G>A ; NM_000487.5(ARSA):c.827C>T ; NM_000487.5(ARSA):c.937C>T ; NM_000487.5(ARSA):c.583delT ; NM_000487.5(ARSA):c.737G>A ; NM_000487.5(ARSA):c.1150G>A ; NM_000487.5(ARSA):c.542dup ; NM_000487.5(ARSA):c.1408_1418del11 ; NM_000487.5(ARSA):c.641C>T ; NM_000487.5(ARSA):c.938G>A ; NM_000487.5(ARSA):c.195delC ; c.1241del ; NM_000487.5(ARSA):c.899T>C ; c.582del ; NM_000487.5(ARSA):c.1283C>T ; NM_000487.5(ARSA):c.869G>A ; NM_000487.5(ARSA):c.986C>T ; NM_000487.5(ARSA):c.34delG ; NM_000487.5(ARSA):c.1232C>T ; NM_000487.5(ARSA):c.1108-2A>G ; NM_000487.5(ARSA):c.991G>T ; NM_000487.5(ARSA):c.763G>A ; NM_000487.5(ARSA):c.542T>G ; NM_000487.5(ARSA):c.979G>A ; NM_000487.5(ARSA):c.302G>A ; NM_000487.5(ARSA):c.257G>A ; NM_000487.5(ARSA):c.293C>T ; NM_000487.5(ARSA):c.1125_1126delCT ; NM_000487.5(ARSA):c.346C>T ; NM_000487.5(ARSA):c.1210+1G>A ; c.1401_1411del ; NM_000487.5(ARSA):c.883G>A ; NM_000487.5(ARSA):c.465+1G>A ; NM_000487.5(ARSA):c.739G>A ; c.854+1G>A ; NM_000487.5(ARSA):c.827C>T ; NM_000487.5(ARSA):c.937C>T ; NM_000487.5(ARSA):c.583delT ; NM_000487.5(ARSA):c.737G>A ; NM_000487.5(ARSA):c.1150G>A ; NM_000487.5(ARSA):c.542dup ; NM_000487.5(ARSA):c.1408_1418del11 ; NM_000487.5(ARSA):c.641C>T ; NM_000487.5(ARSA):c.938G>A ; NM_000487.5(ARSA):c.195delC ; c.1241del ; NM_000487.5(ARSA):c.899T>C ; c.582del ; NM_000487.5(ARSA):c.1283C>T ; NM_000487.5(ARSA):c.869G>A ; NM_000487.5(ARSA):c.986C>T ; NM_000487.5(ARSA):c.34delG ; NM_000487.5(ARSA):c.1232C>T



Mucopolisacaridosis tipo 6, de evolución rápida

La mucopolisacaridosis tipo 6 (MPS 6) es una enfermedad de almacenamiento lisosómico con afectación multisistémica progresiva, asociada a una deficiencia de arilsulfatasa B (ASB) que conduce a la acumulación de dermatán sulfato.


El trastorno muestra un amplio espectro de síntomas, desde formas de progresión lenta a rápida. La displasia esquelética característica incluye baja estatura, disostosis múltiple y enfermedad articular degenerativa. Las formas de progresión rápida pueden tener un inicio desde el nacimiento, glicosaminoglicanos urinarios elevados (GAG, generalmente >100 microgramos/mg de creatinina), disostosis múltiple grave, baja estatura y muerte antes de la segunda o tercera décadas. Se ha descrito una forma de progresión más lenta con un inicio más tardío, glicosaminoglicanos ligeramente elevados (generalmente <100 microgramos/mg de creatinina), disostosis múltiple leve y muerte en la 4ª o 5ª década. Otros hallazgos clínicos pueden incluir valvulopatías cardíacas, reducción de la función pulmonar, hepatoesplenomegalia, sinusitis, otitis media, pérdida de audición, apnea del sueño, opacidad de la córnea, enfermedad del túnel carpiano y hernia inguinal o umbilical. Aunque el déficit intelectual suele estar ausente en la MPS 6, los hallazgos en el sistema nervioso central pueden incluir compresión de la médula cervical causada por inestabilidad de la columna vertebral, engrosamiento meníngeo y/o estenosis ósea, hidrocefalia comunicante, atrofia del nervio óptico y ceguera.

Mucopolisacaridosis tipo 6, de progresión lenta

La mucopolisacaridosis tipo 6 (MPS 6) es una enfermedad de almacenamiento lisosómico con afectación multisistémica progresiva, asociada a una deficiencia de arilsulfatasa B (ASB) que conduce a la acumulación de dermatán sulfato.


El trastorno muestra un amplio espectro de síntomas, desde formas de progresión lenta hasta formas de progresión rápida. La displasia esquelética característica incluye estatura baja, disostosis múltiple y enfermedad articular degenerativa. Las formas de progresión rápida pueden tener un inicio desde el nacimiento, glicosaminoglicanos urinarios elevados (GAG, generalmente >100 microgramos/mg de creatinina), disostosis múltiple grave, baja estatura y muerte antes de la segunda o tercera década. Se ha descrito una forma de progresión más lenta con un inicio más tardío, glicosaminoglicanos ligeramente elevados (generalmente <100 microgramos/mg de creatinina), disostosis múltiple leve y muerte en la 4ª o 5ª década. Otros hallazgos clínicos pueden incluir valvulopatías cardíacas, reducción de la función pulmonar, hepatoesplenomegalia, sinusitis, otitis media, pérdida de audición, apnea del sueño, opacidad de la córnea, enfermedad del túnel carpiano y hernia inguinal o umbilical. Aunque el déficit intelectual suele estar ausente en la MPS 6, los hallazgos en el sistema nervioso central pueden incluir compresión de la médula cervical causada por la inestabilidad de la columna vertebral, engrosamiento meníngeo y/o estenosis ósea, hidrocefalia comunicante, atrofia del nervio óptico y ceguera.


c.921del ; NM_000046.4(ARSB):c.629A>G ; NM_000046.5(ARSB):c.979C>T ; NC_000005.10:g.78780563dup ; NM_000046.5(ARSB):c.427del ; NM_000046.4(ARSB):c.753C>G ; NM_000046.4(ARSB):c.944G>A ; NM_000046.4(ARSB):c.589C>T ; NM_000046.4(ARSB):c.937C>G ; NM_000046.4(ARSB):c.1143-1G>C ; NM_000046.4(ARSB):c.1161dup ; NM_000046.4(ARSB):c.349T>C ; NM_000046.4(ARSB):c.971G>T ; NM_000046.4(ARSB):c.1366C>T ; NM_000046.4(ARSB):c.1143-8T>G ; NM_000046.4(ARSB):c.571C>T ; c.921del ; NM_000046.4(ARSB):c.629A>G ; NM_000046.5(ARSB):c.979C>T ; NC_000005.10:g.78780563dup ; NM_000046.5(ARSB):c.427del ; NM_000046.4(ARSB):c.753C>G ; NM_000046.4(ARSB):c.944G>A ; NM_000046.4(ARSB):c.589C>T ; NM_000046.4(ARSB):c.937C>G ; NM_000046.4(ARSB):c.1143-1G>C ; NM_000046.4(ARSB):c.1161dup ; NM_000046.4(ARSB):c.349T>C ; NM_000046.4(ARSB):c.971G>T ; NM_000046.4(ARSB):c.1366C>T ; NM_000046.4(ARSB):c.1143-8T>G ; NM_000046.4(ARSB):c.571C>T



Aciduria argininosuccínica

Trastorno genético raro del metabolismo del ciclo de la urea que se caracteriza por una forma grave de inicio neonatal que se manifiesta con hiperamonemia acompañada de vómitos, hipotermia, letargo y mala alimentación en los primeros días de vida, o formas de inicio tardío que se manifiestan con hiperamonemia episódica inducida por el estrés o las infecciones o, en algunos casos, con anomalías del comportamiento y/o problemas de aprendizaje, o enfermedad hepática crónica. Los pacientes suelen manifestar una disfunción hepática.


El ASA puede tener un cuadro clínico variable con un inicio neonatal o tardío (a cualquier edad fuera del periodo neonatal). Los neonatos con ASA de inicio neonatal grave suelen tener un aspecto normal durante las primeras 24-48 horas tras el nacimiento, pero a los pocos días presentan una hiperamonemia grave que se manifiesta con letargo, somnolencia, rechazo de la alimentación, vómitos, taquipnea y alcalosis respiratoria. Si no se trata, puede producirse un empeoramiento del letargo, convulsiones, coma y muerte. El ASA de inicio tardío suele desencadenarse por una infección aguda, el estrés o tras una ingesta elevada de proteínas. También se ha notificado la presentación de un deterioro cognitivo de inicio tardío o de problemas de aprendizaje en ausencia de episodios hiperamonémicos. Algunos pacientes pueden ser clínicamente asintomáticos a pesar de mostrar claros signos bioquímicos de la enfermedad. Las complicaciones a largo plazo asociadas a ambas formas de ASA incluyen hepatomegalia crónica, disfunción hepática (fibrosis o cirrosis), déficits neurocognitivos (es decir, deterioro cognitivo, convulsiones y retraso del desarrollo), cabello quebradizo (es decir, tricorrexis nodosa), hipopotasemia e hipertensión arterial.


NC_000007.14:g.66092883C>T ; NM_000048.3(ASL):c.1135C>T ; c.1369dup ; NM_001024943.1(ASL):c.337C>T ; NM_000048.3(ASL):c.544C>T ; NM_000048.3(ASL):c.1045_1057delGTCATCTCTACGC ; c.1144-2A>G ; NM_000048.3(ASL):c.1060C>T ; NM_001024943.2:c.346C>T ; NM_001024943.1(ASL):c.602+1G>A ; NM_000048.3(ASL):c.857A>G ; NM_000048.3(ASL):c.446+1G>A ; NM_000048.3(ASL):c.578G>A ; NM_001024943.1(ASL):c.1255_1256delCT ; c.525-2A>T ; NM_000048.3(ASL):c.532G>A ; NM_000048.3(ASL):c.539T>G ; NM_000048.3(ASL):c.35G>A ; NM_001024943.1(ASL):c.1153C>T ; NC_000007.14:g.66092883C>T ; NM_000048.3(ASL):c.1135C>T ; c.1369dup ; NM_001024943.1(ASL):c.337C>T ; NM_000048.3(ASL):c.544C>T ; NM_000048.3(ASL):c.1045_1057delGTCATCTCTACGC ; c.1144-2A>G ; NM_000048.3(ASL):c.1060C>T ; NM_001024943.2:c.346C>T ; NM_001024943.1(ASL):c.602+1G>A ; NM_000048.3(ASL):c.857A>G ; NM_000048.3(ASL):c.446+1G>A ; NM_000048.3(ASL):c.578G>A ; NM_001024943.1(ASL):c.1255_1256delCT ; c.525-2A>T ; NM_000048.3(ASL):c.532G>A ; NM_000048.3(ASL):c.539T>G ; NM_000048.3(ASL):c.35G>A ; NM_001024943.1(ASL):c.1153C>T



Enfermedad de Canavan leve

La enfermedad de Canavan (EC) leve es un trastorno neurodegenerativo caracterizado por un leve retraso del habla o del desarrollo motor.


La EC leve suele presentarse en la infancia con un leve retraso en el desarrollo o problemas en el habla o el desarrollo motor. El perímetro cefálico suele ser normal. Puede haber retinitis pigmentaria (véase este término). .

Enfermedad de Canavan grave

La enfermedad de Canavan (EC) grave es un trastorno neurodegenerativo de rápida evolución caracterizado por leucodistrofia con macrocefalia, retraso grave del desarrollo e hipotonía.


El inicio de la EC grave es en la infancia. Los pacientes presentan hipotonía, retraso cefálico y macrocefalia. El retraso en el desarrollo se observa con mayor frecuencia entre el tercer y el quinto mes de vida: los pacientes no consiguen sentarse, deambular y hablar de forma independiente. El perímetro cefálico aumenta después de los 6 meses y suele estar por encima del percentil 90 al año de edad. Con la edad, la hipotonía progresa hacia la espasticidad, pueden producirse convulsiones y la atrofia óptica es evidente. Los niños suelen estar irritables y presentan trastornos del sueño. El reflujo gastroesofágico provoca dificultades en la alimentación, requiriendo alimentación nasogástrica o gastrostomía de alimentación permanente.


NM_000049.4:c.854A>C ; NM_000049.4:c.693C>A ; NM_001128085.1(ASPA):c.433-2A>G ; NM_001128085.1(ASPA):c.654C>A ; NM_000049.2(ASPA):c.914C>A ; NM_000049.2(ASPA):c.212G>A ; NM_000049.4:c.854A>C ; NM_000049.4:c.693C>A ; NM_001128085.1(ASPA):c.433-2A>G ; NM_001128085.1(ASPA):c.654C>A ; NM_000049.2(ASPA):c.914C>A ; NM_000049.2(ASPA):c.212G>A



Citrulinemia neonatal aguda tipo I

Forma grave de citrulinemia de tipo 1 caracterizada biológicamente por la hiperamonemia y clínicamente por el letargo progresivo, la mala alimentación y los vómitos, las convulsiones y la posible pérdida de conciencia, entre uno y pocos días después del nacimiento, con signos variables de aumento de la presión intracraneal. La enfermedad puede provocar déficits neurológicos importantes.



Citrulinemia tipo I de inicio en la edad adulta

Una forma de citrulinemia de tipo I caracterizada clínicamente por la aparición de síntomas en la edad adulta que incluyen hiperamonemia variable y hallazgos neurológicos menos llamativos que pueden incluir cefalea intensa, escotomas, episodios de tipo migrañoso, ataxia, dificultad para hablar, letargo y somnolencia. Puede producirse un aumento grave de la presión intracraneal.




NM_000050.4(ASS1):c.1087C>T ; NM_000050.4(ASS1):c.421-2A>G ; NM_000050.4(ASS1):c.1194-1G>C ; NM_000050.4(ASS1):c.257G>A ; NM_000050.4(ASS1):c.814C>T ; NM_000050.4(ASS1):c.794G>A ; NM_000050.4(ASS1):c.40G>A ; NM_000050.4(ASS1):c.1085G>T ; NM_000050.4(ASS1):c.535T>C ; NM_000050.4(ASS1):c.787G>A ; NM_000050.4(ASS1):c.1168G>A ; NM_000050.4(ASS1):c.910C>T ; NM_000050.4(ASS1):c.970+5G>A ; NM_000050.4(ASS1):c.836G>A ; NM_000050.4(ASS1):c.349G>A ; NM_000050.4(ASS1):c.793C>T ; NM_000050.4(ASS1):c.496-2A>G ; NM_000050.4(ASS1):c.835C>T ; NM_000050.4(ASS1):c.571G>A ; NM_000050.4(ASS1):c.970G>A ; NM_000050.4(ASS1):c.256C>T ; NM_000050.4(ASS1):c.539G>A ; NM_000050.4(ASS1):c.1087C>T ; NM_000050.4(ASS1):c.421-2A>G ; NM_000050.4(ASS1):c.1194-1G>C ; NM_000050.4(ASS1):c.257G>A ; NM_000050.4(ASS1):c.814C>T ; NM_000050.4(ASS1):c.794G>A ; NM_000050.4(ASS1):c.40G>A ; NM_000050.4(ASS1):c.1085G>T ; NM_000050.4(ASS1):c.535T>C ; NM_000050.4(ASS1):c.787G>A ; NM_000050.4(ASS1):c.1168G>A ; NM_000050.4(ASS1):c.910C>T ; NM_000050.4(ASS1):c.970+5G>A ; NM_000050.4(ASS1):c.836G>A ; NM_000050.4(ASS1):c.349G>A ; NM_000050.4(ASS1):c.793C>T ; NM_000050.4(ASS1):c.496-2A>G ; NM_000050.4(ASS1):c.835C>T ; NM_000050.4(ASS1):c.571G>A ; NM_000050.4(ASS1):c.970G>A ; NM_000050.4(ASS1):c.256C>T ; NM_000050.4(ASS1):c.539G>A



Enfermedad de Menkes

Trastorno congénito raro del metabolismo del cobre con manifestaciones multisistémicas graves que se caracterizan principalmente por una neurodegeneración progresiva y marcadas anomalías del tejido conectivo. Un rasgo patognomónico es el típico pelo escaso y anormal de color acero.


La enfermedad de Menkes (MD) se manifiesta en el periodo neonatal. La mayoría de los pacientes nacen a término con medidas de nacimiento adecuadas. Ocasionalmente se observan cefalohematomas y fracturas espontáneas al nacer. En el periodo neonatal temprano, los pacientes pueden presentar ictericia prolongada, hipotermia, hipoglucemia y dificultades de alimentación. También se han notificado pectus excavatum y hernias umbilicales e inguinales. La observación inicial a la edad de 1 a 2 meses suele ser un cabello inusualmente escaso y sin brillo en el cuero cabelludo. Es característico que el pelo aparezca hipopigmentado/despigmentado, se parezca a la lana de acero y sea friable, especialmente en las zonas del cuero cabelludo sometidas a fricción. Otros síntomas son retraso en el desarrollo, mala alimentación, vómitos y diarrea. Puede observarse la aparición de piel pálida, salientes frontales u occipitales, micrognatia y mejillas regordetas. Los pacientes desarrollan una disfunción motora gradual y convulsiones. La hipotonía muscular en los primeros años de vida es sustituida más tarde por espasticidad y debilidad de las extremidades. El curso clínico suele ser grave. Existen formas variables, siendo el síndrome del cuerno occipital (OHS) la forma más leve reconocida, que además se presenta con exostosis óseas prominentes y divertículos vesicales.

Síndrome del cuerno occipital

Se trata de un raro trastorno congénito del metabolismo del cobre que se caracteriza principalmente por exostosis óseas (incluidos los patognomónicos cuernos occipitales), y manifestaciones del tejido conectivo con cutis laxa y divertículos vesicales. La afectación del sistema nervioso central es variable.


La edad de aparición oscila entre la infancia y la niñez. Las observaciones al nacer pueden incluir cefalohematoma (12% de los casos), piel suelta y arrugada, y hernias umbilicales o inguinales. Alrededor de un tercio de todos los pacientes presentan principalmente una afectación del sistema nervioso central (hipotonía, retraso en el desarrollo y/o convulsiones). La presentación clínica inicial puede ocurrir más tarde con divertículos vesicales o manifestaciones esqueléticas. Los divertículos vesicales afectan a la mayoría de los pacientes (>80%) y pueden manifestarse mediante infecciones urinarias recurrentes o polaquiuria. La manifestación esquelética más típica (presente en el 96% de los pacientes) es una exostosis en el occipucio, en la inserción del músculo trapecio (cuerno occipital), pero también puede haber exostosis en la tibia y el radio. Otras características esqueléticas más variables son las clavículas en forma de martillo, la escoliosis, la deformidad del pectus, la coxa valga, la genua valga, así como las dislocaciones de la cabeza del radio. Otras manifestaciones esqueléticas menos frecuentes son el arqueo de los huesos largos, el ensanchamiento de la diáfisis media, el espolón metafisario, el redondeo de las alas ilíacas y, raramente, la osteopenia. Los rasgos faciales se vuelven distintivos con la edad e incluyen una cara larga (46%), orejas grandes (38%), mejillas caídas (45%) y pelo grueso (74%). La tricoscopia puede mostrar pili torti. La piel suele ser hiperextensible y blanda, con finas arrugas en las manos y los pies. La redundancia cutánea es notable en el vientre. La tortuosidad vascular es frecuente en las arterias intracraneales (65%), pero también puede afectar a la circulación cervical, esplénica y esplácnica e impone un riesgo de formación de aneurismas. En raras ocasiones puede producirse una dilatación y disección de la raíz aórtica. La mayoría de los pacientes (>90%) presentan disautonomía con hipotensión ortostática postural, inestabilidad térmica y diarrea crónica. Aproximadamente la mitad de los pacientes muestran un retraso en el desarrollo motor debido a la hipotonía muscular y a la hipermovilidad articular, y pueden manifestar una torpeza inusual. Se ha registrado una neuropatía motora distal en al menos un paciente. Alrededor de la mitad de los pacientes presentan una discapacidad intelectual (DI) que suele ser leve, pero puede producirse un deterioro de moderado a grave.

Atrofia muscular distal ligada al X tipo 3

La atrofia muscular espinal distal ligada al cromosoma X de tipo 3 es una neuropatía motora distal hereditaria poco frecuente que se caracteriza por una atrofia y una debilidad lentamente progresivas de los músculos distales de manos y pies con reflejos tendinosos profundos normales o ausencia de reflejos en los tobillos y una pérdida sensorial mínima o nula, a veces una debilidad proximal leve en las piernas y los pies y deformidades en las manos en los varones.


El trastorno se transmitía con un patrón de herencia recesivo ligado al cromosoma X. En 6 de los 9 pacientes examinados, la edad de inicio oscilaba entre 1 y 10 años, y el primer síntoma detectado fue la deformidad del pie (pie cavo o pie varo); en otros 2 individuos se notificó inestabilidad de la marcha. Posteriormente, se observó debilidad y atrofia de los miembros inferiores distales y, por último, se afectaron las manos. A pesar de la gran variabilidad clínica, la progresión de la enfermedad fue muy lenta y la marcha independiente se mantuvo incluso en edades avanzadas. No había deterioro cognitivo, piramidal ni sensorial. La EMG mostró una denervación crónica, la biopsia muscular mostró un patrón neurogénico y la biopsia del nervio sural fue normal.


NM_000052.6(ATP7A):c.3915_3921delCTCCCCA ; c.3257_3258del ; NM_000052.6(ATP7A):c.1974_1977dupGTTT ; NM_000052.6(ATP7A):c.1639C>T ; c.3294+2T>G ; NM_000052.6(ATP7A):c.3911A>G ; NM_000052.6(ATP7A):c.2938C>T ; NM_000052.6(ATP7A):c.3915_3921delCTCCCCA ; c.3257_3258del ; NM_000052.6(ATP7A):c.1974_1977dupGTTT ; NM_000052.6(ATP7A):c.1639C>T ; c.3294+2T>G ; NM_000052.6(ATP7A):c.3911A>G ; NM_000052.6(ATP7A):c.2938C>T



Enfermedad de Wilson

Una enfermedad de inmunodeficiencia primaria caracterizada por microtrombocitopenia, eczema, infecciones y un mayor riesgo de manifestaciones autoinmunes y tumores malignos.


El espectro clínico es muy amplio, incluso dentro de las familias afectadas. Asimismo, la edad de aparición es muy variable. Algunos pacientes permanecen asintomáticos durante décadas, mientras que pocos presentan síntomas antes de los 3 ó 5 años de edad. La enfermedad puede observarse en niños después de los 3 años y la mayoría de los casos se desarrollan antes de los 40 años. También se han descrito casos de aparición tardía después de la quinta década de vida. La presentación clínica depende del sexo y la edad. En los niños, a una edad media de 10 años, suelen prevalecer las manifestaciones hepáticas, que suelen comenzar con daños en el hígado. En general, las manifestaciones hepáticas (hepatomegalia, hepatitis subaguda o crónica, insuficiencia hepática aguda o cirrosis con hipertensión portal) suelen preceder a los síntomas neurológicos. Las manifestaciones neurológicas (distonía, temblor de intención, disartria, dificultades de coordinación, corea, coreoatetosis y trastornos de la marcha) pueden encontrarse junto con los síntomas hepáticos o pueden ser también los primeros síntomas clínicos. Los trastornos psiquiátricos aislados (depresión, fobias, comportamiento compulsivo, cambios de personalidad, agresividad o inestabilidad emocional) son raros y se observan con más frecuencia junto con la enfermedad hepática o neurológica. En los pacientes afectados también puede haber una amplia gama de otras manifestaciones: episodios hemolíticos agudos, retraso de la pubertad, amenorrea, abortos de repetición, anillos de Kayser-Fleischer debidos a depósitos de cobre en la membrana de Descemet, dolor óseo, artralgia y osteoporosis, arritmia, miocardiopatía, hematuria, síndrome nefrótico y litiasis renal. Se han notificado casos raros de carcinoma hepatocelular.


NM_000053.3(ATP7B):c.2532delA ; NM_000053.3(ATP7B):c.2906G>A ; NM_000053.3(ATP7B):c.2930C>T ; c.2807T>A ; NM_000053.4:c.3207C>A ; c.2356-2A>G ; NM_000053.3(ATP7B):c.2305A>G ; NM_000053.3(ATP7B):c.1745_1746delTA ; NM_000053.3(ATP7B):c.915T>A ; NM_001005918.2:c.3369_3372delTTAT ; NM_000053.3(ATP7B):c.2804C>T ; NM_000053.3(ATP7B):c.562C>T ; NM_000053.3(ATP7B):c.1145_1151delCCCAACT ; NM_000053.3(ATP7B):c.1512dupT ; NM_000053.3(ATP7B):c.3809A>G ; NM_000053.3(ATP7B):c.2297C>G ; NM_000053.3(ATP7B):c.2975C>T ; NM_000053.3(ATP7B):c.2795C>A ; NM_000053.3(ATP7B):c.3694A>C ; NM_000053.3(ATP7B):c.4088C>T ; c.3083del ; NM_000053.3(ATP7B):c.2071G>A ; NM_000053.3(ATP7B):c.3955C>T ; NM_000053.3(ATP7B):c.4058G>A ; NM_000053.3(ATP7B):c.3796G>A ; NM_000053.3(ATP7B):c.2755C>G ; NM_000053.3(ATP7B):c.2123T>C ; c.3359T>A ; NM_000053.3(ATP7B):c.2532delA ; NM_000053.3(ATP7B):c.2906G>A ; NM_000053.3(ATP7B):c.2930C>T ; c.2807T>A ; NM_000053.4:c.3207C>A ; c.2356-2A>G ; NM_000053.3(ATP7B):c.2305A>G ; NM_000053.3(ATP7B):c.1745_1746delTA ; NM_000053.3(ATP7B):c.915T>A ; NM_001005918.2:c.3369_3372delTTAT ; NM_000053.3(ATP7B):c.2804C>T ; NM_000053.3(ATP7B):c.562C>T ; NM_000053.3(ATP7B):c.1145_1151delCCCAACT ; NM_000053.3(ATP7B):c.1512dupT ; NM_000053.3(ATP7B):c.3809A>G ; NM_000053.3(ATP7B):c.2297C>G ; NM_000053.3(ATP7B):c.2975C>T ; NM_000053.3(ATP7B):c.2795C>A ; NM_000053.3(ATP7B):c.3694A>C ; NM_000053.3(ATP7B):c.4088C>T ; c.3083del ; NM_000053.3(ATP7B):c.2071G>A ; NM_000053.3(ATP7B):c.3955C>T ; NM_000053.3(ATP7B):c.4058G>A ; NM_000053.3(ATP7B):c.3796G>A ; NM_000053.3(ATP7B):c.2755C>G ; NM_000053.3(ATP7B):c.2123T>C ; c.3359T>A



Enfermedad de la orina con olor a jarabe de arce clásica

La enfermedad de la orina en forma de jarabe de arce clásica (MSUD clásica) es la forma más grave y probablemente común de la MSUD (véase este término), caracterizada por un olor a jarabe de arce en el cerumen al nacer, mala alimentación, letargia y distonía focal, seguida de encefalopatía progresiva e insuficiencia respiratoria central si no se trata.


El inicio de la MSUD clásica se produce en el periodo neonatal (normalmente 12 horas después del nacimiento) con la presencia de un olor a jarabe de arce en el cerumen y posteriormente en la orina, mala alimentación y somnolencia. En los primeros días de vida se produce una encefalopatía progresiva con letargo, apnea intermitente, movimientos estereotipados (descritos como "esgrima" y bicicleta") y opistótono. Sin tratamiento, el coma y la insuficiencia respiratoria central se producen entre los días 7 y 10. Más tarde, el estrés catabólico, la infección o las lesiones pueden causar una intoxicación aguda, potencialmente mortal, por leucina con vómitos, alteración de la conciencia, ataxia y distonía aguda en los niños pequeños y alucinaciones, hiperactividad, distonía focal, ataxia y coreoatetosis en los niños y adultos.

Enfermedad de la orina con olor a jarabe de arce intermedia

La enfermedad de la orina con olor a jarabe de arce intermedia (MSUD intermedia) es una forma más leve de MSUD (véase este término) caracterizada por la elevación persistente de los aminoácidos de cadena ramificada (BCAA) y los cetoácidos, pero con menos o ningún episodio agudo de descompensación.


La aparición de los síntomas de la MSUD intermedia varía entre los primeros meses y los primeros años de la infancia. Los bebés pueden tener problemas de alimentación, crecimiento deficiente, olor a jarabe de arce en la orina y retraso en el desarrollo. Los niños mayores suelen presentar dificultades de aprendizaje. Al igual que la MSUD clásica (véase este término), el estrés catabólico puede provocar una descompensación aguda con anorexia, vómitos, ataxia (en bebés/niños pequeños), deterioro cognitivo, trastornos del sueño, alucinaciones, hiperactividad, cambios de humor, distonía aguda, coreoatetosis (en adultos), estupor, coma y edema cerebral, si no se trata.

Enfermedad de la orina con jarabe de arce intermitente

La enfermedad de la orina con olor a jarabe de arce intermitente (MSUD intermitente) es una forma leve de MSUD (véase este término) en la que los pacientes (cuando están bien) son asintomáticos con niveles normales de aminoácidos de cadena ramificada (BCAA), pero con estrés catabólico corren el riesgo de sufrir una descompensación aguda con cetoacidosis, que puede provocar edema cerebral y coma si no se trata.


A diferencia de la MSUD clásica (véase este término), los pacientes con MSUD intermitente muestran un crecimiento y un desarrollo intelectual normales durante la infancia y la niñez. Pueden desarrollar síntomas (principalmente en la infancia) con cualquier estrés catabólico (por ejemplo, ayuno, deshidratación, fiebre, infecciones o embarazo (en adultos)). Estos factores precipitantes pueden conducir a un episodio potencialmente mortal de descompensación aguda con anorexia, náuseas, vómitos, letargo, ataxia (en los bebés/niños pequeños), deterioro cognitivo, trastornos del sueño, alucinaciones, hiperactividad, cambios de humor, distonía aguda y coreoatetosis (en los adultos), que puede progresar hasta el estupor, el coma y el edema cerebral. La inteligencia y el desarrollo no suelen verse afectados por estos episodios.

Enfermedad de la orina con jarabe de arce que responde a la tiamina

La enfermedad de la orina en forma de jarabe de arce que responde a la tiamina (MSUD) es una variante menos grave de la MSUD (véase este término) que se manifiesta con un fenotipo similar al de la MSUD intermedia (véase este término) pero que responde positivamente al tratamiento con tiamina.


La MSUD que responde a la tiamina está mal caracterizada. Parece que suele presentarse después de la infancia con un fenotipo muy similar al observado en la MSUD intermedia (véase este término). Las manifestaciones incluyen problemas de alimentación, crecimiento deficiente, olor a jarabe de arce en la orina y retraso en el desarrollo. Los niños mayores suelen presentar dificultades de aprendizaje. Al igual que la MSUD clásica (véase este término), el estrés fisiológico puede provocar una descompensación aguda con anorexia, náuseas, vómitos (en todas las edades), ataxia (en bebés/niños pequeños), deterioro cognitivo, trastornos del sueño, alucinaciones, hiperactividad, cambios de humor, distonía aguda/focal y coreoatetosis (en adultos) que pueden progresar hasta el estupor, el coma y el edema cerebral, si no se tratan. La tiamina (en dosis de 10-1000 mg al día) ha mejorado la tolerancia a la leucina en los pocos casos notificados de este subtipo de MSUD, pero sigue siendo necesaria una cierta restricción de aminoácidos de cadena ramificada (BCAA) en la dieta.


NM_000709.3(BCKDHA):c.659C>T ; NM_000709.3(BCKDHA):c.964C>T ; c.797del ; NM_000709.3(BCKDHA):c.917delT ; NM_000709.3(BCKDHA):c.14delT ; NM_000709.3(BCKDHA):c.929C>G ; NM_000709.3(BCKDHA):c.1234G>A ; NM_000709.3(BCKDHA):c.740_741insT ; NM_000709.3(BCKDHA):c.632C>T ; NM_000709.3(BCKDHA):c.853G>C ; NM_000709.3(BCKDHA):c.909_910delGT ; NM_000709.3(BCKDHA):c.868G>A ; NM_000709.3(BCKDHA):c.979G>A ; NM_000709.3(BCKDHA):c.905A>C ; NM_000709.3(BCKDHA):c.1036C>T ; NM_000709.3(BCKDHA):c.659C>T ; NM_000709.3(BCKDHA):c.964C>T ; c.797del ; NM_000709.3(BCKDHA):c.917delT ; NM_000709.3(BCKDHA):c.14delT ; NM_000709.3(BCKDHA):c.929C>G ; NM_000709.3(BCKDHA):c.1234G>A ; NM_000709.3(BCKDHA):c.740_741insT ; NM_000709.3(BCKDHA):c.632C>T ; NM_000709.3(BCKDHA):c.853G>C ; NM_000709.3(BCKDHA):c.909_910delGT ; NM_000709.3(BCKDHA):c.868G>A ; NM_000709.3(BCKDHA):c.979G>A ; NM_000709.3(BCKDHA):c.905A>C ; NM_000709.3(BCKDHA):c.1036C>T



Enfermedad de la orina con olor a jarabe de arce clásica

La enfermedad de la orina en forma de jarabe de arce clásica (MSUD clásica) es la forma más grave y probablemente común de la MSUD (véase este término), caracterizada por un olor a jarabe de arce en el cerumen al nacer, mala alimentación, letargia y distonía focal, seguida de encefalopatía progresiva e insuficiencia respiratoria central si no se trata.


El inicio de la MSUD clásica se produce en el periodo neonatal (normalmente 12 horas después del nacimiento) con la presencia de un olor a jarabe de arce en el cerumen y posteriormente en la orina, mala alimentación y somnolencia. En los primeros días de vida se produce una encefalopatía progresiva con letargo, apnea intermitente, movimientos estereotipados (descritos como "esgrima" y bicicleta") y opistótono. Sin tratamiento, el coma y la insuficiencia respiratoria central se producen entre los días 7 y 10. Más tarde, el estrés catabólico, la infección o las lesiones pueden causar una intoxicación aguda, potencialmente mortal, por leucina con vómitos, alteración de la conciencia, ataxia y distonía aguda en los niños pequeños y alucinaciones, hiperactividad, distonía focal, ataxia y coreoatetosis en los niños y adultos.

Enfermedad de la orina con olor a jarabe de arce intermedia

La enfermedad de la orina con olor a jarabe de arce intermedia (MSUD intermedia) es una forma más leve de MSUD (véase este término) caracterizada por la elevación persistente de los aminoácidos de cadena ramificada (BCAA) y los cetoácidos, pero con menos o ningún episodio agudo de descompensación.


La aparición de los síntomas de la MSUD intermedia varía entre los primeros meses y los primeros años de la infancia. Los bebés pueden tener problemas de alimentación, crecimiento deficiente, olor a jarabe de arce en la orina y retraso en el desarrollo. Los niños mayores suelen presentar dificultades de aprendizaje. Al igual que la MSUD clásica (véase este término), el estrés catabólico puede provocar una descompensación aguda con anorexia, vómitos, ataxia (en bebés/niños pequeños), deterioro cognitivo, trastornos del sueño, alucinaciones, hiperactividad, cambios de humor, distonía aguda, coreoatetosis (en adultos), estupor, coma y edema cerebral, si no se trata.

Enfermedad de la orina con jarabe de arce intermitente

La enfermedad de la orina con olor a jarabe de arce intermitente (MSUD intermitente) es una forma leve de MSUD (véase este término) en la que los pacientes (cuando están bien) son asintomáticos con niveles normales de aminoácidos de cadena ramificada (BCAA), pero con estrés catabólico corren el riesgo de sufrir una descompensación aguda con cetoacidosis, que puede provocar edema cerebral y coma si no se trata.


A diferencia de la MSUD clásica (véase este término), los pacientes con MSUD intermitente muestran un crecimiento y un desarrollo intelectual normales durante la infancia y la niñez. Pueden desarrollar síntomas (principalmente en la infancia) con cualquier estrés catabólico (por ejemplo, ayuno, deshidratación, fiebre, infecciones o embarazo (en adultos)). Estos factores precipitantes pueden conducir a un episodio potencialmente mortal de descompensación aguda con anorexia, náuseas, vómitos, letargo, ataxia (en los bebés/niños pequeños), deterioro cognitivo, trastornos del sueño, alucinaciones, hiperactividad, cambios de humor, distonía aguda y coreoatetosis (en los adultos), que puede progresar hasta el estupor, el coma y el edema cerebral. La inteligencia y el desarrollo no suelen verse afectados por estos episodios.

Enfermedad de la orina con jarabe de arce que responde a la tiamina

La enfermedad de la orina en forma de jarabe de arce que responde a la tiamina (MSUD) es una variante menos grave de la MSUD (véase este término) que se manifiesta con un fenotipo similar al de la MSUD intermedia (véase este término) pero que responde positivamente al tratamiento con tiamina.


La MSUD que responde a la tiamina está mal caracterizada. Parece que suele presentarse después de la infancia con un fenotipo muy similar al observado en la MSUD intermedia (véase este término). Las manifestaciones incluyen problemas de alimentación, crecimiento deficiente, olor a jarabe de arce en la orina y retraso en el desarrollo. Los niños mayores suelen presentar dificultades de aprendizaje. Al igual que la MSUD clásica (véase este término), el estrés fisiológico puede provocar una descompensación aguda con anorexia, náuseas, vómitos (en todas las edades), ataxia (en bebés/niños pequeños), deterioro cognitivo, trastornos del sueño, alucinaciones, hiperactividad, cambios de humor, distonía aguda/focal y coreoatetosis (en adultos) que pueden progresar hasta el estupor, el coma y el edema cerebral, si no se tratan. La tiamina (en dosis de 10-1000 mg al día) ha mejorado la tolerancia a la leucina en los pocos casos notificados de este subtipo de MSUD, pero sigue siendo necesaria una cierta restricción de aminoácidos de cadena ramificada (BCAA) en la dieta.


NM_183050.3(BCKDHB):c.752T>C ; NM_183050.3(BCKDHB):c.508C>T ; NM_000056.4(BCKDHB):c.488A>T ; NM_000056.4(BCKDHB):c.508C>A ; NM_000056.4(BCKDHB):c.952-1G>A ; NM_000056.4(BCKDHB):c.356T>G ; NM_183050.2(BCKDHB):c.547C>T ; NM_000056.4(BCKDHB):c.344-1G>A ; NM_183050.3(BCKDHB):c.799C>T ; NM_183050.3(BCKDHB):c.1114G>T ; NM_183050.3(BCKDHB):c.832G>A ; NM_183050.2(BCKDHB):c.970C>T ; NM_000056.4(BCKDHB):c.526A>T ; NM_000056.4(BCKDHB):c.302G>A ; NM_000056.4(BCKDHB):c.508C>G ; NM_000056.4(BCKDHB):c.479T>G ; NM_183050.3(BCKDHB):c.342T>G ; NM_000056.4(BCKDHB):c.748G>T ; NM_183050.4:c.548G>C ; NM_183050.3(BCKDHB):c.752T>C ; NM_183050.3(BCKDHB):c.508C>T ; NM_000056.4(BCKDHB):c.488A>T ; NM_000056.4(BCKDHB):c.508C>A ; NM_000056.4(BCKDHB):c.952-1G>A ; NM_000056.4(BCKDHB):c.356T>G ; NM_183050.2(BCKDHB):c.547C>T ; NM_000056.4(BCKDHB):c.344-1G>A ; NM_183050.3(BCKDHB):c.799C>T ; NM_183050.3(BCKDHB):c.1114G>T ; NM_183050.3(BCKDHB):c.832G>A ; NM_183050.2(BCKDHB):c.970C>T ; NM_000056.4(BCKDHB):c.526A>T ; NM_000056.4(BCKDHB):c.302G>A ; NM_000056.4(BCKDHB):c.508C>G ; NM_000056.4(BCKDHB):c.479T>G ; NM_183050.3(BCKDHB):c.342T>G ; NM_000056.4(BCKDHB):c.748G>T ; NM_183050.4:c.548G>C



Síndrome de Bj�rnstad

El síndrome de Bj�rnstad se caracteriza por una pérdida auditiva neurosensorial congénita y pili torti.


La pérdida de audición suele hacerse evidente muy pronto en la vida, a menudo en el primer año. Pili torti, una enfermedad en la que el tallo del pelo está aplanado y retorcido, hace que el pelo sea muy frágil y los pacientes desarrollan la pérdida de pelo en los dos primeros años de vida.

Síndrome GRACILE

Un trastorno mitocondrial hereditario letal caracterizado por restricción del crecimiento fetal (RG), aminoaciduria (A), colestasis (C), sobrecarga de hierro (I), lactacidosis (L) y muerte temprana (E).


La restricción del crecimiento fetal aparece al principio del embarazo sin signos de hipoxia crónica. Debido al pequeño tamaño del feto, los embarazos suelen interrumpirse unas semanas antes de la fecha prevista de parto (mediana de 38 semanas gestacionales). El recién nacido es pequeño para la edad gestacional (peso al nacer de aproximadamente 1.700 g) y desarrolla una acidosis láctica fulminante (mediana de pH 7,02, lactato 12,8 mmol/l) durante el primer día de vida. En el cribado metabólico, se encuentra una marcada aminoaciduria debido a una tubulopatía proximal renal de tipo Fanconi. La sobrecarga de hierro se manifiesta por el aumento de la ferritina plasmática y la disminución de las concentraciones de transferrina y la acumulación de hierro en el hígado. Otros signos de hepatopatía son colestasis con esteatosis, fibrosis y cirrosis. No se observan rasgos dismórficos. Hasta ahora no se han encontrado anormalidades cerebrales distintivas, sin embargo en algunos bebés, el EEG ha sido anormal, tal vez como resultado de una acidosis metabólica severa. La respuesta auditiva evaluada con BAEP ha sido anormal.

Deficiencia aislada del complejo III

El síndrome cerebro-culo-esquelético (COFS) es un trastorno genético raro, perteneciente a una familia de enfermedades de la reparación del ADN, caracterizado por una grave afectación neurosensorial.


La deficiencia del complejo III mitocondrial autosómica recesiva es un trastorno multisistémico grave con aparición al nacer de acidosis láctica, hipotonía, hipoglucemia, retraso en el crecimiento, encefalopatía y retraso en el desarrollo psicomotor. También puede haber afectación visceral, incluyendo hepatopatía y tubulopatía renal. Muchos pacientes mueren en la primera infancia, pero algunos pueden mostrar una mayor supervivencia. 

Síndrome de tubulopatía renal-encefalopatía-insuficiencia hepática

La tubulopatía renal - encefalopatía - insuficiencia hepática describe un espectro de fenotipos con manifestaciones similares pero más leves que las observadas en el síndrome GRACILE (véase este término) y que pueden asociarse a encefalopatía y trastornos psiquiátricos.


La presentación de la enfermedad es variable. La mayoría de las características del síndrome GRACILE están presentes (restricción del crecimiento fetal, tubulopatía proximal y hepatopatía, así como acidosis láctica), pero suelen ser menos graves. Se han descrito signos de alteraciones del metabolismo del hierro, como el aumento de los niveles de ferritina sérica, pero no está claro si existe una sobrecarga grave de hierro en el hígado. La mayoría de los bebés mueren durante el periodo neonatal. En los que sobreviven, se han descrito encefalopatía y trastornos psiquiátricos.


NM_004328.4(BCS1L):c.1057G>A ; NM_004328.4(BCS1L):c.103G>C ; NM_001257342.1(BCS1L):c.232A>G ; NM_004328.4(BCS1L):c.148A>G ; NM_004328.4(BCS1L):c.548G>A ; NM_004328.4(BCS1L):c.830G>A ; NM_004328.4(BCS1L):c.133C>T ; c.696del ; NM_004328.4(BCS1L):c.166C>T ; NM_004328.4(BCS1L):c.1057G>A ; NM_004328.4(BCS1L):c.103G>C ; NM_001257342.1(BCS1L):c.232A>G ; NM_004328.4(BCS1L):c.148A>G ; NM_004328.4(BCS1L):c.548G>A ; NM_004328.4(BCS1L):c.830G>A ; NM_004328.4(BCS1L):c.133C>T ; c.696del ; NM_004328.4(BCS1L):c.166C>T



Anemia de Fanconi

Se trata de un raro trastorno genético multisistémico caracterizado por pancitopenia progresiva con insuficiencia de la médula ósea, malformaciones congénitas variables y predisposición a desarrollar tumores hematológicos o sólidos.


Los primeros signos de la anemia de Fanconi (AF) suelen ser rasgos no hematológicos. Las anomalías de las extremidades suelen afectar a las mismas, son unilaterales o (normalmente asimétricas) bilaterales. También pueden presentarse anomalías menores, como baja talla y peso al nacer, microcefalia y/o microftalmia. Son frecuentes las anomalías en la pigmentación de la piel (manchas café con leche) y la hipoplasia de la eminencia tenar. Casi el 20% de los pacientes presentan malformaciones del oído con o sin pérdida de audición. Las malformaciones congénitas pueden afectar a otros sistemas orgánicos y variar dentro de las familias. La baja estatura es sindrómica y/o está asociada a endocrinopatías. La fertilidad se ve afectada con frecuencia en los varones y está muy alterada en la mitad de las mujeres. Cuando las malformaciones congénitas no son prominentes, el diagnóstico puede retrasarse hasta la aparición de anomalías hematológicas. La insuficiencia de la médula ósea (FMO) se produce a una edad media de 7 años, desarrollándose en el 90% de los pacientes a los 40 años. Las primeras manifestaciones son la macrocitosis (muy temprana) y la trombocitopenia. En los pacientes con mosaicismo somático, los recuentos sanguíneos pueden permanecer normales hasta la aparición de una neoplasia hematológica. En general, los pacientes tienen una gran predisposición a los tumores sólidos (con mayor frecuencia en la cabeza y el cuello o en las regiones anogenitales).

Síndrome de cáncer de mama y ovario hereditario

El cáncer de mama (CB) es el cáncer más frecuente en las mujeres, y representa el 25% de todos los nuevos casos de cáncer. La mayoría de los casos de CB son esporádicos, mientras que se estima que entre el 5 y el 10% se deben a una predisposición hereditaria.




c.502C>T ; NM_032043.2(BRIP1):c.2237_2240delTCAA ; NM_032043.2(BRIP1):c.1045G>C ; NM_032043.2(BRIP1):c.1702_1703delAA ; NM_032043.2(BRIP1):c.2990_2993delCAAA ; c.502C>T ; NM_032043.2(BRIP1):c.2237_2240delTCAA ; NM_032043.2(BRIP1):c.1045G>C ; NM_032043.2(BRIP1):c.1702_1703delAA ; NM_032043.2(BRIP1):c.2990_2993delCAAA



Sordera neurosensorial autosómica recesiva de tipo DFNB

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Síndrome de Bartter infantil con sordera neurosensorial

El síndrome de Bartter infantil con sordera, una variante fenotípica del síndrome de Bartter (véase este término) se caracteriza por polihidramnios materno, parto prematuro, poliuria y sordera neurosensorial, y se asocia con alcalosis hipocalémica, aumento de los niveles de renina y aldosterona en plasma, presión arterial baja y resistencia vascular a la angiotensina II.


El síndrome de Bartter infantil con sordera es un tipo grave de síndrome de Bartter que se manifiesta prenatalmente con polihidramnios materno (debido a la poliuria fetal) que suele ser evidente al final del segundo trimestre, lo que a menudo conduce a un parto prematuro y a la prematuridad. En el periodo postnatal, las pacientes presentan poliuria, isostenuria/hipostenuria y corren un alto riesgo de deshidratación, hipotensión hipovolémica y shock. Los pacientes presentan una sordera neurosensorial completa. Se observan vómitos recurrentes, calambres musculares, espasmos y retraso en el desarrollo. Es frecuente la progresión hacia la insuficiencia renal. Se observa alcalosis hipocalémica, hipomagnesemia, hiperprostaglandina E e hipocloremia (la hipercalciuria es sólo transitoria).


NM_057176.3(BSND):c.23G>T ; NM_057176.3(BSND):c.1A>T ; NM_057176.3(BSND):c.139G>A ; NM_057176.3(BSND):c.3G>A ; NM_057176.3(BSND):c.22C>T ; NM_057176.3(BSND):c.10G>T ; NM_057176.3(BSND):c.23G>T ; NM_057176.3(BSND):c.1A>T ; NM_057176.3(BSND):c.139G>A ; NM_057176.3(BSND):c.3G>A ; NM_057176.3(BSND):c.22C>T ; NM_057176.3(BSND):c.10G>T



Deficiencia de biotinidasa

Una forma de inicio tardío de la deficiencia múltiple de carboxilasa, un error congénito del metabolismo de la biotina que, si no se trata, se caracteriza por convulsiones, dificultades respiratorias, hipotonía, erupción cutánea, alopecia, pérdida de audición y retraso en el desarrollo.


Al ingerir leche materna o fórmulas que contienen lactosa, los bebés desarrollan problemas de alimentación, retraso en el desarrollo y signos de daño hepático (ictericia, tendencia a la hemorragia, hipoglucemia). En ausencia de un tratamiento adecuado (restricción de galactosa), puede producirse sepsis (E-coli) y muerte neonatal. A pesar del tratamiento adecuado, aparecen complicaciones a largo plazo, como alteraciones cognitivas, déficits motores, disfunción ovárica con reducción de la fertilidad en las mujeres y disminución de la densidad ósea. La fertilidad masculina aún no se ha estudiado a fondo.


NM_001281725.2(BTD):c.1279C>T ; NM_001281723.2(BTD):c.241C>T ; NM_001281723.2(BTD):c.1601C>T ; NM_001281723.2(BTD):c.635A>G ; NM_001281723.2(BTD):c.449G>A ; NM_001281723.2(BTD):c.190G>A ; NM_001281725.2(BTD):c.1292G>A ; NM_000060.4(BTD):c.1324del ; NM_001281723.2(BTD):c.761A>G ; NM_001281723.2(BTD):c.340G>C ; NM_001281723.2(BTD):c.1618C>T ; NM_001281723.2(BTD):c.1495C>T ; NM_000060.4(BTD):c.1508_1512delGGATG ; NM_001281723.2(BTD):c.649C>T ; NM_001281723.2(BTD):c.601G>A ; NM_001281723.2(BTD):c.637C>T ; NM_001281723.2(BTD):c.534G>T ; NM_001281723.2(BTD):c.563G>A ; NM_000060.2(BTD):c.933delT ; NM_001281724.2(BTD):c.1374A>C ; NM_001281723.2(BTD):c.800A>T ; NM_001281725.2(BTD):c.1279C>T ; NM_001281723.2(BTD):c.241C>T ; NM_001281723.2(BTD):c.1601C>T ; NM_001281723.2(BTD):c.635A>G ; NM_001281723.2(BTD):c.449G>A ; NM_001281723.2(BTD):c.190G>A ; NM_001281725.2(BTD):c.1292G>A ; NM_000060.4(BTD):c.1324del ; NM_001281723.2(BTD):c.761A>G ; NM_001281723.2(BTD):c.340G>C ; NM_001281723.2(BTD):c.1618C>T ; NM_001281723.2(BTD):c.1495C>T ; NM_000060.4(BTD):c.1508_1512delGGATG ; NM_001281723.2(BTD):c.649C>T ; NM_001281723.2(BTD):c.601G>A ; NM_001281723.2(BTD):c.637C>T ; NM_001281723.2(BTD):c.534G>T ; NM_001281723.2(BTD):c.563G>A ; NM_000060.2(BTD):c.933delT ; NM_001281724.2(BTD):c.1374A>C ; NM_001281723.2(BTD):c.800A>T



Estatura baja por deficiencia aislada de la hormona del crecimiento con hipogammaglobulinemia ligada al X

La IGHD3 se caracteriza por una agammaglobulinemia y un número notablemente reducido de células B, baja estatura, retraso en la edad ósea y buena respuesta al tratamiento con la hormona del crecimiento.


La agammaglobulinemia ligada al cromosoma X es una inmunodeficiencia caracterizada por la incapacidad de producir linfocitos B maduros y asociada a un fallo en el reordenamiento de la cadena pesada de Ig. El defecto de este trastorno reside en la BTK, también conocida como BPK o ATK, un regulador clave en el desarrollo de las células B. La forma ligada al cromosoma X representa aproximadamente entre el 85 y el 90% de los casos de este trastorno.

Agammaglobulinemia ligada al X

Una forma clínicamente variable de agammaglobulinemia aislada, un trastorno hereditario de inmunodeficiencia, caracterizado en los varones afectados por infecciones bacterianas recurrentes durante la infancia.


Los individuos afectados suelen estar sanos en los primeros meses de vida debido a las inmunoglobulinas maternas residuales. La mayoría de los pacientes desarrollan infecciones bacterianas recurrentes o persistentes, más comúnmente causadas por S. pneumoniae y H. influenzae, durante los dos primeros años de vida: otitis media, conjuntivitis, sinusitis, infecciones respiratorias, diarrea e infecciones cutáneas (impétigo, celulitis, abscesos y forúnculos). Otras infecciones graves pueden ser el empiema, la meningitis, la sepsis o la artritis séptica. La pioderma o la celulitis (asociadas a la neutropenia) y la sepsis por pseudomonas o estafilococos son hallazgos de presentación frecuentes, sobre todo en pacientes menores de 12 meses. Los ganglios linfáticos, las amígdalas y otros tejidos linfoides son inusualmente pequeños o están ausentes. En raras ocasiones, los pacientes presentan vitíligo, erupción eritematosa o alopecia total. Las infecciones tienden a persistir durante la edad adulta. Se ha informado de que los pacientes afectados tienen una mayor susceptibilidad a las infecciones graves y crónicas por enterovirus. El crecimiento y el desarrollo suelen ser normales. Algunos pacientes tienen una presentación clínica menos grave y no se reconocen como inmunodeficientes hasta los 10 años de edad o más. Las complicaciones de la agammaglobulinemia ligada al cromosoma X (XLA) incluyen enfermedad pulmonar progresiva, sinusitis crónica, enfermedad intestinal inflamatoria, artritis , así como cambios neurológicos.


NM_000061.2(BTK):c.763C>T ; NM_000061.2(BTK):c.1766A>G ; NM_000061.2(BTK):c.919A>G ; NM_000061.2(BTK):c.1906G>T ; NM_000061.2(BTK):c.718G>T ; NM_000061.2(BTK):c.755G>A ; NM_000061.2(BTK):c.862C>T ; NM_000061.2(BTK):c.1559G>A ; NM_000061.2(BTK):c.1516T>C ; NM_000061.2(BTK):c.1082A>G ; NM_000061.2(BTK):c.1838G>A ; NM_000061.2(BTK):c.1773C>A ; NM_000061.2(BTK):c.1125T>G ; NM_000061.2(BTK):c.1288A>G ; NM_000061.2(BTK):c.338T>A ; NM_000061.2(BTK):c.1889T>A ; NM_000061.2(BTK):c.1558C>T ; NM_000061.2(BTK):c.1001A>C ; NM_000061.2(BTK):c.1820C>A ; NM_000061.2(BTK):c.1506C>A ; NM_000061.2(BTK):c.1275C>A ; NM_000061.2(BTK):c.1223T>C ; NM_000061.2(BTK):c.763C>T ; NM_000061.2(BTK):c.1766A>G ; NM_000061.2(BTK):c.919A>G ; NM_000061.2(BTK):c.1906G>T ; NM_000061.2(BTK):c.718G>T ; NM_000061.2(BTK):c.755G>A ; NM_000061.2(BTK):c.862C>T ; NM_000061.2(BTK):c.1559G>A ; NM_000061.2(BTK):c.1516T>C ; NM_000061.2(BTK):c.1082A>G ; NM_000061.2(BTK):c.1838G>A ; NM_000061.2(BTK):c.1773C>A ; NM_000061.2(BTK):c.1125T>G ; NM_000061.2(BTK):c.1288A>G ; NM_000061.2(BTK):c.338T>A ; NM_000061.2(BTK):c.1889T>A ; NM_000061.2(BTK):c.1558C>T ; NM_000061.2(BTK):c.1001A>C ; NM_000061.2(BTK):c.1820C>A ; NM_000061.2(BTK):c.1506C>A ; NM_000061.2(BTK):c.1275C>A ; NM_000061.2(BTK):c.1223T>C



Distrofia muscular de cinturas relacionada con la calpaína 3 R1

Subtipo de distrofia muscular autosómica recesiva de la cintura de las extremidades que se caracteriza por una edad variable de aparición de una debilidad y atrofia progresivas, típicamente simétricas y selectivas, de los músculos proximales de la cintura escapular y pélvica (el glúteo mayor, los aductores del muslo y los músculos del compartimento posterior de las extremidades son los más comúnmente afectados) sin afectación cardíaca o facial. Las manifestaciones clínicas incluyen intolerancia al ejercicio, marcha de pato, alas escapulares y pseudohipertrofia de la pantorrilla.


La distrofia muscular de cinturas autosómica recesiva afecta principalmente a los músculos proximales y provoca dificultades para caminar. La edad de inicio varía, pero la mayoría de los pacientes presentan un inicio en la infancia, y el trastorno es progresivo. Otros rasgos pueden ser el ala escapular, la pseudohipertrofia de la pantorrilla y las contracturas.


NM_000070.2(CAPN3):c.2251_2254dupGTCA ; NM_000070.2(CAPN3):c.1715G>A ; NM_000070.2(CAPN3):c.1468C>T ; c.217C>T ; NM_000070.2(CAPN3):c.580delT ; NM_000070.2(CAPN3):c.2362_2363delAGinsTCATCT ; NM_000070.2(CAPN3):c.223dupT ; NM_000070.2(CAPN3):c.1466G>A ; NM_000070.2(CAPN3):c.2120A>G ; NM_000070.2(CAPN3):c.855_864dupGTTGATTGCA ; c.1455_1458del ; NM_000070.2(CAPN3):c.2306G>A ; NM_000070.2(CAPN3):c.1469G>A ; NM_000070.2(CAPN3):c.598_612delTTCTGGAGTGCTCTG ; NM_000070.2(CAPN3):c.1795dupA ; NM_000070.3(CAPN3):c.549delA ; NM_000070.2(CAPN3):c.133G>A ; NM_000070.2(CAPN3):c.1838delA ; NM_000070.2(CAPN3):c.257C>T ; NM_000070.2(CAPN3):c.2243G>A ; NM_000070.2(CAPN3):c.328C>T ; NM_000070.2(CAPN3):c.1322delG ; c.367_368delinsTCATCT ; NM_000070.2(CAPN3):c.2251_2254dupGTCA ; NM_000070.2(CAPN3):c.1715G>A ; NM_000070.2(CAPN3):c.1468C>T ; c.217C>T ; NM_000070.2(CAPN3):c.580delT ; NM_000070.2(CAPN3):c.2362_2363delAGinsTCATCT ; NM_000070.2(CAPN3):c.223dupT ; NM_000070.2(CAPN3):c.1466G>A ; NM_000070.2(CAPN3):c.2120A>G ; NM_000070.2(CAPN3):c.855_864dupGTTGATTGCA ; c.1455_1458del ; NM_000070.2(CAPN3):c.2306G>A ; NM_000070.2(CAPN3):c.1469G>A ; NM_000070.2(CAPN3):c.598_612delTTCTGGAGTGCTCTG ; NM_000070.2(CAPN3):c.1795dupA ; NM_000070.3(CAPN3):c.549delA ; NM_000070.2(CAPN3):c.133G>A ; NM_000070.2(CAPN3):c.1838delA ; NM_000070.2(CAPN3):c.257C>T ; NM_000070.2(CAPN3):c.2243G>A ; NM_000070.2(CAPN3):c.328C>T ; NM_000070.2(CAPN3):c.1322delG ; c.367_368delinsTCATCT



Homocistinuria clásica

La homocistinuria clásica por deficiencia de cistationina beta-sintasa (CbS) se caracteriza por la afectación múltiple del ojo, el esqueleto, el sistema nervioso central y el sistema vascular.


Los pacientes son normales al nacer y, si no se tratan, el curso de la enfermedad es progresivo. Las anomalías oculares incluyen ectopia lentis (85% de los casos), con alta miopía. Los cambios esqueléticos incluyen genu valgum y pes cavus, seguidos de dolichostenomelia, pectus excavatum o carinatum y cifosis, o escoliosis y osteoporosis. El tromboembolismo, que afecta tanto a las arterias grandes como a las pequeñas y a las venas, es la causa más llamativa de morbilidad y mortalidad. La deficiencia intelectual rara vez se manifiesta antes del primer o segundo año de vida. En el 51% de los casos se encuentran enfermedades psiquiátricas clínicamente significativas. También se ha descrito la afectación del hígado, el cabello y la piel.


NM_000071.2(CBS):c.374G>A ; NM_000071.2(CBS):c.146C>T ; NM_000071.2(CBS):c.415G>A ; c.526G>T ; NM_000071.2(CBS):c.1058C>T ; NM_000071.2(CBS):c.969G>A ; NM_000071.2(CBS):c.797G>A ; NM_000071.2(CBS):c.1330G>A ; NM_000071.2(CBS):c.1136G>A ; NM_000071.2(CBS):c.1150A>G ; NM_000071.2(CBS):c.1006C>T ; NM_000071.2(CBS):c.325T>C ; NM_000071.2(CBS):c.572C>T ; NM_000071.2(CBS):c.992C>A ; NM_000071.2(CBS):c.919G>A ; NM_000071.2(CBS):c.959T>C ; NM_000071.2(CBS):c.341C>T ; NM_000071.2(CBS):c.374G>A ; NM_000071.2(CBS):c.146C>T ; NM_000071.2(CBS):c.415G>A ; c.526G>T ; NM_000071.2(CBS):c.1058C>T ; NM_000071.2(CBS):c.969G>A ; NM_000071.2(CBS):c.797G>A ; NM_000071.2(CBS):c.1330G>A ; NM_000071.2(CBS):c.1136G>A ; NM_000071.2(CBS):c.1150A>G ; NM_000071.2(CBS):c.1006C>T ; NM_000071.2(CBS):c.325T>C ; NM_000071.2(CBS):c.572C>T ; NM_000071.2(CBS):c.992C>A ; NM_000071.2(CBS):c.919G>A ; NM_000071.2(CBS):c.959T>C ; NM_000071.2(CBS):c.341C>T



Sordera neurosensorial autosómica recesiva de tipo DFNB

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Enfermedad de Cushing

La enfermedad de Cushing (EC) es la causa más común del síndrome de Cushing endógeno (SC; véase este término) y se debe a la hipersecreción crónica de ACTH por un adenoma corticotrofo hipofisario.


La proporción mujer-hombre de la EC es de 4-5:1, excepto en los pacientes prepúberes, en los que se observa un fuerte predominio masculino. El pico de incidencia se produce a los 25-40 años de edad. La enfermedad se manifiesta con signos de SC (obesidad troncal y facial y signos de hipercatabolismo), así como hiperpigmentación cutánea y/o complicaciones neurológicas en algunos casos de macroadenoma corticotrofo.

Adenoma hipofisario familiar aislado

Tumor endocrino hereditario poco frecuente, caracterizado por un adenoma hipofisario benigno que es secretor (por ejemplo, de prolactina, hormona del crecimiento, hormona estimulante del tiroides) o no secretor. Los síntomas pueden producirse debido a la hipersecreción hormonal y/o al efecto de masa de la lesión en las estructuras locales del cerebro.


En la FIPA, los adenomas hipofisarios pueden ser de cualquier tipo secretor (por ejemplo, prolactinoma, acromegalia, enfermedad de Cushing, secretor de TSH) o pueden ser no secretores. Los linajes de FIPA suelen tener de 2 a 4 miembros afectados con adenomas hipofisarios, mientras que un número mayor de pacientes afectados por familia puede ocurrir con poca frecuencia. En los casos de FIPA, los adenomas hipofisarios suelen comenzar a una edad más temprana y son más grandes que los casos esporádicos correspondientes no FIPA. Los adenomas hipofisarios en la FIPA pueden causar síntomas debido a la hipersecreción hormonal y/o debido al efecto de masa del adenoma hipofisario en las estructuras locales del cerebro (por ejemplo, trastornos visuales). En las familias FIPA con mutaciones AIP las características de crecimiento del adenoma hipofisario suelen ser agresivas y la hipersecreción hormonal puede ser marcada.


Una neoplasia rara, generalmente benigna, de la glándula pituitaria anterior que provoca hiperprolactinemia. Las manifestaciones clínicas más comunes son la amenorrea y la infertilidad en las mujeres, y la impotencia, la disminución de la libido y la infertilidad en los hombres.


La enfermedad suele aparecer entre la segunda y la cuarta década de la vida, con galactorrea, amenorrea e infertilidad en las mujeres e impotencia, disminución de la libido e infertilidad en los hombres. En los pacientes masculinos, el prolactinoma puede presentar un curso clínico más agresivo. El prolactinoma también puede causar efectos de masa (defectos del campo visual, cefaleas) o manifestaciones psiquiátricas (ansiedad, depresión).

Adenoma hipofisario secretor de TSH

Adenoma hipofisario funcional, poco frecuente, caracterizado por la presencia de una masa hipofisaria asociada a niveles elevados de hormonas tiroideas libres en circulación, junto con niveles de TSH de normales a elevados y falta de respuesta de los niveles de TSH a las pruebas de estimulación de TRH y supresión de T3, que suele manifestarse con signos y síntomas de hipertiroidismo de leve a moderado (por ejemplo, bocio (lo más frecuente). p. ej. bocio (lo más frecuente), palpitaciones, sudoración excesiva, arritmia, pérdida de peso, temblor) y/o efecto de masa tumoral (como cefalea, defectos del campo visual, hipopituitarismo). Ocasionalmente, la cosecreción de prolactina y/o de la hormona del crecimiento puede causar galactorrea y/o acromegalia.


Un adenoma hipofisario funcional poco frecuente que se caracteriza por la presencia de una masa hipofisaria asociada a niveles elevados de hormonas tiroideas libres circulantes junto con niveles de TSH normales o elevados y la falta de respuesta de los niveles de TSH a la estimulación con TRH y a las pruebas de supresión de T3, y que suele manifestarse con signos y síntomas de hipertiroidismo de leve a moderado (por ejemplo, bocio (lo más frecuente). p. ej. bocio (lo más frecuente), palpitaciones, sudoración excesiva, arritmia, pérdida de peso, temblor) y/o efecto de masa tumoral (como cefalea, defectos del campo visual, hipopituitarismo). Ocasionalmente, la cosecreción de prolactina y/o de la hormona del crecimiento puede causar galactorrea y/o acromegalia.

Síndrome de Usher tipo 1

Una rara ciliopatía caracterizada por sordera congénita profunda, retinitis pigmentosa y disfunción vestibular. La retinosis pigmentaria provoca la pérdida de visión y se manifiesta generalmente como ceguera nocturna, campos visuales progresivamente constreñidos y deterioro de la agudeza visual. La disfunción vestibular, que es una característica definitoria de esta forma, se manifiesta como un retraso en el desarrollo motor, ya que los niños afectados tardan más en sentarse de forma independiente y en caminar. Más adelante, la disfunción vestibular provoca dificultades en las actividades que requieren equilibrio.


Una rara ciliopatía caracterizada por sordera congénita profunda, retinitis pigmentosa y disfunción vestibular. La retinosis pigmentaria provoca la pérdida de la visión y se manifiesta generalmente como ceguera nocturna, campos visuales progresivamente constreñidos y agudeza visual deteriorada. La disfunción vestibular, que es una característica definitoria de esta forma, se manifiesta como un retraso en el desarrollo motor, ya que los niños afectados tardan más en sentarse de forma independiente y en caminar. Más adelante, la disfunción vestibular provoca dificultades en las actividades que requieren equilibrio.


c.3141C>A ; NM_022124.5(CDH23):c.6050-9G>A ; NM_022124.5(CDH23):c.5663T>C ; c.3579+2T>C ; c.9319+3_9319+6del ; c.288+1G>A ; c.3516_3519del ; c.1858+2T>G ; NC_000010.11:g.71740837C>T ; NM_022124.5(CDH23):c.193delC ; NM_022124.5(CDH23):c.5237G>A ; c.6393del ; NM_022124.5(CDH23):c.146-2A>G ; c.3141C>A ; NM_022124.5(CDH23):c.6050-9G>A ; NM_022124.5(CDH23):c.5663T>C ; c.3579+2T>C ; c.9319+3_9319+6del ; c.288+1G>A ; c.3516_3519del ; c.1858+2T>G ; NC_000010.11:g.71740837C>T ; NM_022124.5(CDH23):c.193delC ; NM_022124.5(CDH23):c.5237G>A ; c.6393del ; NM_022124.5(CDH23):c.146-2A>G



Síndrome de Bardet-Biedl

El síndrome de Bardet-Biedl (BBS) es una ciliopatía con afectación multisistémica.


Este trastorno se caracteriza por una combinación de signos clínicos: obesidad, retinopatía pigmentaria, polidactilia post-axial, riñones poliquísticos, hipogenitalismo y problemas de aprendizaje, muchos de los cuales aparecen varios años después del inicio de la enfermedad. La expresión clínica es variable, pero la mayoría de los pacientes manifiestan la mayoría de los signos clínicos durante el curso de la enfermedad. La retinopatía pigmentaria es el único signo clínico constante después de la infancia. El BBS también puede estar asociado a otras manifestaciones, como la diabetes, la hipertensión, la cardiopatía congénita y la enfermedad de Hirschsprung (véase este término).

Síndrome de Joubert con defecto oculorrenal

Un subtipo raro del síndrome de Joubert (JS) y trastornos relacionados (JSRD) caracterizado por los rasgos neurológicos del JS asociados a una enfermedad renal y ocular.


Los pacientes presentan afectación de la retina (que se manifiesta con amaurosis congénita de Leber (LCA, ver este término), o distrofia progresiva de la retina) y nefronoptisis (NPH, generalmente juvenil). La afectación de la retina está presente al nacer (LCA) o puede manifestarse más tarde. La NPH juvenil suele ser clínicamente sintomática hacia finales de la primera década o principios de la segunda.

Amaurosis congénita de Leber

La amaurosis congénita de Leber (ACL) es una distrofia de la retina definida por la ceguera y las respuestas a la estimulación electrofisiológica (electrorretinograma (ERG) de Ganzfeld) por debajo del umbral, asociada a una discapacidad visual grave en el primer año de vida.


La LCA se caracteriza por una agudeza visual gravemente reducida (inferior o igual a 20/400) o ceguera en el primer año de vida. Dependiendo de la causa genética, pueden aparecer respuestas pupilares lentas, movimientos oculares errantes, fotofobia, hipermetropía elevada, nistagmo, estrabismo convergente o queratocono. El signo oculo-digital de Franceschetti, que consiste en pinchar, presionar y frotar el ojo, es patognomónico. La ACV puede estar asociada a mutaciones en genes vinculados a síndromes que presentan un retraso del neurodesarrollo, discapacidad intelectual, comportamiento de tipo apraxia oculomotora (dificultad para mover el ojo) y disfunción renal.

Síndrome de Meckel

Trastorno genético de anomalías congénitas múltiples, raro y letal, que se caracteriza por la tríada de malformaciones cerebrales (principalmente encefalocele occipital), riñones grandes y poliquísticos y polidactilia, así como por anomalías asociadas que pueden incluir labio leporino/paladar hendido, anomalías cardíacas y genitales, malformaciones del sistema nervioso central (SNC), fibrosis hepática y displasia ósea.


Los fetos afectados por el síndrome de Meckel (MKS) sólo sobreviven entre unos días y unas semanas como máximo, o mueren en el útero. Las principales características del SNC incluyen encefalocele occipital, hidrocefalia, anencefalia, holoprosencefalia, así como Dandy-Walker. Los riñones grandes y poliquísticos con displasia quística son una característica constante del síndrome de Meckel. La disgenesia hepática y la fibrosis hepática son frecuentes. La polidactilia puede afectar a las cuatro extremidades y es típicamente postaxial (80%) o muy raramente preaxial. Los individuos afectados presentan hipoplasia pulmonar secundaria al oligohidramnios. Pueden observarse labio y paladar hendido, microftalmia y micrognatia. Las malformaciones cardíacas pueden incluir la comunicación interauricular, la coartación de la aorta, el conducto arterial persistente y la estenosis pulmonar valvular. Son frecuentes el desarrollo incompleto de los genitales internos y externos y la criptorquidia en los varones.

Síndrome de Senior-Loken

Se trata de una rara ciliopatía oculo-renal autosómica recesiva que se caracteriza por la asociación de nefronoptisis (NPHP), una enfermedad renal crónica, con distrofia de la retina.


La enfermedad se presenta típicamente en las dos primeras décadas de vida como una combinación de nefronoptisis (NPH) con degeneración de la retina. Dependiendo de los antecedentes genéticos, el trastorno visual o la enfermedad renal crónica determinan el cuadro clínico. La NPH suele presentar síntomas como poliuria, polidipsia, enuresis secundaria y anemia. La enfermedad renal crónica suele progresar lentamente hasta convertirse en una enfermedad renal terminal (ESKD). Las características oculares incluyen una pérdida visual grave congénita o de aparición temprana debida a una distrofia de la retina (amaurosis congénita de Leber) o un fenotipo más leve determinado por una restricción tubular de los campos visuales y ceguera nocturna de progresión lenta (degeneración tapeto-retiniana). La funduscopia revela diversos grados de alteraciones atróficas y pigmentarias de la retina. En raras ocasiones, pueden observarse otros signos clínicos adicionales como fibrosis hepática, obesidad y trastornos neurológicos.


NM_025114.3(CEP290):c.6798G>A ; NM_025114.3(CEP290):c.4393C>T ; NM_025114.3(CEP290):c.1665_1666delAA ; NM_025114.3(CEP290):c.4723A>T ; c.6624del ; NM_025114.3(CEP290):c.4705-1G>T ; NM_025114.3(CEP290):c.384_387delTAGA ; c.6448_6455del ; c.1681C>T ; NM_025114.3(CEP290):c.164_167delCTCA ; NM_025114.3(CEP290):c.613C>T ; c.4916C>A ; NM_025114.3(CEP290):c.21G>T ; NM_025114.3(CEP290):c.4962_4963delAA ; NM_025114.3(CEP290):c.5668G>T ; c.7324G>T ; NM_025114.3(CEP290):c.5611_5614delCAAA ; NM_025114.3(CEP290):c.3185delT ; c.1501G>T ; NM_025114.3(CEP290):c.2249T>G ; NM_025114.3(CEP290):c.6798G>A ; NM_025114.3(CEP290):c.4393C>T ; NM_025114.3(CEP290):c.1665_1666delAA ; NM_025114.3(CEP290):c.4723A>T ; c.6624del ; NM_025114.3(CEP290):c.4705-1G>T ; NM_025114.3(CEP290):c.384_387delTAGA ; c.6448_6455del ; c.1681C>T ; NM_025114.3(CEP290):c.164_167delCTCA ; NM_025114.3(CEP290):c.613C>T ; c.4916C>A ; NM_025114.3(CEP290):c.21G>T ; NM_025114.3(CEP290):c.4962_4963delAA ; NM_025114.3(CEP290):c.5668G>T ; c.7324G>T ; NM_025114.3(CEP290):c.5611_5614delCAAA ; NM_025114.3(CEP290):c.3185delT ; c.1501G>T ; NM_025114.3(CEP290):c.2249T>G






c.312del ; NM_201548.4(CERKL):c.1012C>T ; c.1631_1647dup ; NM_201548.4(CERKL):c.769C>T ; NM_201548.4(CERKL):c.780del ; c.312del ; NM_201548.4(CERKL):c.1012C>T ; c.1631_1647dup ; NM_201548.4(CERKL):c.769C>T ; NM_201548.4(CERKL):c.780del



Fibrosis quística

Trastorno pulmonar genético poco frecuente, caracterizado por sudoración, secreciones mucosas espesas que provocan enfermedades multisistémicas, infecciones crónicas de los pulmones, diarrea voluminosa y baja estatura.


La FQ es crónica y suele ser progresiva. Los síntomas suelen comenzar al nacer y afectan a los pulmones y al tracto gastrointestinal. Una presentación común puede incluir secreciones espesas e infecciones crónicas en el pulmón, diarrea voluminosa y baja estatura. Las secreciones anormales en las vías respiratorias, la inflamación y las infecciones conducen a la bronquiectasia y a la muerte temprana. La diabetes relacionada con la fibrosis quística (CFRD) es muy frecuente, llegando a casi el 50% de los pacientes que sobreviven hasta los 50 años. La esterilidad masculina es frecuente. Los individuos con fenotipos leves pueden tener síntomas respiratorios leves o ausentes en la infancia, pero algunos pueden tener infertilidad o pueden desarrollar bronquiectasias o pancreatitis más adelante. Estos individuos suelen ser diagnosticados mediante cribado neonatal, pero pueden ser diagnosticados más tarde en la vida.

Queratodermia palmoplantar acuagénica

Enfermedad cutánea poco frecuente que se caracteriza por arrugas transitorias en la piel, edema, formación de pápulas blanquecinas, prurito, sensación de quemazón o dolor, en las palmas de las manos y/o las plantas de los pies en respuesta al contacto con el agua. La duración de la exposición y la temperatura del agua afectan a la velocidad de desarrollo y a la intensidad de las lesiones. Esta afección es más común en las mujeres que en los hombres y se da con frecuencia en pacientes con fibrosis quística.



Ausencia bilateral congénita de los conductos deferentes

La ausencia bilateral congénita de los conductos deferentes (CBAVD) es una enfermedad que conduce a la infertilidad masculina.


Los pacientes infértiles con CBAVD producen pequeños volúmenes de esperma ácido (<1 ml con un pH<7,0).

Pancreatitis crónica hereditaria

Una rara enfermedad gastroenterológica caracterizada por pancreatitis aguda recurrente y/o pancreatitis crónica en al menos 2 familiares de primer grado, o 3 o más familiares de segundo grado en 2 o más generaciones, para la que no se identifican factores predisponentes. Esta rara forma hereditaria de pancreatitis provoca daños irreversibles en los componentes exocrino y endocrino del páncreas.


El inicio de la PCH suele ser temprano en la vida, durante la infancia y la adolescencia. La presentación clínica es muy variable e incluye dolor abdominal crónico o intermitente, de leve a grave, asociado a una insuficiencia pancreática exocrina, que conduce a una mala digestión y/o a una insuficiencia endocrina pancreática (intolerancia a la glucosa que progresa a diabetes mellitus de tipo 3c) en algunos casos. La enfermedad es lentamente progresiva. El riesgo de desarrollar un carcinoma pancreático después de los 50 años es elevado en los pacientes con HCP. Sin embargo, el aumento exacto del riesgo es difícil de evaluar.

Bronquiectasia idiopática

La bronquiectasia idiopática (IB) es una enfermedad pulmonar progresiva caracterizada por la dilatación crónica de los bronquios y la destrucción de las paredes bronquiales en ausencia de cualquier causa subyacente (como una enfermedad postinfecciosa, aspiración, inmunodeficiencia, anomalías congénitas y anomalías ciliares).



Infertilidad masculina con azoospermia u oligozoospermia debida a una mutación genética única

La infertilidad masculina con azoospermia u oligospermia debida a una mutación de un solo gen es una infertilidad masculina genética rara debida a un trastorno espermático que se caracteriza por la ausencia de una cantidad medible de espermatozoides en el eyaculado (azoospermia), o un número de espermatozoides en el eyaculado inferior a 15 millones/mL (oligozoospermia), resultante de una mutación en un solo gen que se sabe que causa azoo o oligoespermia. La morfología del esperma puede ser normal.


La aplasia bilateral congénita de los conductos deferentes (CBAVD), que conduce a la infertilidad masculina, puede ocurrir de forma aislada o como una manifestación de la fibrosis quística. Se ha comprobado que los varones con fibrosis quística son infértiles debido al fracaso del desarrollo normal de los conductos deferentes. Otros concluyeron que los cambios en los conductos de transporte del sistema genital masculino son responsables de la infertilidad y no son una anomalía del desarrollo, sino un cambio degenerativo debido a una obstrucción similar a la que se produce en el páncreas y las glándulas salivales en la fibrosis quística. 


NM_000492.3(CFTR):c.571T>G (p.Phe191Val) ; NM_000492.3(CFTR):c.592G>A (p.Ala198Thr) ; NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) ; NM_000492.3(CFTR):c.1399C>T (p.Leu467Phe) ; NM_000492.3(CFTR):c.1684G>C (p.Val562Leu) ; NM_000492.3(CFTR):c.2249C>T (p.Pro750Leu) ; NM_000492.3(CFTR):c.2855T>C (p.Met952Thr) ; NM_000492.3(CFTR):c.2939T>A (p.Ile980Lys) ; NM_000492.3(CFTR):c.4056G>T (p.Gln1352His) ; NM_000492.3(CFTR):c.328G>T (p.Asp110Tyr) ; NM_000492.3(CFTR):c.445G>T (p.Gly149Ter) ; NM_000492.3(CFTR):c.1438G>T (p.Gly480Cys) ; NM_000492.3(CFTR):c.3067_3072delATAGTG (p.Ile1023_Val1024del) ; NM_000492.3(CFTR):c.3536_3539delCCAA (p.Thr1179Asnfs) ; NM_000492.3(CFTR):c.445G>A (p.Gly149Arg) ; NM_000492.4:c.115C>T ; NM_000492.4:c.178G>T ; NM_000492.4:c.200C>T ; NM_000492.4:c.223C>T ; NM_000492.4:c.254G>A ; NM_000492.4:c.262_263delTT ; NM_000492.4:c.273+1G>A ; NM_000492.4:c.274-1G>A ; NM_000492.4:c.274G>A ; NM_000492.4:c.274G>T ; NM_000492.4:c.292C>T ; NM_000492.4:c.328G>C ; NM_000492.4:c.349C>T ; NM_000492.4:c.366T>A ; NM_000492.4:c.442delA ; NM_000492.4:c.489+1G>T ; NM_000492.4:c.531delT ; NM_000048.4:c.532G>A ; NM_000492.4:c.577G>T ; NM_000492.4:c.579+1G>T ; NM_000492.4:c.579+3A>G ; NM_000492.4:c.579+5G>A ; NM_000492.4:c.595C>T ; NM_000492.4:c.613C>T ; NM_000492.4:c.617T>G ; NM_000492.4:c.658C>T ; c.708del ; NM_000492.4:c.720_741delAGGGAGAATGATGATGAAGTAC ; NM_000492.4:c.803delA ; NC_000007.14:g.117540159_117540161TCT[2] ; NM_000492.4:c.988G>T ; NM_000492.4:c.1000C>T ; NM_000492.4:c.1007T>A ; NM_000492.4:c.1013C>T ; NM_000492.4:c.1021_1022dupTC ; NM_000492.4:c.1021T>C ; NM_000492.4:c.1040G>A ; NM_000492.4:c.1040G>C ; NM_000492.4:c.1055G>A ; NM_000492.4:c.1081delT ; NM_000492.3(CFTR):c.1297_1303delTTCTCAC (p.Ser434Leufs) ; NM_000492.4:c.1327_1330dupGATA ; NM_000492.4:c.1340delA ; NM_000492.4:c.1364C>A ; NM_000492.4:c.1393-1G>A ; NM_000492.4:c.1397C>A ; NM_000492.4:c.1397C>G ; NM_000492.4:c.1400T>C ; NM_000492.4:c.1466C>A ; NM_000492.4:c.1475C>T ; NM_000492.4:c.1477C>T ; NM_000492.4:c.1519_1521delATC ; NM_000492.4:c.1521_1523delCTT ; NM_000492.4:c.1545_1546delTA ; NM_000492.4:c.1585-1G>A ; NM_000492.4:c.1624G>T ; NM_000492.4:c.1692delA ; NM_000492.3(CFTR):c.1706A>G (p.Tyr569Cys) ; NM_000492.4:c.1721C>A ; NM_000492.4:c.1766+1G>A ; NM_000492.3:c.1970delG ; NM_000492.4:c.2012delT ; NM_000492.4:c.2052dupA ; NM_000492.4:c.2052delA ; NM_000492.4:c.2125C>T ; NM_000492.4:c.2128A>T ; NM_000492.4:c.2175dupA ; NM_000492.4:c.2195T>G ; NM_000492.4:c.2215delG ; NM_000492.4:c.2537G>A ; NM_000492.3(CFTR):c.2538G>A (p.Trp846Ter) ; NM_000492.4:c.2551C>T ; NM_000492.4:c.2583delT ; NM_000492.4:c.2657+5G>A ; NM_000492.4:c.2668C>T ; NM_000492.4:c.2737_2738insG ; NM_000492.4:c.2739T>A ; NM_000492.4:c.2780T>C ; NM_000492.4:c.2834C>T ; NM_000492.3:c.2869_2870insG ; NM_000492.4:c.2875delG ; NM_000492.4:c.2908G>C ; NM_000492.4:c.2989-1G>A ; NM_000492.4:c.3140-26A>G ; NM_000492.4:c.3194T>C ; NM_000492.4:c.3196C>T ; NM_000492.4:c.3197G>A ; NM_000492.4:c.3230T>C ; NM_000492.4:c.3266G>A ; NM_000492.4:c.3276C>A ; NM_000492.4:c.3276C>G ; NM_000492.4:c.3302T>A ; NM_000492.4:c.3310G>T ; NM_000492.4:c.3528delC ; NM_000492.4:c.3587C>G ; NM_000492.4:c.3611G>A ; NM_000492.4:c.3612G>A ; NM_000492.4:c.3659delC ; NM_000492.4:c.3731G>A ; NM_000492.4:c.3744delA ; NM_000492.4:c.3752G>A ; NM_000492.4:c.3761T>G ; NM_000492.4:c.3764C>A ; NM_000492.4:c.3773dupT ; NM_000492.4:c.3846G>A ; NM_000492.4:c.3909C>G ; NM_000492.4:c.3937C>T ; NM_000492.4:c.4251delA ; NM_000492.3(CFTR):c.4426C>T (p.Gln1476Ter) ; NM_000492.4:c.2175dupA ; NM_000492.4:c.2175dupA ; NM_000492.4:c.4077_4080delTGTTinsAA



Enfermedad CLN3

Las lipofuscinosis ceroides neuronales juveniles (JNCL) son un grupo genéticamente heterogéneo de lipofuscinosis ceroides neuronales (NCL; véase este término) que se caracterizan por un inicio en la edad escolar temprana con pérdida de visión debido a la retinopatía, convulsiones y el declive de las capacidades mentales y motoras.


La forma clásica de las JNCL (cJNCL, también denominada enfermedad de Batten y enfermedad de Spielmeyer-Vogt) suele manifestarse con un deterioro de la visión en un niño por lo demás sano a los seis años de edad aproximadamente. La ceguera se produce a los pocos años. Varios años después de la aparición de los problemas visuales, las capacidades cognitivas disminuyen y comienza la epilepsia. La demencia y las alteraciones motoras empeoran progresivamente. También se han notificado problemas psiquiátricos (como comportamiento agresivo y problemas de sueño). También se han descrito casos raros de JNCL en los que la afectación ocular no es una característica llamativa. La epilepsia y la demencia sin pérdida visual en estos pacientes pueden ser indicativas de una forma de JNCL conocida como la variante epiléptica del norte (epilepsia progresiva-déficit intelectual, tipo finlandés; ver este término).


NM_001042432.1(CLN3):c.1272delG ; NM_001042432.1(CLN3):c.622dupT ; NM_001042432.1(CLN3):c.597C>A ; NM_000086.2(CLN3):c.883G>A ; NM_001042432.1(CLN3):c.1272delG ; NM_001042432.1(CLN3):c.622dupT ; NM_001042432.1(CLN3):c.597C>A ; NM_000086.2(CLN3):c.883G>A



Enfermedad CLN5

Las lipofuscinosis ceroideas neuronales infantiles tardías (LINCL) son un grupo genéticamente heterogéneo de lipofuscinosis ceroideas neuronales (NCL; véase este término) que se caracterizan típicamente por su aparición durante la infancia o la niñez temprana, con deterioro de las capacidades mentales y motoras, epilepsia y pérdida de visión por degeneración de la retina.


Los síntomas clínicos iniciales son el deterioro motor y/o cognitivo o la epilepsia, pero la edad media de inicio y la velocidad de progresión pueden variar en función del defecto genético subyacente. Los pacientes con LINCL clásico suelen presentar un estancamiento del desarrollo mental o la aparición de epilepsia grave alrededor del tercer año de vida. El trastorno progresa hasta la pérdida completa de casi todas las capacidades motoras y mentales antes de la edad escolar. Como la pérdida visual no es un hallazgo prominente en las primeras etapas del curso de la enfermedad, a menudo no se reconoce. También se han descrito en la literatura diversas formas variantes (vLINCL) en las que la edad media de inicio suele variar entre los 2 y los 7 años y que suelen manifestarse con epilepsia grave seguida de deterioro cognitivo y motor y pérdida de visión.


NM_006493.2(CLN5):c.919delA ; NM_006493.2(CLN5):c.924_925delAT ; NM_006493.2(CLN5):c.595C>T ; NM_006493.2(CLN5):c.335G>C ; NM_006493.2(CLN5):c.613C>T ; NM_006493.2(CLN5):c.669dupC ; NM_006493.2(CLN5):c.565C>T ; NM_006493.2(CLN5):c.620G>C ; NM_006493.2(CLN5):c.955_970del16 ; NM_006493.2(CLN5):c.524T>G ; NM_006493.2(CLN5):c.575A>G ; NM_006493.2(CLN5):c.377G>A ; NM_006493.2(CLN5):c.1026C>A ; NM_006493.2(CLN5):c.835G>A ; c.526dup ; NM_006493.2(CLN5):c.433C>T ; NM_006493.2(CLN5):c.593T>C ; NM_006493.2(CLN5):c.919delA ; NM_006493.2(CLN5):c.924_925delAT ; NM_006493.2(CLN5):c.595C>T ; NM_006493.2(CLN5):c.335G>C ; NM_006493.2(CLN5):c.613C>T ; NM_006493.2(CLN5):c.669dupC ; NM_006493.2(CLN5):c.565C>T ; NM_006493.2(CLN5):c.620G>C ; NM_006493.2(CLN5):c.955_970del16 ; NM_006493.2(CLN5):c.524T>G ; NM_006493.2(CLN5):c.575A>G ; NM_006493.2(CLN5):c.377G>A ; NM_006493.2(CLN5):c.1026C>A ; NM_006493.2(CLN5):c.835G>A ; c.526dup ; NM_006493.2(CLN5):c.433C>T ; NM_006493.2(CLN5):c.593T>C



Enfermedad CLN4A

Se trata de un grupo genéticamente heterogéneo de lipofuscinosis neuronal ceroidea (LCN) con aparición durante la tercera década de la vida, caracterizada por demencia, convulsiones y pérdida de las capacidades motoras, y a veces asociada a la pérdida visual causada por la degeneración de la retina.


El cuadro clínico se caracteriza por un inicio con epilepsia mioclónica progresiva o alteraciones del comportamiento, demencia y síntomas motores extrapiramidales que aparecen a la edad de 20-30 años. La pérdida de visión es una característica poco común y depende de la causa genética subyacente.

Enfermedad CLN6

Las lipofuscinosis ceroideas neuronales infantiles tardías (LINCLs) son un grupo genéticamente heterogéneo de lipofuscinosis ceroideas neuronales (NCLs; ver este término) que se caracterizan por aparecer durante la infancia o la niñez temprana con un declive de las capacidades mentales y motoras, epilepsia y pérdida de visión por degeneración de la retina.


Los síntomas clínicos iniciales son el deterioro motor y/o cognitivo o la epilepsia, pero la edad media de inicio y la velocidad de progresión pueden variar en función del defecto genético subyacente. Los pacientes con LINCL clásico suelen presentar un estancamiento del desarrollo mental o la aparición de epilepsia grave alrededor del tercer año de vida. El trastorno progresa hasta la pérdida completa de casi todas las capacidades motoras y mentales antes de la edad escolar. Como la pérdida visual no es un hallazgo prominente en las primeras etapas del curso de la enfermedad, a menudo no se reconoce. También se han descrito en la literatura varias formas variantes (vLINCL) en las que la edad media de inicio suele variar entre los 2 y los 7 años y que suelen manifestarse con epilepsia grave seguida de deterioro cognitivo y motor y pérdida de visión.


NM_017882.2(CLN6):c.214G>T ; NM_017882.2(CLN6):c.200T>C ; NM_017882.2(CLN6):c.663C>G ; NM_017882.2(CLN6):c.214G>T ; NM_017882.2(CLN6):c.200T>C ; NM_017882.2(CLN6):c.663C>G



Enfermedad CLN8

Las lipofuscinosis neuronales ceroides (NCL) son un grupo de enfermedades cerebrales degenerativas progresivas y hereditarias que se caracterizan clínicamente por una disminución de las capacidades mentales y de otro tipo, epilepsia y pérdida de visión por degeneración de la retina, e histopatológicamente por la acumulación intracelular de un material autofluorescente, la lipofuscina ceroide, en las células neuronales del cerebro y de la retina.


La presentación clínica varía mucho entre las distintas formas, pero el sello clínico es una combinación de demencia, pérdida visual y epilepsia. Las manifestaciones pueden comenzar entre el periodo neonatal y la edad adulta joven, dependiendo de la forma, lo que llevó a la clasificación original de las NCL por edad de inicio en subgrupos de NCL congénita, infantil, infantil tardía, juvenil y adulta (ver estos términos). También se ha descrito una variante de la epilepsia del Norte (epilepsia progresiva-déficit intelectual, tipo finlandés; véase este término), en la que los problemas visuales pueden estar ausentes o ser leves y pasar desapercibidos.

Síndrome de epilepsia progresiva y discapacidad intelectual, tipo finlandés

La epilepsia progresiva-déficit intelectual, tipo finlandés (también conocida como epilepsia del Norte) es un subtipo de lipofuscinosis ceroidea neuronal (LCN; véase este término) que se caracteriza por convulsiones, disminución progresiva de las capacidades intelectuales y pérdida variable de la visión.


El trastorno se caracteriza por convulsiones tónico-clónicas generalizadas con inicio entre los 5 y 10 años de edad y posterior deterioro mental lentamente progresivo. Las convulsiones aumentan en frecuencia hasta la pubertad, después de lo cual la actividad epiléptica comienza a disminuir. El déficit intelectual es grave, se desarrolla entre 2 y 5 años después del inicio de las crisis y progresa continuamente hasta la edad adulta. Los problemas visuales no son una característica destacada de este trastorno; si están presentes pueden ser leves y pasar desapercibidos.


NM_018941.3(CLN8):c.610C>T ; NM_018941.3(CLN8):c.789G>C ; NM_018941.3(CLN8):c.88delG ; NM_018941.3(CLN8):c.88G>C ; NM_018941.3(CLN8):c.610C>T ; NM_018941.3(CLN8):c.789G>C ; NM_018941.3(CLN8):c.88delG ; NM_018941.3(CLN8):c.88G>C



Retinitis pigmentaria

La retinosis pigmentaria (RP) es una distrofia hereditaria de la retina que conduce a la pérdida progresiva de los fotorreceptores y del epitelio pigmentario de la retina y que provoca la ceguera generalmente después de varias décadas.


La retinosis pigmentaria es lentamente progresiva pero implacable. Sin embargo, existe una amplia variabilidad en la edad de inicio, la tasa de progresión y las manifestaciones clínicas secundarias. Los individuos afectados suelen desarrollar primero ceguera nocturna (nictalopía) debido a la pérdida de la función de los bastones, a menudo en la adolescencia o antes. A continuación, desarrollan un deterioro del campo visual periférico y, con el tiempo, la pérdida de la visión central, normalmente en etapas tardías, a menudo en torno a la mediana edad. La pérdida de agudeza visual central puede producirse a cualquier edad como resultado de un edema macular cistoide o de la pérdida de fotorreceptores. Las cataratas subcapsulares posteriores son frecuentes y su gravedad depende de la edad. También puede encontrarse una reducción de la visión de los colores. El examen del fondo de ojo revela depósitos de pigmento de espícula ósea, vasos retinianos atenuados, atrofia de la retina y palidez del nervio óptico. La gravedad está parcialmente correlacionada con el patrón de herencia: los casos ligados al cromosoma X son los más graves, los casos autosómicos recesivos y de ocurrencia única tienen una gravedad intermedia, y los autosómicos dominantes son los más favorables.

Síndrome de Usher tipo 3

Una ciliopatía rara que se caracteriza por una pérdida progresiva de la audición y la visión en las primeras décadas de la vida y, en algunos casos, por una disfunción vestibular. Los pacientes tienen una audición normal al nacer. El inicio de la pérdida de audición suele producirse al final de la infancia o en la adolescencia, tras el desarrollo del habla. La sordera profunda se registra sobre todo en la mediana edad. La pérdida visual relacionada con la retinosis pigmentaria también se desarrolla en la infancia tardía o en la adolescencia. Los hitos motrices del desarrollo suelen ser normales, pero pueden aparecer disfunciones vestibulares en la edad adulta.


Una ciliopatía rara que se caracteriza por una pérdida progresiva de la audición y la visión en las primeras décadas de la vida y, en algunos casos, por una disfunción vestibular. Los pacientes tienen una audición normal al nacer. El inicio de la pérdida de audición suele producirse al final de la infancia o en la adolescencia, tras el desarrollo del habla. La sordera profunda se registra sobre todo en la mediana edad. La pérdida visual relacionada con la retinosis pigmentaria también se desarrolla en la infancia tardía o en la adolescencia. Los hitos motrices del desarrollo suelen ser normales, pero puede producirse una disfunción vestibular en la edad adulta.


NM_001195794.1:c.144T>G ; c.633dup ; NM_001195794.1(CLRN1):c.92C>T ; NM_001195794.1(CLRN1):c.189C>A ; NM_001195794.1:c.144T>G ; c.633dup ; NM_001195794.1(CLRN1):c.92C>T ; NM_001195794.1(CLRN1):c.189C>A






La ACHM se caracteriza por una reducción de la agudeza visual, nistagmo pendular, aumento de la sensibilidad a la luz (fotofobia), un pequeño escotoma central y una pérdida reducida o completa de la discriminación del color. La mayoría de los individuos tienen una ACHM completa, con ausencia total de función en los tres tipos de conos. En raras ocasiones, los individuos tienen ACHM incompleta, con síntomas similares, pero generalmente menos graves.

Distrofia progresiva de conos

Una rara distrofia de la retina caracterizada por fotofobia, pérdida progresiva de la agudeza visual, nistagmo, anomalías del campo visual, visión anormal de los colores y pruebas psicofísicas y electrofisiológicas de una función anormal de los conos. La distrofia progresiva de los conos suele presentarse en la infancia o en los primeros años de la vida adulta, y los pacientes tienden a desarrollar una disfunción de los fotorreceptores de los bastones en etapas posteriores de la vida.



Enfermedad de Stargardt

Es un trastorno oftálmico poco frecuente que suele caracterizarse por una pérdida progresiva de la visión central asociada a motas irregulares maculares y perimaculares de color blanco amarillento en el fondo de ojo, y a una lesión macular central atrófica denominada ''bronce batido''.


La enfermedad suele presentarse en las dos primeras décadas de vida, aunque los síntomas también pueden aparecer durante la edad adulta y hasta la séptima década. Aunque la progresión y la gravedad de la enfermedad varían mucho, la enfermedad de Stargardt (STGD1) suele caracterizarse por una pérdida progresiva de la visión central que provoca visión borrosa y, ocasionalmente, una creciente dificultad para adaptarse en la oscuridad. La visión periférica suele ser normal. La mayoría de los individuos afectados también tienen una visión del color deteriorada. Puede haber fotofobia.


NM_019098.4(CNGB3):c.819_826delCAGACTCC ; c.2048_2049del ; c.893_897del ; c.887_896del ; NM_019098.4(CNGB3):c.1063C>T ; c.2011G>T ; NM_019098.4(CNGB3):c.446_447insT ; NM_019098.4:c.1148delC ; c.886_890del ; NM_019098.4(CNGB3):c.819_826delCAGACTCC ; c.2048_2049del ; c.893_897del ; c.887_896del ; NM_019098.4(CNGB3):c.1063C>T ; c.2011G>T ; NM_019098.4(CNGB3):c.446_447insT ; NM_019098.4:c.1148delC ; c.886_890del



Síndrome de Alport autosómico dominante

Enfermedad renal rara que se caracteriza por una nefropatía glomerular con hematuria que evoluciona hacia una enfermedad renal terminal (ESRD), frecuentemente asociada a una sordera neurosensorial, y ocasionalmente a anomalías oculares.


Los subtipos clínicos de la EA incluyen la EA ligada al cromosoma X (XL), la autosómica recesiva (AR) y la autosómica dominante (AD), y representan aproximadamente el 80%, el 15% y el 5% de todos los casos de EA, respectivamente. La EA puede presentarse desde la infancia hasta la edad avanzada, aunque generalmente se manifiesta antes (durante la infancia o la adolescencia) en las formas XL y AR. Los varones están gravemente afectados en la forma XLAS y presentan microhematuria muy temprano en la vida, seguida de microalbuminuria, macroproteinuria y progresión a la enfermedad renal terminal antes de los 40 años. El XLAS es muy variable en las mujeres, desde una enfermedad asintomática hasta hematuria microscópica de por vida (con función renal conservada), o insuficiencia renal a una edad temprana. Es frecuente la pérdida de audición neurosensorial. Ocasionalmente, pueden desarrollarse anomalías oculares (por ejemplo, lenticonus anterior, manchas en la retina, lesiones en la córnea) en la infancia tardía o en la edad adulta temprana, y los varones se ven más afectados que las mujeres. En raras ocasiones, puede asociarse una leiomiomatosis (esófago, árbol traqueobronquial o genitales femeninos), formando la leiomiomatosis difusa ligada al cromosoma X-AS (XL-DLAS). La ARAS es similar a la XLAS en los varones, pero se presenta sin diferenciación de género en el curso de la enfermedad y en los antecedentes familiares. La ADAS varía desde una enfermedad asintomática (que se presenta sobre todo como una hematuria benigna familiar) hasta formas de AD de proteinuria y glomeruloesclerosis segmentaria focal (en casos sin hematuria o no como presentación de primera línea). La progresión hacia la ERS suele ser más lenta que en la XLAS, y las manifestaciones extrarrenales son menos frecuentes.

Síndrome de Alport autosómico recesivo

Enfermedad renal rara que se caracteriza por una nefropatía glomerular con hematuria que evoluciona hacia una enfermedad renal terminal (ESRD), frecuentemente asociada a una sordera neurosensorial, y ocasionalmente a anomalías oculares.


Los subtipos clínicos de la EA incluyen la EA ligada al cromosoma X (XL), la autosómica recesiva (AR) y la autosómica dominante (AD), y representan aproximadamente el 80%, el 15% y el 5% de todos los casos de EA, respectivamente. La EA puede presentarse desde la infancia hasta la edad avanzada, aunque generalmente se manifiesta antes (durante la infancia o la adolescencia) en las formas XL y AR. Los varones están gravemente afectados en la forma XLAS y presentan microhematuria muy temprano en la vida, seguida de microalbuminuria, macroproteinuria y progresión a la enfermedad renal terminal antes de los 40 años. El XLAS es muy variable en las mujeres, desde una enfermedad asintomática hasta hematuria microscópica de por vida (con función renal conservada), o insuficiencia renal a una edad temprana. Es frecuente la pérdida de audición neurosensorial. Ocasionalmente, pueden desarrollarse anomalías oculares (por ejemplo, lenticonus anterior, manchas en la retina, lesiones en la córnea) en la infancia tardía o en la edad adulta temprana, y los varones se ven más afectados que las mujeres. En raras ocasiones, puede asociarse una leiomiomatosis (esófago, árbol traqueobronquial o genitales femeninos), formando la leiomiomatosis difusa ligada al cromosoma X-AS (XL-DLAS). La ARAS es similar a la XLAS en los varones, pero se presenta sin diferenciación de género en el curso de la enfermedad y en los antecedentes familiares. La ADAS varía desde una enfermedad asintomática (que se presenta sobre todo como una hematuria benigna familiar) hasta formas de AD de proteinuria y glomeruloesclerosis segmentaria focal (en casos sin hematuria o no como presentación de primera línea). La progresión hacia la ERS suele ser más lenta que en la XLAS, y las manifestaciones extrarrenales son menos frecuentes.

Síndrome nefrótico genético resistente a los esteroides

Un raro síndrome nefrótico hereditario caracterizado por proteinuria, hipoalbuminemia, edema e hiperlipidemia, con ausencia de respuesta a una prueba inicial de corticosteroides (es decir, síndrome nefrótico resistente a los esteroides; SRNS) y un curso generalmente complicado.


La aparición de la enfermedad puede producirse en cualquier momento entre el nacimiento y la edad adulta, pero se presenta predominantemente en poblaciones jóvenes. El síndrome nefrótico se define por una proteinuria grave (relación proteína/creatinina urinaria > 200 mg/mmol) con una albúmina sérica baja (<30 g/l) y posibles edemas. La biopsia muestra enfermedad con cambios mínimos (ECM), glomeruloesclerosis segmentaria focal (GFS) o, más raramente, esclerosis mesangial difusa (EMD), y borramiento del proceso podocitario del pie por microscopía electrónica. Es resistente a múltiples fármacos y suele progresar hasta la insuficiencia renal terminal; sin embargo, los pacientes tienen un riesgo muy bajo de recurrencia tras un trasplante de riñón.

NO RARO EN EUROPA: Hematuria familiar benigna





NM_000091.4(COL4A3):c.2083G>A ; NM_000091.4(COL4A3):c.898G>A ; NM_000091.4(COL4A3):c.4441C>T ; c.2111del ; NM_000091.4(COL4A3):c.345delG ; NM_000091.4(COL4A3):c.4420_4424del5 ; NM_000091.4(COL4A3):c.4571C>G ; NM_000091.4(COL4A3):c.2083G>A ; NM_000091.4(COL4A3):c.898G>A ; NM_000091.4(COL4A3):c.4441C>T ; c.2111del ; NM_000091.4(COL4A3):c.345delG ; NM_000091.4(COL4A3):c.4420_4424del5 ; NM_000091.4(COL4A3):c.4571C>G



Síndrome de Alport autosómico dominante

Enfermedad renal rara que se caracteriza por una nefropatía glomerular con hematuria que evoluciona hacia una enfermedad renal terminal (ESRD), frecuentemente asociada a una sordera neurosensorial, y ocasionalmente a anomalías oculares.


Los subtipos clínicos de la EA incluyen la EA ligada al cromosoma X (XL), la autosómica recesiva (AR) y la autosómica dominante (AD), y representan aproximadamente el 80%, el 15% y el 5% de todos los casos de EA, respectivamente. La EA puede presentarse desde la infancia hasta la edad avanzada, aunque generalmente se manifiesta antes (durante la infancia o la adolescencia) en las formas XL y AR. Los varones están gravemente afectados en la forma XLAS y presentan microhematuria muy temprano en la vida, seguida de microalbuminuria, macroproteinuria y progresión a la enfermedad renal terminal antes de los 40 años. El XLAS es muy variable en las mujeres, desde una enfermedad asintomática hasta hematuria microscópica de por vida (con función renal conservada), o insuficiencia renal a una edad temprana. Es frecuente la pérdida de audición neurosensorial. Ocasionalmente, pueden desarrollarse anomalías oculares (por ejemplo, lenticonus anterior, manchas en la retina, lesiones en la córnea) en la infancia tardía o en la edad adulta temprana, y los varones se ven más afectados que las mujeres. En raras ocasiones, puede asociarse una leiomiomatosis (esófago, árbol traqueobronquial o genitales femeninos), formando la leiomiomatosis difusa ligada al cromosoma X-AS (XL-DLAS). La ARAS es similar a la XLAS en los varones, pero se presenta sin diferenciación de género en el curso de la enfermedad y en los antecedentes familiares. La ADAS varía desde una enfermedad asintomática (que se presenta sobre todo como una hematuria benigna familiar) hasta formas de AD de proteinuria y glomeruloesclerosis segmentaria focal (en casos sin hematuria o no como presentación de primera línea). La progresión hacia la ERS suele ser más lenta que en la XLAS, y las manifestaciones extrarrenales son menos frecuentes.

Síndrome de Alport autosómico recesivo

Enfermedad renal rara que se caracteriza por una nefropatía glomerular con hematuria que evoluciona hacia una enfermedad renal terminal (ESRD), frecuentemente asociada a una sordera neurosensorial, y ocasionalmente a anomalías oculares.


Los subtipos clínicos de la EA incluyen la EA ligada al cromosoma X (XL), la autosómica recesiva (AR) y la autosómica dominante (AD), y representan aproximadamente el 80%, el 15% y el 5% de todos los casos de EA, respectivamente. La EA puede presentarse desde la infancia hasta la edad avanzada, aunque generalmente se manifiesta antes (durante la infancia o la adolescencia) en las formas XL y AR. Los varones están gravemente afectados en la forma XLAS y presentan microhematuria muy temprano en la vida, seguida de microalbuminuria, macroproteinuria y progresión a la enfermedad renal terminal antes de los 40 años. El XLAS es muy variable en las mujeres, desde una enfermedad asintomática hasta hematuria microscópica de por vida (con función renal conservada), o insuficiencia renal a una edad temprana. Es frecuente la pérdida de audición neurosensorial. Ocasionalmente, pueden desarrollarse anomalías oculares (por ejemplo, lenticonus anterior, manchas en la retina, lesiones en la córnea) en la infancia tardía o en la edad adulta temprana, y los varones se ven más afectados que las mujeres. En raras ocasiones, puede asociarse una leiomiomatosis (esófago, árbol traqueobronquial o genitales femeninos), formando la leiomiomatosis difusa ligada al cromosoma X-AS (XL-DLAS). La ARAS es similar a la XLAS en los varones, pero se presenta sin diferenciación de género en el curso de la enfermedad y en los antecedentes familiares. La ADAS varía desde una enfermedad asintomática (que se presenta sobre todo como una hematuria benigna familiar) hasta formas de AD de proteinuria y glomeruloesclerosis segmentaria focal (en casos sin hematuria o no como presentación de primera línea). La progresión hacia la ERS suele ser más lenta que en la XLAS, y las manifestaciones extrarrenales son menos frecuentes.

NO RARO EN EUROPA: Hematuria familiar benigna





NM_000092.4(COL4A4):c.3713C>A ; c.2312del ; NM_000092.4(COL4A4):c.3601G>A ; NM_000092.4(COL4A4):c.71+1G>A ; NM_000092.4(COL4A4):c.4129C>T ; NM_000092.4(COL4A4):c.4923C>A ; NM_000092.4(COL4A4):c.3713C>A ; c.2312del ; NM_000092.4(COL4A4):c.3601G>A ; NM_000092.4(COL4A4):c.71+1G>A ; NM_000092.4(COL4A4):c.4129C>T ; NM_000092.4(COL4A4):c.4923C>A



Epidermólisis bullosa distrófica generalizada autosómica dominante

La epidermólisis bullosa distrófica dominante generalizada (DDEB-gen) es un subtipo de epidermólisis bullosa distrófica (DEB, véase este término), anteriormente conocido como DDEB, tipo Pasini y Cockayne-Touraine, caracterizado por la formación de ampollas generalizadas, formación de milia, cicatrices atróficas y uñas distróficas.


El cuadro clínico de la epidermólisis bullosa distrófica dominante intermedia (DDEB-intermedia) suele ser más leve que el de las formas de DEB generalizada autosómica recesiva. La DDEB-intermedia se manifiesta normalmente en el nacimiento con el desarrollo de ampollas, que afectan principalmente a las extremidades. Las ampollas se curan desarrollando numerosos milios y cicatrices atróficas con aspecto de cebolla, especialmente visibles en los codos, las rodillas y las manos. La distrofia ungueal, siempre presente, puede conducir a la pérdida de las placas ungueales. Por lo general, los dedos de las manos y de los pies no están afectados por retracciones cicatriciales importantes. Pueden desarrollarse ampollas en la mucosa, principalmente en la cavidad oral y, con menor frecuencia, en el esófago, donde pueden causar estenosis, a menudo en fuerte contraste con la escasa afectación cutánea. Las caries dentales son relativamente frecuentes. La afectación de la córnea y del tracto genitourinario, la anemia y el retraso del crecimiento son raros.

Epidermólisis bullosa distrófica generalizada autosómica recesiva, forma intermedia

La epidermólisis bullosa distrófica recesiva (RDEB) generalizada, también conocida como RDEB no tipo Hallopeau-Siemens, es un subtipo de DEB (véase este término) que se caracteriza por la formación de ampollas cutáneas y mucosas generalizadas que no se asocian a deformidades graves.


Bajo el término RDEB intermedia se agrupa un espectro de fenotipos, que muestran una gravedad muy variable de la afectación cutánea y de las mucosas. La enfermedad se manifiesta al nacer o durante el periodo neonatal con ampollas generalizadas. La aplasia cutis congénita (ausencia congénita de la piel) también puede observarse al nacer. La cicatrización de las ampollas da lugar a la aparición de milia, cicatrices atróficas (menos graves que en la RDEB grave), uñas distróficas y, ocasionalmente, lesiones albopapuloides (pápulas de color blanco marfil con aspecto de cicatriz) y anomalías en el cuero cabelludo. En algunos pacientes, los fenómenos de cicatrización pueden conducir a un cierto grado de pseudosindactilia y a la pérdida de las placas ungueales. La afectación extracutánea es similar, pero menos grave que en la RDEB grave, sin que se produzcan deformidades en manos y pies asociadas a esta enfermedad. Las lesiones de la cavidad oral y la caries dental excesiva son comunes. Los pacientes tienen un menor riesgo de estenosis esofágica y de lesiones en la córnea que en la RDEB grave. El retraso del crecimiento y la anemia son poco frecuentes. La afectación del tracto genitourinario es rara. El riesgo de desarrollar carcinomas de células escamosas (CCE) también está aumentado, pero es menos frecuente que en la RDEB grave y se produce más tarde en la edad adulta.

Epidermólisis bullosa distrófica generalizada autosómica recesiva, forma grave

La epidermólisis bullosa distrófica generalizada grave (RDEB-sev gen) es el subtipo más grave de la epidermólisis bullosa distrófica (DEB, véase este término), anteriormente conocido como tipo Hallopeau-Siemens, y se caracteriza por la formación de ampollas y cicatrices cutáneas y mucosas generalizadas, asociadas a graves deformidades y a una importante afectación extracutánea.


Las ampollas se desarrollan de forma espontánea o después de un traumatismo leve al nacer o durante el periodo neonatal y afectan a todo el cuerpo (con predilección por la piel sobre las prominencias óseas) con una amplia implicación de la mucosa oral y gastrointestinal. Puede haber ulceración cutánea congénita con denudación extensa de una zona del cuerpo. Las lesiones se curan con cicatrices retráctiles y milia. Pueden aparecer nevos de epidermólisis bullosa (EB). Una cicatrización excesiva puede provocar la adhesión de los dedos de las manos y de los pies, lo que da lugar a una pseudosindactilia, y a contracturas articulares que causan además deformidades discapacitantes en manos y pies (''deformidades en manopla''). También se observa alopecia cicatricial del cuero cabelludo y pérdida permanente de las placas ungueales. La afectación ocular es frecuente e incluye blefaritis, pérdida de pestañas, ectropión, simblefaron y ampollas en la córnea que pueden llevar a la pérdida de visión. Las dificultades para masticar y tragar se deben a la anquiloglosia, la obliteración de los vestíbulos orales y la microstomía progresiva. Las caries dentales son numerosas. La estenosis esofágica es frecuente y provoca una disfagia grave. Las erosiones anales y perianales provocan grandes dolores durante la defecación y favorecen el estreñimiento. La amplia afectación gastrointestinal en combinación con un estado hipercatabólico debido a las heridas permanentes, la infección y la inflamación, inducen un estado de desnutrición crónica que contribuye al retraso del crecimiento, al retraso de la pubertad, a la osteopenia y a la osteoporosis. Pueden producirse estenosis uretrales. También se observa anemia refractaria, deficiencia de hierro e hipoalbuminemia. Casi todos los pacientes desarrollan al menos un carcinoma de células escamosas (CCE) agresivo, normalmente durante la tercera-cuarta década de vida.

Epidermólisis bullosa distrófica inversa

La epidermólisis bullosa distrófica recesiva (RDEB-I) es un subtipo raro de epidermólisis bullosa distrófica (DEB, véase este término) que se caracteriza por ampollas y erosiones que se limitan principalmente a las zonas cutáneas intertriginosas, la base del cuello, la parte superior de la espalda y la zona lumbosacra.


La enfermedad se manifiesta al nacer o poco después con ampollas generalizadas y erosiones superficiales de gravedad intermedia que curan con cicatrización atrófica y formación de milia. Desde la adolescencia hasta los primeros años de la vida adulta, las ampollas tienden a localizarse en los pliegues, especialmente en las axilas, la ingle, la zona perianal y la hendidura natal. Las mujeres pueden presentar una marcada formación de ampollas en la piel vulvovaginal e inframamaria. Otros lugares de predilección son la base del cuello, la parte superior de la espalda y la zona lumbosacra. La distrofia ungueal es típica pero de gravedad variable. Las lesiones de la mucosa con ampollas y cicatrices en la boca son características y pueden provocar microglosia (pérdida de papilas linguales y fusión de la lengua con el suelo de la boca) y anquiloglosia (obliteración de los vestíbulos orales y restricción progresiva de la apertura oral). La afectación esofágica suele ser grave y se asocia a un riesgo de estenosis esofágica que puede perjudicar la ingesta de nutrientes. Las lesiones de la porción más baja del tracto genitourinario también son comunes y pueden conducir al desarrollo de estenosis vaginales que pueden perjudicar la función sexual normal. Otros rasgos extracutáneos menos comunes son la estenosis del conducto auditivo externo o la oclusión completa con diversos grados de pérdida de audición; las erosiones corneales y la anemia. El retraso del crecimiento es poco frecuente. Los pacientes pueden desarrollar carcinomas de células escamosas, con un riesgo acumulado que alcanza el 23% a la edad de 50 años, que es mucho menor que en cualquiera de las dos formas generalizadas de RDEB (RDEB grave y RDEB intermedia).

Epidermólisis bullosa distrófica pruriginosa

La epidermólisis distrófica bullosa pruriginosa es un subtipo poco frecuente de epidermólisis bullosa distrófica (DEB, véase este término) que se caracteriza por lesiones cutáneas generalizadas o localizadas asociadas a un prurito grave, aunque no intratable.


Mientras que la fragilidad de la piel y las lesiones ampollosas suelen manifestarse en la infancia, que se curan con cicatrización atrófica y formación de milia, la aparición del prurito intenso suele retrasarse hasta la adolescencia o incluso la edad adulta. Al inicio del prurito, el cuadro clínico suele empeorar con el desarrollo de pápulas, nódulos, lesiones liquenoides e hipertróficas en una distribución lineal, preferentemente en las superficies extensoras de las extremidades. Suele haber distrofia ungueal.

Epidermólisis bullosa distrófica localizada, forma acral

Una epidermólisis bullosa distrófica (DEB) muy rara que se caracteriza por la formación de ampollas confinadas principalmente en las manos y los pies.



Epidermólisis bullosa distrófica localizada, sólo en las uñas

La epidermólisis bullosa distrófica sólo en las uñas es un subtipo poco frecuente de epidermólisis bullosa distrófica (DEB, véase este término) que no presenta ampollas y que se caracteriza por la ausencia de uñas o por su distrofia.



Epidermólisis bullosa distrófica localizada, forma pretibial

La epidermólisis bullosa distrófica pretibial es un subtipo poco frecuente de epidermólisis bullosa distrófica (DEB, véase este término) que se caracteriza por el desarrollo de ampollas, erosiones y lesiones liquenoides predominantemente en la región pretibial.


La epidermólisis bullosa distrófica pretibial es un subtipo poco frecuente de epidermólisis bullosa distrófica (DEB, véase este término) que se caracteriza por el desarrollo de ampollas, erosiones y lesiones liquenoides predominantemente en la región pretibial.

Epidermólisis bullosa distrófica autoreferencial

La dermólisis bullosa transitoria del recién nacido es un subtipo poco frecuente de epidermólisis bullosa distrófica (DEB, consulte este término) que se caracteriza por la aparición de ampollas generalizadas al nacer que suelen remitir en los primeros 6 a 24 meses de vida.


La enfermedad suele manifestarse al nacer o poco después. Las ampollas cutáneas suelen afectar a todo el cuerpo. Las ampollas también pueden afectar a la cavidad oral. La curación de las ampollas se asocia a una cicatrización leve, en su mayoría atrófica, y a la formación de milia. La actividad de la enfermedad suele cesar en los primeros 6 a 24 meses de vida, aunque hay algunos casos en los que las ampollas continúan después de los 3 años. La distrofia ungueal y cierto grado de fragilidad cutánea pueden persistir en la edad adulta. Desde el punto de vista ultraestructural, la presencia en los queratinocitos basales de inclusiones citoplasmáticas peculiares, conocidas como cuerpos estrellados, llenos de procolágeno VII no secretado, es típica de la enfermedad.


NC_000003.12:g.48572412C>T ; NM_000094.3(COL7A1):c.6527dupC ; c.6670G>T ; c.5821-1G>A ; c.7930-1G>C ; NC_000003.12:g.48588759dup ; NM_000094.3(COL7A1):c.6859G>A ; NM_000094.3(COL7A1):c.7411C>T ; NM_000094.3(COL7A1):c.7957G>A ; NM_000094.3(COL7A1):c.6187C>T ; NM_000094.3(COL7A1):c.8479C>T ; c.5443G>C ; NM_000094.3(COL7A1):c.5532+1G>A ; NM_000094.3(COL7A1):c.8393T>A ; c.7345-1G>A ; NM_000094.3(COL7A1):c.933C>A ; c.336C>G ; c.7912G>T ; c.8524_8527+10del ; c.6573+1G>T ; c.5287C>T ; c.5052+1G>A ; NM_000094.3(COL7A1):c.8440C>T ; NM_000094.3(COL7A1):c.4039G>C ; NC_000003.12:g.48584484C>A ; NM_000094.3(COL7A1):c.4888C>T ; NM_000094.3(COL7A1):c.6752G>A ; NM_000094.3(COL7A1):c.4373C>T ; NM_000094.3(COL7A1):c.706C>T ; NM_000094.3(COL7A1):c.425A>G ; NM_000094.3(COL7A1):c.5096C>T ; NM_000094.3(COL7A1):c.4783G>C ; NM_000094.3(COL7A1):c.8245G>A ; NM_000094.3(COL7A1):c.6205C>T ; NM_000094.3(COL7A1):c.887delG ; NC_000003.12:g.48585689C>A ; NC_000003.12:g.48572412C>T ; NM_000094.3(COL7A1):c.6527dupC ; c.6670G>T ; c.5821-1G>A ; c.7930-1G>C ; NC_000003.12:g.48588759dup ; NM_000094.3(COL7A1):c.6859G>A ; NM_000094.3(COL7A1):c.7411C>T ; NM_000094.3(COL7A1):c.7957G>A ; NM_000094.3(COL7A1):c.6187C>T ; NM_000094.3(COL7A1):c.8479C>T ; c.5443G>C ; NM_000094.3(COL7A1):c.5532+1G>A ; NM_000094.3(COL7A1):c.8393T>A ; c.7345-1G>A ; NM_000094.3(COL7A1):c.933C>A ; c.336C>G ; c.7912G>T ; c.8524_8527+10del ; c.6573+1G>T ; c.5287C>T ; c.5052+1G>A ; NM_000094.3(COL7A1):c.8440C>T ; NM_000094.3(COL7A1):c.4039G>C ; NC_000003.12:g.48584484C>A ; NM_000094.3(COL7A1):c.4888C>T ; NM_000094.3(COL7A1):c.6752G>A ; NM_000094.3(COL7A1):c.4373C>T ; NM_000094.3(COL7A1):c.706C>T ; NM_000094.3(COL7A1):c.425A>G ; NM_000094.3(COL7A1):c.5096C>T ; NM_000094.3(COL7A1):c.4783G>C ; NM_000094.3(COL7A1):c.8245G>A ; NM_000094.3(COL7A1):c.6205C>T ; NM_000094.3(COL7A1):c.887delG ; NC_000003.12:g.48585689C>A



Deficiencia de carbamoil-fosfato sintetasa 1

Un trastorno grave y poco frecuente del metabolismo del ciclo de la urea que se caracteriza por una hiperamonemia grave de inicio neonatal que se produce pocos días después del nacimiento y se manifiesta con letargo, vómitos, hipotermia, convulsiones, coma y muerte, o una presentación fuera del periodo neonatal a cualquier edad con síntomas (a veces) más leves de hiperamonemia.


En la forma de inicio neonatal de la deficiencia de carbamoil-fosfato sintetasa 1 (CPS1D), los pacientes suelen estar sanos al nacer, pero a los pocos días empiezan a manifestarse con letargo y falta de voluntad para alimentarse. La hiperamonemia grave continúa y se manifiesta con vómitos, hipotermia, hipotonía, convulsiones, coma, y puede llevar a la muerte. Fuera del periodo neonatal, los pacientes pueden presentarse en cualquier momento de la vida. Los factores de riesgo para la manifestación incluyen factores de estrés catabólico como el ayuno y las enfermedades intercurrentes. Las manifestaciones incluyen hiperamonemia con irritabilidad, letargo, cefalea, convulsiones, confusión, evitación de comidas ricas en proteínas, hipotonía axial y discapacidad cognitiva.


NM_001875.4(CPS1):c.1631C>T ; c.3556del ; NM_001875.4(CPS1):c.1912C>T ; NM_001875.4(CPS1):c.1631C>T ; c.3556del ; NM_001875.4(CPS1):c.1912C>T



Deficiencia de carnitina palmitoil transferasa 1A

La deficiencia de carnitina palmitoiltransferasa 1A (CPT-1A) es un error innato del metabolismo que afecta a la oxidación mitocondrial de los ácidos grasos de cadena larga (AGL) en el hígado y los riñones, y se caracteriza por ataques recurrentes de hipoglucemia hipocetósica inducida por el ayuno y riesgo de insuficiencia hepática.


La deficiencia de CPT-1A se manifiesta entre el nacimiento y los 18 meses de edad con ataques recurrentes de hipoglucemia hipocetósica de gravedad variable, desencadenados por el ayuno o por una enfermedad intercurrente, que pueden provocar graves secuelas neurológicas. Los pacientes con deficiencia de CPT-1A también pueden presentar encefalopatía hepática con pérdida de conciencia, convulsiones, coma o incluso muerte súbita. Puede haber riesgo de progresión a insuficiencia hepática. Los pacientes con deficiencia grave de CPT-1A también pueden presentar acidosis tubular renal.


NM_001876.4:c.1361A>G ; NM_001876.3(CPT1A):c.1393G>T ; NM_001031847.2(CPT1A):c.281+1G>A ; NM_001876.3(CPT1A):c.298C>T ; c.335_336del ; NM_001876.3(CPT1A):c.1436C>T ; NM_001876.3(CPT1A):c.1241C>T ; NM_001876.3(CPT1A):c.1079A>G ; NC_000011.10:g.68781907G>A ; NM_001876.3(CPT1A):c.222C>A ; NM_001876.4:c.1361A>G ; NM_001876.3(CPT1A):c.1393G>T ; NM_001031847.2(CPT1A):c.281+1G>A ; NM_001876.3(CPT1A):c.298C>T ; c.335_336del ; NM_001876.3(CPT1A):c.1436C>T ; NM_001876.3(CPT1A):c.1241C>T ; NM_001876.3(CPT1A):c.1079A>G ; NC_000011.10:g.68781907G>A ; NM_001876.3(CPT1A):c.222C>A



Encefalopatía necrosante aguda de la infancia

La encefalopatía aguda es una complicación neurológica grave de una infección que suele darse en niños. Se caracteriza por una fiebre alta acompañada en un plazo de 12 a 48 horas de convulsiones febriles, que a menudo conducen al coma, al fallo multiorgánico, al edema cerebral y a una elevada morbilidad y mortalidad. Las infecciones suelen ser víricas, en particular la gripe, aunque se han encontrado otros virus e incluso micoplasmas que causan el trastorno


Enfermedad neurológica rara que se caracteriza por una rápida aparición de convulsiones, un estado de conciencia alterado, un deterioro neurológico y grados variables de disfunción hepática tras una infección respiratoria o gastrointesitnal (por ejemplo, micoplasma, virus de la gripe) en un niño previamente sano. La resonancia magnética cerebral de los pacientes revela lesiones bilaterales, múltiples y simétricas que se observan predominantemente en los tálamos y el tronco cerebral, pero también en la sustancia blanca periventricular y el cerebelo en algunos casos.

Deficiencia de carnitina palmitoil transferasa II, forma miopática

La forma miopática de la deficiencia de carnitina palmitoiltransferasa II (CPT II), un trastorno metabólico heredado que afecta a la oxidación mitocondrial de los ácidos grasos de cadena larga (AGL), es la forma más común y menos grave de la deficiencia de CPT II (véase este término).


La edad de aparición varía entre 1 y 61 años, y el 70% de los casos se presentan por primera vez en la infancia. La enfermedad es más frecuente en los hombres, lo que probablemente refleje un sesgo en la detección relacionado con la exposición al ejercicio prolongado. Las manifestaciones clínicas se caracterizan por ataques recurrentes de rabdomiólisis, dolor muscular y debilidad desencadenados generalmente por el ejercicio físico prolongado y a veces exacerbados por temperaturas extremas; los episodios también pueden ser provocados o exacerbados por el ayuno prolongado, como puede ocurrir con una enfermedad viral intercurrente. Los episodios de rabdomiólisis pueden asociarse a una elevación extrema de la creatina-fosfocinasa sérica (CPK) y a mioglobinuria (en el 75% de los casos) y pueden conducir a una insuficiencia renal (en el 8-25% de los casos, pero rara vez requieren diálisis). Los pacientes son asintomáticos entre los episodios de rabdomiólisis.

Deficiencia de carnitina palmitoil transferasa II, forma neonatal

La forma neonatal de la deficiencia de carnitina palmitoiltransferasa II (CPT II) (véase este término), un trastorno hereditario que afecta a la oxidación mitocondrial de los ácidos grasos de cadena larga (AGL), es la forma letal de la enfermedad que se presenta con un fallo multisistémico.


Los bebés afectados experimentan hipoglucemia hipocetósica, insuficiencia hepática y respiratoria y pueden presentar cardiomiopatía, hipotonía muscular, calcificación hepática, riñones displásicos quísticos y malformaciones cerebrales debido a un defecto de migración neuronal. Pueden producirse convulsiones y coma, así como arritmias cardíacas que generalmente conducen a un paro cardíaco en el periodo perinatal/infantil temprano. La muerte se produce en un plazo de días a meses.

Deficiencia de carnitina palmitoil transferasa II, forma infantil grave

La forma infantil grave de la deficiencia de carnitina palmitoiltransferasa II (CPT II) (véase este término), un trastorno hereditario que afecta a la oxidación mitocondrial de los ácidos grasos de cadena larga (AGL), es la forma de aparición temprana de la enfermedad.


La presentación puede ser en el periodo neonatal, pero la mayoría de los casos tienen una edad de inicio entre los 6 y los 24 meses. La enfermedad se caracteriza por una severa intolerancia al ayuno que conduce a desórdenes metabólicos de hipoglucemia hipocetósica, lo que resulta en coma y convulsiones, y encefalopatía hepática que lleva a la insuficiencia hepática. Existe una miopatía del músculo esquelético y una cardiomiopatía asociadas que pueden dar lugar a arritmias cardíacas paroxísticas mortales.


NM_000098.2(CPT2):c.359A>G ; NM_000098.3:c.338C>T ; NM_000098.2(CPT2):c.725_726delAC ; NM_000098.2(CPT2):c.1784delC ; c.1237C>T ; NM_000098.2(CPT2):c.1883A>C ; c.1437C>G ; NM_000098.3:c.1239_1240delGA ; NM_000098.2(CPT2):c.1369A>T ; NM_000098.2(CPT2):c.149C>A ; NM_000098.2(CPT2):c.638A>G ; NM_000098.2(CPT2):c.1891C>T ; NM_000098.2(CPT2):c.520G>A ; NM_000098.2(CPT2):c.452G>A ; NM_000098.2(CPT2):c.1148T>A ; NM_000098.2(CPT2):c.370C>T ; c.464dup ; NM_000098.2(CPT2):c.886C>T ; NM_000098.2(CPT2):c.680C>T ; NM_000098.2(CPT2):c.359A>G ; NM_000098.3:c.338C>T ; NM_000098.2(CPT2):c.725_726delAC ; NM_000098.2(CPT2):c.1784delC ; c.1237C>T ; NM_000098.2(CPT2):c.1883A>C ; c.1437C>G ; NM_000098.3:c.1239_1240delGA ; NM_000098.2(CPT2):c.1369A>T ; NM_000098.2(CPT2):c.149C>A ; NM_000098.2(CPT2):c.638A>G ; NM_000098.2(CPT2):c.1891C>T ; NM_000098.2(CPT2):c.520G>A ; NM_000098.2(CPT2):c.452G>A ; NM_000098.2(CPT2):c.1148T>A ; NM_000098.2(CPT2):c.370C>T ; c.464dup ; NM_000098.2(CPT2):c.886C>T ; NM_000098.2(CPT2):c.680C>T



Amaurosis congénita de Leber

La amaurosis congénita de Leber (ACL) es una distrofia de la retina definida por la ceguera y las respuestas a la estimulación electrofisiológica (electrorretinograma (ERG) de Ganzfeld) por debajo del umbral, asociada a una discapacidad visual grave en el primer año de vida.


La LCA se caracteriza por una agudeza visual gravemente reducida (inferior o igual a 20/400) o ceguera en el primer año de vida. Dependiendo de la causa genética, pueden aparecer respuestas pupilares lentas, movimientos oculares errantes, fotofobia, hipermetropía elevada, nistagmo, estrabismo convergente o queratocono. El signo oculo-digital de Franceschetti, que consiste en pinchar, presionar y frotar el ojo, es patognomónico. La ACV puede estar asociada a mutaciones en genes vinculados a síndromes que presentan un retraso del neurodesarrollo, discapacidad intelectual, comportamiento de tipo apraxia oculomotora (dificultad para mover el ojo) y disfunción renal.


Es una enfermedad oftalmológica rara y una forma grave de microftalmia (fenotipo de ojo pequeño) caracterizada por un ojo pequeño con una longitud axial corta, hipermetropía grave, una relación lente/ojo elevada y una alta incidencia de glaucoma de ángulo cerrado.


La enfermedad se produce en el período neonatal o durante la infancia. Los signos clínicos típicos incluyen una longitud axial inferior a 20 mm, una relación lente/ojo de 4 a 8 veces superior a la normal, una esclerótica engrosada y anormalmente densa, un cristalino y una coroides engrosados y una hipermetropía grave (de +7,00 D a +13,00 D). A pesar de su pequeño tamaño, la funcionalidad y la organización del ojo están conservadas. El nanoftalmos es generalmente bilateral. El estrabismo está presente en la mayoría de los pacientes. Se ha descrito la asociación de nanoftalmos y retinopatía pigmentaria o enfermedad de Best. La afección puede ser simple (se produce de forma aislada), compleja (asociada a otras malformaciones como colobomas, disgenesia del segmento anterior y anomalías del cristalino y del segmento posterior) o sindrómica (como parte de un síndrome raro).

Atrofia retinocoroidea paravenosa pigmentada

La atrofia retinocoroidea paravenosa pigmentada (ARPP) es una enfermedad retiniana rara, comúnmente bilateral y simétrica, que se caracteriza por una atrofia coriorretiniana no progresiva o lentamente progresiva, cambios pigmentarios peripapilares y acumulación de pigmentación "ósea" a lo largo de las venas retinianas, y que suele ser asintomática o puede presentarse con una leve visión borrosa.


La atrofia retinocoroidea paravenosa pigmentada (ARPP) es una enfermedad retiniana rara, comúnmente bilateral y simétrica, que se caracteriza por una atrofia coriorretiniana no progresiva o lentamente progresiva, cambios pigmentarios peripapilares y acumulación de pigmentación "óseo-corpuscular" a lo largo de las venas retinianas y que suele ser asintomática o puede presentarse con visión borrosa leve.

Retinitis pigmentaria

La retinosis pigmentaria (RP) es una distrofia hereditaria de la retina que conduce a la pérdida progresiva de los fotorreceptores y del epitelio pigmentario de la retina y que provoca la ceguera generalmente después de varias décadas.


La retinosis pigmentaria es lentamente progresiva pero implacable. Sin embargo, existe una amplia variabilidad en la edad de inicio, la tasa de progresión y las manifestaciones clínicas secundarias. Los individuos afectados suelen desarrollar primero ceguera nocturna (nictalopía) debido a la pérdida de la función de los bastones, a menudo en la adolescencia o antes. A continuación, desarrollan un deterioro del campo visual periférico y, con el tiempo, la pérdida de la visión central, normalmente en etapas tardías, a menudo en torno a la mediana edad. La pérdida de agudeza visual central puede producirse a cualquier edad como resultado de un edema macular cistoide o de la pérdida de fotorreceptores. Las cataratas subcapsulares posteriores son frecuentes y su gravedad depende de la edad. También puede encontrarse una reducción de la visión de los colores. El examen del fondo de ojo revela depósitos de pigmento de espícula ósea, vasos retinianos atenuados, atrofia de la retina y palidez del nervio óptico. La gravedad está parcialmente correlacionada con el patrón de herencia: los casos ligados al cromosoma X son los más graves, los casos autosómicos recesivos y de ocurrencia única tienen una gravedad intermedia, y los autosómicos dominantes son los más favorables.


NM_201253.2(CRB1):c.3383delT ; c.3083T>A ; NM_201253.2(CRB1):c.613_619delATAGGAA ; NM_201253.2(CRB1):c.2290C>T ; NM_201253.2(CRB1):c.2401A>T ; NM_201253.2(CRB1):c.2983G>T ; NM_201253.2(CRB1):c.3122T>C ; NM_201253.2(CRB1):c.2688T>A ; NM_201253.2(CRB1):c.2843G>A ; c.2080G>T ; NM_201253.2(CRB1):c.3997G>T ; c.2719_2723dup ; NM_201253.2(CRB1):c.3299T>G ; NM_201253.2(CRB1):c.3383delT ; c.3083T>A ; NM_201253.2(CRB1):c.613_619delATAGGAA ; NM_201253.2(CRB1):c.2290C>T ; NM_201253.2(CRB1):c.2401A>T ; NM_201253.2(CRB1):c.2983G>T ; NM_201253.2(CRB1):c.3122T>C ; NM_201253.2(CRB1):c.2688T>A ; NM_201253.2(CRB1):c.2843G>A ; c.2080G>T ; NM_201253.2(CRB1):c.3997G>T ; c.2719_2723dup ; NM_201253.2(CRB1):c.3299T>G



Cistinosis nefropática infantil

Un subtipo de cistinosis caracterizado por una acumulación de cistina en los órganos y tejidos, especialmente en los riñones y los ojos, y que se manifiesta clínicamente desde la infancia con el síndrome de Fanconi renal, fotofobia, hipotiroidismo, alteraciones del crecimiento y raquitismo, además de otros efectos sistémicos diversos. Las manifestaciones extrarrenales progresivas incluyen hipotiroidismo, hipogonadismo e infertilidad masculina, diabetes insulinodependiente, hepatoesplenomegalia con hipertensión portal, afectación muscular con debilidad y atrofia muscular distal, disfunción faríngea y oral, dificultades para tragar, afectación cerebral con hipotonía, dificultades para hablar y caminar, y síndrome cerebeloso.


La cistinosis se ha clasificado como un trastorno de almacenamiento lisosómico sobre la base de pruebas citológicas y de otro tipo que apuntan a la localización intralisosómica de la cistina almacenada. La cistinosis se diferencia de las demás enfermedades lisosomales en que la hidrólisis ácida, la principal función enzimática de los lisosomas, no desempeña un papel en la disposición metabólica de la cistina. El hecho de que los niveles plasmáticos estén muy por debajo de la saturación indica que el defecto es celular. Dentro de la célula, la cistina está compartimentada con la fosfatasa ácida y está unida a la membrana, tal y como demuestra la microscopía electrónica. La ferritina se acumula en el mismo orgánulo que parece ser el lisosoma.

Cistinosis nefropática juvenil

Un subtipo de cistinosis caracterizado por una acumulación de cistina en diferentes órganos y tejidos, especialmente en los riñones y los ojos, y que se manifiesta clínicamente entre la infancia y la adolescencia con una tubulopatía proximal lentamente progresiva y/o proteinuria, y fotofobia. Las manifestaciones extrarrenales (por ejemplo, hipotiroidismo, diabetes insulinodependiente, hepatoesplenomegalia, afectación muscular y cerebral) son menos graves que en la forma infantil de la enfermedad.


La cistinosis nefropática del adolescente se manifiesta primero a la edad de 10 a 12 años con proteinuria debida al daño glomerular más que con las manifestaciones de daño tubular que se producen primero en la cistinosis infantil. No hay exceso de aminoácidos y la estatura es normal. La fotofobia, el desarrollo tardío de retinopatía pigmentaria y las cefaleas crónicas son características. Los glóbulos blancos muestran un alto contenido de cistina en los heterocigotos de esta forma de cistinosis, al igual que en la cistinosis infantil. Clínicamente, el trastorno muestra una insuficiencia glomerular lentamente progresiva en lugar del prominente síndrome de Fanconi, alteraciones de los electrolitos y del agua, detención del crecimiento y raquitismo típicos de la cistinosis infantil. El paciente era el único afectado de la familia y los padres no estaban emparentados (como cabría esperar si la cistinosis juvenil es el compuesto genético de la cistinosis infantil y la cistinosis adulta).

Cistinosis ocular

La cistinosis ocular es la forma adulta benigna de la cistinosis (véase este término), una enfermedad metabólica caracterizada por la acumulación de cristales de cistina en la córnea y la conjuntiva, responsable del lagrimeo y la fotofobia, y asociada a ninguna otra manifestación adicional.


La cistinosis ocular no nefropática, una variante del tipo clásico de cistinosis nefropática (219800), es un trastorno de almacenamiento lisosómico autosómico recesivo que se caracteriza por la fotofobia debida a los cristales de cistina en la córnea pero la ausencia de enfermedad renal.


NM_001031681.2(CTNS):c.283G>T ; NM_001031681.2(CTNS):c.506G>A ; NM_004937.2(CTNS):c.416C>T ; NM_004937.2(CTNS):c.646dupA ; c.357_360del ; NM_004937.2(CTNS):c.589G>A ; NM_004937.2(CTNS):c.414G>A ; c.397_398del ; NM_004937.3:c.1015G>A ; NM_004937.2(CTNS):c.853-3C>G ; NM_001031681.2(CTNS):c.329G>T ; NM_001031681.2(CTNS):c.283G>T ; NM_001031681.2(CTNS):c.506G>A ; NM_004937.2(CTNS):c.416C>T ; NM_004937.2(CTNS):c.646dupA ; c.357_360del ; NM_004937.2(CTNS):c.589G>A ; NM_004937.2(CTNS):c.414G>A ; c.397_398del ; NM_004937.3:c.1015G>A ; NM_004937.2(CTNS):c.853-3C>G ; NM_001031681.2(CTNS):c.329G>T



Enfermedad CLN10

Las lipofuscinosis ceroides neuronales (NCL) son un grupo de enfermedades cerebrales degenerativas progresivas y hereditarias que se caracterizan clínicamente por un deterioro de las capacidades mentales y de otro tipo, epilepsia y pérdida de visión por degeneración de la retina, e histopatológicamente por la acumulación intracelular de un material autofluorescente, la lipofuscina ceroide, en las células neuronales del cerebro y de la retina.


La presentación clínica varía mucho entre las distintas formas, pero el sello clínico es una combinación de demencia, pérdida visual y epilepsia. Las manifestaciones pueden comenzar entre el periodo neonatal y la edad adulta joven, dependiendo de la forma, lo que llevó a la clasificación original de las NCL por edad de inicio en subgrupos de NCL congénita, infantil, infantil tardía, juvenil y adulta (ver estos términos). También se ha descrito una variante de la epilepsia del Norte (epilepsia progresiva-déficit intelectual, tipo finlandés; véase este término), en la que los problemas visuales pueden estar ausentes o ser leves y pasar desapercibidos.


NM_001909.4(CTSD):c.1149G>C ; NM_001909.4(CTSD):c.685T>A ; NM_001909.4(CTSD):c.1149G>C ; NM_001909.4(CTSD):c.685T>A




La picnodisostosis es una enfermedad lisosómica genética caracterizada por osteoesclerosis del esqueleto, baja estatura y huesos frágiles.


La enfermedad se descubre a edades variables, que van desde los 9 meses hasta los 50 años. La enfermedad se diagnostica con mayor frecuencia en la infancia, pero a veces no se detecta hasta la edad adulta, normalmente como resultado de una fractura o de un examen rutinario. Las manifestaciones clínicas o radiológicas más frecuentes de la enfermedad son la osteoesclerosis, la baja estatura o el enanismo, la acroosteolisis de las falanges distales, la fragilidad ósea asociada a fracturas espontáneas y la displasia de las clavículas. Los pacientes presentan malformaciones craneales características: un cráneo voluminoso con presencia de huesos wormianos y persistencia de la fontanela anterior, y una mandíbula pequeña. Pueden observarse anomalías dentales como dientes cariados, mal localizados o de forma anormal (puntiagudos o cónicos) y retraso en la erupción dental. Las uñas a veces son irregulares y están agrietadas. Muy raramente, la enfermedad se asocia a anemia, hepatoesplenomegalia, alteraciones hematológicas, dificultad respiratoria y apnea del sueño. La baja estatura es variable pero moderada (1,35m a 1,50m).


NM_000396.3(CTSK):c.926T>C ; NM_000396.3(CTSK):c.436G>C ; NM_000396.3(CTSK):c.236G>A ; NM_000396.3(CTSK):c.154A>T ; NM_000396.3(CTSK):c.721C>T ; NM_000396.3(CTSK):c.926T>C ; NM_000396.3(CTSK):c.436G>C ; NM_000396.3(CTSK):c.236G>A ; NM_000396.3(CTSK):c.154A>T ; NM_000396.3(CTSK):c.721C>T



Hiperplasia suprarrenal congénita clásica por deficiencia de 21-hidroxilasa, forma de pérdida de sal

La forma de pérdida de sal de la hiperplasia suprarrenal congénita clásica debida a la deficiencia de 21-hidroxilasa (CAH 21 OHD clásica; véase este término) se caracteriza por la virilización de los genitales externos en las mujeres, hipocortisolismo, pseudopubertad precoz y pérdida de sal renal debido a la deficiencia de aldosterona.


Las niñas se presentan al nacer con genitales ambiguos y niveles variables de virilización. Tienen un útero normal pero un desarrollo vaginal anormal. Los genitales externos de los niños son normales. La pseudopubertad precoz, que se manifiesta con diversos síntomas, como la aceleración de la velocidad de crecimiento y la maduración ósea, también está presente en ambos sexos. A diferencia de la forma de pérdida de sal de la HSC clásica de 21 OHD, la forma virilizante simple no presenta síntomas de deshidratación, pero tiene una deficiencia de glucocorticoides que requiere una terapia de sustitución de por vida y conlleva un riesgo de crisis suprarrenal de por vida.

Hiperplasia suprarrenal congénita clásica por deficiencia de 21-hidroxilasa, forma virilizante simple

La forma virilizante simple de la hiperplasia suprarrenal congénita clásica por déficit de 21-hidroxilasa (HSC clásica 21 OHD; véase este término) se caracteriza por ambigüedad genital y virilización de los genitales externos en las mujeres, hipocortisolismo y pseudopubertad precoz sin pérdida de sal.


El diagnóstico de la EP idiopática clásica es principalmente clínico, con manifestaciones que incluyen temblor en reposo, rigidez muscular, bradicinesia e inestabilidad postural. Otros rasgos adicionales son las anomalías posturales características, la disautonomía, los calambres distónicos y la demencia. La enfermedad es progresiva y suele tener un inicio insidioso a mediados o finales de la edad adulta. Las características patológicas de la EP clásica incluyen la pérdida de neuronas dopaminérgicas en la sustancia negra (SN) y la presencia de cuerpos de Lewy, inclusiones intracelulares, en las neuronas que sobreviven en varias zonas del cerebro, especialmente en la SN.

NO RARO EN EUROPA: Hiperplasia suprarrenal congénita no clásica por deficiencia de 21-hidroxilasa

En las recién nacidas, los genitales externos están masculinizados; las gónadas y los genitales internos son normales. En el período postnatal, tanto los varones como las mujeres no tratados pueden manifestar un crecimiento rápido, un agrandamiento del pene o del clítoris, una adrenarquia precoz y, en última instancia, un cierre epifisario temprano y una estatura baja. Una forma leve de hiperplasia suprarrenal de aparición tardía debida a la deficiencia de 21-hidroxilasa puede darse en adultos y tiene el hirsutismo como única manifestación en la forma más atenuada.


La hiperplasia suprarrenal congénita (HSC) es el resultado de una deficiencia en una u otra de las enzimas de la biosíntesis del cortisol. En aproximadamente el 95% de los casos, la 21-hidroxilación está alterada en la zona fasciculada de la corteza suprarrenal, de modo que la 17-hidroxiprogesterona (17-OHP) no se convierte en 11-deoxicortisol. Debido a la síntesis defectuosa de cortisol, los niveles de ACTH aumentan, lo que da lugar a una sobreproducción y acumulación de precursores de cortisol, en particular de 17-OHP, proximal al bloqueo. Esto provoca una producción excesiva de andrógenos, lo que da lugar a la virilización.


NM_000500.7(CYP21A2):c.719T>A (p.Met240Lys) ; NM_000500.7(CYP21A2):c.713T>A (p.Val238Glu) ; NM_000500.7(CYP21A2):c.710T>A (p.Ile237Asn) ; NM_000500.7(CYP21A2):c.518T>A (p.Ile173Asn) ; NM_000500.7(CYP21A2):c.1069C>T ; NM_000500.7(CYP21A2):c.293-13C>G ; NM_000500.7(CYP21A2):c.332_339delGAGACTAC (p.Gly111Valfs) ; NM_000500.9(CYP21A2):c.923dup (p.Leu308Phefs) ; NM_000500.7(CYP21A2):c.92C>T (p.Pro31Leu) ; NM_000500.7(CYP21A2):c.844G>T (p.Val282Leu) ; NM_000500.7(CYP21A2):c.1360C>T (p.Pro454Ser) ; NM_000500.7(CYP21A2):c.955C>T (p.Gln319Ter)



Enfermedad de la orina con olor a jarabe de arce clásica

La enfermedad de la orina en forma de jarabe de arce clásica (MSUD clásica) es la forma más grave y probablemente común de la MSUD (véase este término), caracterizada por un olor a jarabe de arce en el cerumen al nacer, mala alimentación, letargia y distonía focal, seguida de encefalopatía progresiva e insuficiencia respiratoria central si no se trata.


El inicio de la MSUD clásica se produce en el periodo neonatal (normalmente 12 horas después del nacimiento) con la presencia de un olor a jarabe de arce en el cerumen y posteriormente en la orina, mala alimentación y somnolencia. En los primeros días de vida se produce una encefalopatía progresiva con letargo, apnea intermitente, movimientos estereotipados (descritos como "esgrima" y bicicleta") y opistótono. Sin tratamiento, el coma y la insuficiencia respiratoria central se producen entre los días 7 y 10. Más tarde, el estrés catabólico, la infección o las lesiones pueden causar una intoxicación aguda, potencialmente mortal, por leucina con vómitos, alteración de la conciencia, ataxia y distonía aguda en los niños pequeños y alucinaciones, hiperactividad, distonía focal, ataxia y coreoatetosis en los niños y adultos.

Enfermedad de la orina con olor a jarabe de arce intermedia

La enfermedad de la orina con olor a jarabe de arce intermedia (MSUD intermedia) es una forma más leve de MSUD (véase este término) caracterizada por la elevación persistente de los aminoácidos de cadena ramificada (BCAA) y los cetoácidos, pero con menos o ningún episodio agudo de descompensación.


La aparición de los síntomas de la MSUD intermedia varía entre los primeros meses y los primeros años de la infancia. Los bebés pueden tener problemas de alimentación, crecimiento deficiente, olor a jarabe de arce en la orina y retraso en el desarrollo. Los niños mayores suelen presentar dificultades de aprendizaje. Al igual que la MSUD clásica (véase este término), el estrés catabólico puede provocar una descompensación aguda con anorexia, vómitos, ataxia (en bebés/niños pequeños), deterioro cognitivo, trastornos del sueño, alucinaciones, hiperactividad, cambios de humor, distonía aguda, coreoatetosis (en adultos), estupor, coma y edema cerebral, si no se trata.

Enfermedad de la orina con jarabe de arce intermitente

La enfermedad de la orina con olor a jarabe de arce intermitente (MSUD intermitente) es una forma leve de MSUD (véase este término) en la que los pacientes (cuando están bien) son asintomáticos con niveles normales de aminoácidos de cadena ramificada (BCAA), pero con estrés catabólico corren el riesgo de sufrir una descompensación aguda con cetoacidosis, que puede provocar edema cerebral y coma si no se trata.


A diferencia de la MSUD clásica (véase este término), los pacientes con MSUD intermitente muestran un crecimiento y un desarrollo intelectual normales durante la infancia y la niñez. Pueden desarrollar síntomas (principalmente en la infancia) con cualquier estrés catabólico (por ejemplo, ayuno, deshidratación, fiebre, infecciones o embarazo (en adultos)). Estos factores precipitantes pueden conducir a un episodio potencialmente mortal de descompensación aguda con anorexia, náuseas, vómitos, letargo, ataxia (en los bebés/niños pequeños), deterioro cognitivo, trastornos del sueño, alucinaciones, hiperactividad, cambios de humor, distonía aguda y coreoatetosis (en los adultos), que puede progresar hasta el estupor, el coma y el edema cerebral. La inteligencia y el desarrollo no suelen verse afectados por estos episodios.

Enfermedad de la orina con jarabe de arce que responde a la tiamina

La enfermedad de la orina en forma de jarabe de arce que responde a la tiamina (MSUD) es una variante menos grave de la MSUD (véase este término) que se manifiesta con un fenotipo similar al de la MSUD intermedia (véase este término) pero que responde positivamente al tratamiento con tiamina.


La MSUD que responde a la tiamina está mal caracterizada. Parece que suele presentarse después de la infancia con un fenotipo muy similar al observado en la MSUD intermedia (véase este término). Las manifestaciones incluyen problemas de alimentación, crecimiento deficiente, olor a jarabe de arce en la orina y retraso en el desarrollo. Los niños mayores suelen presentar dificultades de aprendizaje. Al igual que la MSUD clásica (véase este término), el estrés fisiológico puede provocar una descompensación aguda con anorexia, náuseas, vómitos (en todas las edades), ataxia (en bebés/niños pequeños), deterioro cognitivo, trastornos del sueño, alucinaciones, hiperactividad, cambios de humor, distonía aguda/focal y coreoatetosis (en adultos) que pueden progresar hasta el estupor, el coma y el edema cerebral, si no se tratan. La tiamina (en dosis de 10-1000 mg al día) ha mejorado la tolerancia a la leucina en los pocos casos notificados de este subtipo de MSUD, pero sigue siendo necesaria una cierta restricción de aminoácidos de cadena ramificada (BCAA) en la dieta.


c.1281+1G>A ; NM_001918.3(DBT):c.294C>G ; c.772+1G>A ; NM_001918.3(DBT):c.126T>G ; NM_001918.3(DBT):c.272_275delCAGT ; NM_001918.3(DBT):c.670G>T ; NM_001918.3(DBT):c.901C>T ; NM_001918.3(DBT):c.871C>T ; NM_001918.4:c.581C>G ; NM_001918.3(DBT):c.939G>C ; c.1281+1G>A ; NM_001918.3(DBT):c.294C>G ; c.772+1G>A ; NM_001918.3(DBT):c.126T>G ; NM_001918.3(DBT):c.272_275delCAGT ; NM_001918.3(DBT):c.670G>T ; NM_001918.3(DBT):c.901C>T ; NM_001918.3(DBT):c.871C>T ; NM_001918.4:c.581C>G ; NM_001918.3(DBT):c.939G>C



Síndrome de Omenn

El síndrome de Omenn (OS) es una enfermedad inflamatoria caracterizada por eritrodermia, descamación, alopecia, diarrea crónica, retraso en el desarrollo, linfadenopatía y hepatoesplenomegalia, asociada a una inmunodeficiencia combinada grave (SCID; véase este término).


El OS se presenta durante el primer año de vida con características de SCID, incluyendo diarrea crónica, neumonitis y retraso en el crecimiento. Además, los pacientes presentan síntomas inflamatorios que incluyen linfadenopatía, hepatoesplenomegalia y eritrodermia generalizada, que a menudo puede causar alopecia y pérdida de cejas y pestañas; la pérdida de proteínas puede provocar edema generalizado y alteraciones metabólicas. Los signos y síntomas del OS pueden evolucionar con el tiempo y pueden no aparecer simultáneamente. Algunos pacientes presentan algunos de estos síntomas, pero no todos, y pueden describirse como síndrome de Omenn atípico. El OS también puede estar asociado a trastornos sindrómicos, como la hipoplasia cartilaginosa (CHH), la deficiencia de adenosina deaminasa (ADA), la monosomía 22q11, el coloboma ocular, el síndrome CHARGE y la deficiencia de ligasa 4 (consulte estos términos).

Inmunodeficiencia combinada severa por deficiencia de DCLRE1C

La inmunodeficiencia combinada grave (IDCG) debida a la deficiencia de DCLRE1C es un tipo de IDCG (véase este término) que se caracteriza por infecciones graves y recurrentes, diarrea, retraso en el desarrollo y sensibilidad celular a la radiación ionizante.


Los pacientes presentan las características clásicas de la IDCG, como retraso en el desarrollo, infecciones graves (neumonía, infecciones gastrointestinales, sepsis), aftas recurrentes o persistentes y diarrea crónica. La enfermedad de injerto contra huésped asociada a la transfusión materno-fetal también se asocia a la enfermedad. Los hallazgos inmunológicos incluyen la ausencia de linfocitos T y B con un recuento normal de células asesinas naturales (NK).


c.1294G>T ; NM_022487.3(DCLRE1C):c.435del ; c.1214dup ; NM_001033855.2(DCLRE1C):c.597C>A ; NM_001033855.2(DCLRE1C):c.2T>C ; c.1294G>T ; NM_022487.3(DCLRE1C):c.435del ; c.1214dup ; NM_001033855.2(DCLRE1C):c.597C>A ; NM_001033855.2(DCLRE1C):c.2T>C



Xeroderma pigmentoso

Un raro trastorno de la biogénesis del peroxisoma (la variante más grave del espectro de trastornos de la biogénesis del peroxisoma) caracterizado por defectos de migración neuronal en el cerebro, rasgos craneofaciales dismórficos, hipotonía profunda, convulsiones neonatales y disfunción hepática.


La gravedad de las manifestaciones clínicas y la edad de aparición son extremadamente variables y dependen en parte de la exposición a la luz solar y del grupo de complementación. Aproximadamente el 50% de los individuos afectados tienen una sensibilidad solar aguda desde los primeros meses de vida, presentando quemaduras solares graves y/o eritema persistente que tarda semanas en resolverse. Otros no muestran ninguna reacción de quemadura solar y desarrollan gradualmente pecas marcadas en los lugares expuestos al sol. Los individuos tienen la piel seca y lesiones hipo o hiperpigmentadas. El riesgo de padecer cánceres de piel no melanoma es más de 10.000 veces mayor, y el de melanoma por debajo de los 20 años es 2.000 veces mayor en comparación con la población general. Los pacientes con XP clásico desarrollan cáncer de piel generalmente antes de los 20 años, mientras que los pacientes con la variante XP empiezan a desarrollar cáncer de piel a los 20-30 años aproximadamente. Las anomalías oculares incluyen queratitis que dan lugar a opacificación y vascularización de la córnea. La fotofobia es frecuente. El carcinoma de células escamosas ocular y el melanoma son comunes. Se han notificado anomalías neurológicas de diversa gravedad en aproximadamente el 30% de los casos. Estas incluyen microcefalia adquirida, disminución o ausencia de reflejos tendinosos profundos, pérdida de audición neurosensorial progresiva, espasticidad, ataxia, convulsiones y deterioro cognitivo progresivo. El síndrome de Sanctis-Cacchione es un término que originalmente se atribuía a los casos de XP con graves anomalías neurológicas, pero ya no es de uso general.


NM_000107.2(DDB2):c.730A>G ; NM_000107.2(DDB2):c.919G>T ; NM_000107.2(DDB2):c.937C>T ; NM_000107.2(DDB2):c.818G>A ; NM_000107.2(DDB2):c.730A>G ; NM_000107.2(DDB2):c.919G>T ; NM_000107.2(DDB2):c.937C>T ; NM_000107.2(DDB2):c.818G>A



Síndrome de Smith-Lemli-Opitz

El síndrome de Smith-Lemli-Opitz (SLOS) se caracteriza por múltiples anomalías congénitas, déficit intelectual y problemas de comportamiento.


La enfermedad está presente al nacer, pero puede detectarse en la infancia o en la edad adulta en las formas leves. Los pacientes presentan un retraso en el crecimiento y un déficit intelectual. Los problemas de comportamiento incluyen múltiples rasgos autistas, hiperactividad, comportamiento autolesivo y trastornos del sueño. Las anomalías estructurales del cerebro pueden incluir hipoplasia o ausencia del cuerpo calloso y holoprosencefalia. La microcefalia (80% de los casos), el estrechamiento bitemporal, la ptosis, el puente nasal ancho, la raíz nasal corta, las narices antevertidas (90% de los casos), el mentón pequeño y la micrognatia son rasgos craneofaciales comunes. Ocasionalmente, se observan cataratas, estrabismo y nistagmo. Otros rasgos clínicos son el paladar hendido o la úvula bífida (1/3 de los pacientes), fotosensibilidad, rizomelia y polidactilia postaxial de las manos o los pies, sindactilia del segundo y tercer dedo del pie (95% de los casos) y pulgares cortos y situados en posición proximal. Las anomalías genitales (pene pequeño, hipospadias, genitales ambiguos) son frecuentes en los varones (70% de los casos). Pueden presentarse anomalías cardiovasculares (defectos septales auriculares y ventriculares, conducto arterioso persistente, canal atrioventricular). Son frecuentes las anomalías gastrointestinales, como la mala alimentación, el reflujo gastroesofágico, la estenosis pilórica, la malrotación y la aganglionosis colónica.


NM_001360.2(DHCR7):c.1337G>A ; NM_001360.2(DHCR7):c.744G>T ; NM_001360.2(DHCR7):c.832-1G>C ; c.904T>C ; NM_001360.2(DHCR7):c.1342G>A ; NM_001360.2(DHCR7):c.730G>A ; NM_001360.2(DHCR7):c.453G>A ; NM_001360.2(DHCR7):c.725G>A ; NM_001360.2:c.964-1G>C ; NM_001360.2(DHCR7):c.1228G>A ; NM_001360.2(DHCR7):c.452G>A ; NM_001360.2(DHCR7):c.866C>T ; NM_001360.2(DHCR7):c.356A>T ; NM_001360.2(DHCR7):c.1055G>A ; NM_001360.2(DHCR7):c.724C>T ; NM_001360.2(DHCR7):c.976G>T ; NM_001360.2(DHCR7):c.292C>T ; NM_001360.2(DHCR7):c.1A>G ; NM_001360.2(DHCR7):c.1210C>T ; NM_001360.2(DHCR7):c.1054C>T ; NM_001360.2(DHCR7):c.151C>T ; NM_001360.2(DHCR7):c.278C>T ; NM_001360.2(DHCR7):c.839A>G ; NM_001360.2(DHCR7):c.1337G>A ; NM_001360.2(DHCR7):c.744G>T ; NM_001360.2(DHCR7):c.832-1G>C ; c.904T>C ; NM_001360.2(DHCR7):c.1342G>A ; NM_001360.2(DHCR7):c.730G>A ; NM_001360.2(DHCR7):c.453G>A ; NM_001360.2(DHCR7):c.725G>A ; NM_001360.2:c.964-1G>C ; NM_001360.2(DHCR7):c.1228G>A ; NM_001360.2(DHCR7):c.452G>A ; NM_001360.2(DHCR7):c.866C>T ; NM_001360.2(DHCR7):c.356A>T ; NM_001360.2(DHCR7):c.1055G>A ; NM_001360.2(DHCR7):c.724C>T ; NM_001360.2(DHCR7):c.976G>T ; NM_001360.2(DHCR7):c.292C>T ; NM_001360.2(DHCR7):c.1A>G ; NM_001360.2(DHCR7):c.1210C>T ; NM_001360.2(DHCR7):c.1054C>T ; NM_001360.2(DHCR7):c.151C>T ; NM_001360.2(DHCR7):c.278C>T ; NM_001360.2(DHCR7):c.839A>G



Encefalopatía epiléptica inespecífica de inicio temprano

Síndrome de epilepsia infantil poco frecuente que se caracteriza por la aparición temprana de convulsiones de tipo y gravedad variables, potencialmente asociadas a un espectro de signos y síntomas clínicos que incluyen retraso o falta de desarrollo psicomotor, discapacidad intelectual, desarrollo del habla deficiente o ausente, anomalías del comportamiento, hipotonía, trastornos del movimiento, espasticidad, microcefalia y rasgos faciales dismórficos, entre otros. Los resultados de las imágenes cerebrales también son variables y pueden incluir atrofia cerebral o anomalías de la sustancia blanca.



Retinitis pigmentaria

La retinosis pigmentaria (RP) es una distrofia hereditaria de la retina que conduce a la pérdida progresiva de los fotorreceptores y del epitelio pigmentario de la retina y que provoca la ceguera generalmente después de varias décadas.


La retinosis pigmentaria es lentamente progresiva pero implacable. Sin embargo, existe una amplia variabilidad en la edad de inicio, la tasa de progresión y las manifestaciones clínicas secundarias. Los individuos afectados suelen desarrollar primero ceguera nocturna (nictalopía) debido a la pérdida de la función de los bastones, a menudo en la adolescencia o antes. A continuación, desarrollan un deterioro del campo visual periférico y, con el tiempo, la pérdida de la visión central, normalmente en etapas tardías, a menudo en torno a la mediana edad. La pérdida de agudeza visual central puede producirse a cualquier edad como resultado de un edema macular cistoide o de la pérdida de fotorreceptores. Las cataratas subcapsulares posteriores son frecuentes y su gravedad depende de la edad. También puede encontrarse una reducción de la visión de los colores. El examen del fondo de ojo revela depósitos de pigmento de espícula ósea, vasos retinianos atenuados, atrofia de la retina y palidez del nervio óptico. La gravedad está parcialmente correlacionada con el patrón de herencia: los casos ligados al cromosoma X son los más graves, los casos autosómicos recesivos y de ocurrencia única tienen una gravedad intermedia, y los autosómicos dominantes son los más favorables.


c.995C>G ; NM_024887.3:c.124A>G ; c.330del ; c.995C>G ; NM_024887.3:c.124A>G ; c.330del



Disqueratosis congénita

Un raro síndrome de displasia ectodérmica que suele presentarse con la tríada clásica de displasia ungueal, cambios pigmentarios en la piel y leucoplasia oral, asociado a un alto riesgo de insuficiencia de la médula ósea (FMO) y cáncer.


La DC tiene un amplio espectro fenotípico y una amplia edad de aparición. Clásicamente se manifiesta durante la infancia con la tríada de uñas displásicas, pigmentación reticular de encaje y atrofia de la piel a nivel del cuello y la parte superior del tórax, y leucoplasia oral. Los pacientes tienen un alto riesgo de padecer una FMO progresiva y pueden desarrollar un síndrome mielodisplásico o una leucemia mielógena aguda a cualquier edad (el riesgo aumenta con la edad). También existe un mayor riesgo de padecer tumores sólidos, normalmente carcinoma de células escamosas de cabeza y cuello o cáncer anogenital. Se han notificado otros hallazgos clínicos que pueden incluir: retraso en el desarrollo, baja estatura, microcefalia, blefaritis, epífora, enfermedad periodontal, taurodontismo, disminución de la relación dientes/raíz, estenosis esofágica, estenosis uretral, osteoporosis, necrosis avascular de fémur y/o húmero, encanecimiento prematuro del cabello/alopecia o pestañas anormales. Los pacientes con DC también pueden desarrollar fibrosis pulmonar, malformaciones arteriovenosas pulmonares, telangiectasias gastrointestinales y enfermedad hepática. Es importante tener en cuenta que las características clínicas de la CD progresan con el tiempo y que todas las características, incluida la tríada mucocutánea, pueden no estar presentes.

Síndrome de Hoyeraal-Hreidarsson

Una discapacidad intelectual sindrómica ligada al cromosoma X, considerada una variante grave de la disqueratosis congénita, caracterizada por retraso del crecimiento intrauterino, microcefalia, hipoplasia cerebelosa, inmunodeficiencia combinada progresiva y anemia aplásica.


La enfermedad suele presentarse en la primera infancia y afecta principalmente a los varones. El retraso del crecimiento suele ser de inicio prenatal. Otras manifestaciones clínicas incluyen microcefalia, lesiones mucocutáneas (hiperpigmentación, distrofia ungueal, leucoplasia premaligna que afecta a la mucosa oral y gastrointestinal), insuficiencia de la médula ósea de aparición temprana, inmunodeficiencia y pancitopenia. También se ha descrito una predisposición al cáncer.


NM_001363.4(DKC1):c.91C>A ; NM_001363.4(DKC1):c.204C>A ; NM_001363.4(DKC1):c.91C>G ; NM_001363.4(DKC1):c.196A>G ; NM_001363.4(DKC1):c.200C>T ; NM_001363.4(DKC1):c.194G>C ; NM_001363.4(DKC1):c.214_215delCTinsTA ; NM_001363.4(DKC1):c.91C>A ; NM_001363.4(DKC1):c.204C>A ; NM_001363.4(DKC1):c.91C>G ; NM_001363.4(DKC1):c.196A>G ; NM_001363.4(DKC1):c.200C>T ; NM_001363.4(DKC1):c.194G>C ; NM_001363.4(DKC1):c.214_215delCTinsTA



Deficiencia de piruvato deshidrogenasa E3

La deficiencia de piruvato deshidrogenasa E3 es un subtipo muy raro de la deficiencia de piruvato deshidrogenasa (PDHD, véase este término) que se caracteriza por una acidosis láctica de aparición temprana y un retraso en el desarrollo, una disfunción neurológica de aparición tardía o una enfermedad hepática.


La mayoría de los pacientes se han presentado con acidosis láctica neonatal o con acidosis láctica, retraso en el desarrollo e hipotonía durante la infancia. Unos pocos pacientes se han presentado más tarde en la infancia con ataxia y distonía con un desarrollo cognitivo normal. Un grupo separado de pacientes, esencialmente todos de origen judío asquenazí y muchos homocigotos para una mutación de sentido erróneo G229C común, presentan vómitos episódicos, dolor abdominal, encefalopatía y disfunción hepática. En algunos pacientes, hay evidencia de deficiencia de alfa-cetoácidos deshidrogenados de cadena ramificada, con concentraciones elevadas de los aminoácidos de cadena ramificada y sus metabolitos. Sin embargo, las manifestaciones clínicas en la mayoría de los casos parecen estar relacionadas con la deficiencia de piruvato deshidrogenasa.


NM_000108.4(DLD):c.1483A>G ; c.916_926del ; NM_000108.3:c.105_106insA ; NM_000108.4(DLD):c.1483A>G ; c.916_926del ; NM_000108.3:c.105_106insA



Distrofia muscular de Becker

Distrofia muscular rara y genética que se caracteriza por una debilidad y atrofia muscular progresiva debida a la degeneración del músculo esquelético, liso y cardíaco.


El inicio suele ser en la infancia, normalmente después de los 7 años de edad, pero puede ser posterior. Las características de presentación en los niños incluyen la marcha con los dedos del pie y/o calambres relacionados con el ejercicio, con o sin mioglobinuria. Algunos pacientes pueden presentar una rabdomiólisis aguda inducida por anestesia. En los pacientes de más edad, la cardiomiopatía puede ser la característica de presentación. A medida que la enfermedad progresa, la debilidad muscular provoca dificultades funcionales (dificultad para subir escaleras o levantarse de una silla). En raras ocasiones, la cardiomiopatía puede ser la característica de presentación. El examen clínico revela una pseudohipertrofia muscular de los músculos de la pantorrilla y puede haber atrofia de músculos más proximales, como el cuádriceps. La debilidad muscular es simétrica y proximal, y las extremidades inferiores están más afectadas que las superiores. Puede haber contracturas articulares, especialmente del tendón de Aquiles. Los músculos faciales, oftálmicos y bulbares no están afectados. La enfermedad es lentamente progresiva y alrededor del 40% de los pacientes afectados acabarán dependiendo de una silla de ruedas. En los pacientes dependientes de la silla de ruedas, se produce una insuficiencia respiratoria restrictiva debido a la debilidad de los músculos intercostales y del diafragma. La afectación cardíaca da lugar a una miocardiopatía dilatada, que puede ser desproporcionada con respecto a la afectación del músculo esquelético.

Distrofia muscular de Duchenne

Distrofia muscular rara y genética que se caracteriza por una debilidad y atrofia muscular rápidamente progresiva debida a la degeneración del músculo esquelético, liso y cardíaco.


El inicio se produce en la primera infancia, y los niños afectados pueden mostrar un retraso en la marcha (después de los 18 meses de edad) acompañado de un retraso en el habla y/o en el desarrollo global. El autismo y los problemas de comportamiento, como el TDAH (trastorno por déficit de atención e hiperactividad), la ansiedad y el trastorno obsesivo compulsivo, son relativamente frecuentes. Los niños con DMD no tratados rara vez alcanzan la capacidad de correr o saltar. La enfermedad progresa rápidamente y el niño desarrolla una marcha de pato y un signo de Gowers positivo. Subir escaleras se vuelve difícil y el niño se cae frecuentemente. La pérdida de la deambulación independiente se produce entre los 6 y los 13 años, siendo la media de 9,5 años en los pacientes no tratados con esteroides. Una vez perdida la deambulación, se desarrollan rápidamente contracturas articulares y escoliosis. Los pacientes no tratados mueren entre el final de la adolescencia y el principio de la veintena por insuficiencia respiratoria y/o cardiomiopatía.

Miocardiopatía dilatada familiar aislada

Una rara miocardiopatía familiar caracterizada por la dilatación del ventrículo izquierdo y el deterioro progresivo de la función ventricular sistólica, en ausencia de condiciones de carga anormales o de una enfermedad arterial coronaria suficiente para causar un deterioro sistólico global. La enfermedad puede causar insuficiencia cardíaca o arritmia. La enfermedad es aislada cuando no hay manifestaciones cardíacas o extracardíacas adicionales atípicas


.La enfermedad se define por la presencia de dos criterios clínicos principales: un acortamiento fraccional del ventrículo izquierdo (VI) inferior al 25% y/o una fracción de eyección del VI inferior al 45% con un diámetro diastólico final del VI superior al 117% del valor previsto (corregido por la edad y la superficie corporal según la fórmula de Henry), en ausencia de condiciones de carga anormales o de una enfermedad arterial coronaria suficiente para causar un deterioro sistólico global. La enfermedad puede desarrollarse a cualquier edad, en ambos sexos. La masa del VI suele estar muy aumentada en este trastorno, pero el grosor de la pared del VI es normal. Puede haber síntomas de insuficiencia cardíaca y arritmias. Otras presentaciones incluyen la detección incidental de cardiomegalia asintomática y síntomas relacionados con trastornos de la conducción coexistentes o complicaciones tromboembólicas. Normalmente, hay antecedentes de MCD en la familia.

Forma sintomática de distrofia muscular de Duchenne y Becker en mujeres portadoras

Distrofia muscular genética rara que afecta a las mujeres portadoras y se caracteriza por grados variables de debilidad muscular debido a una miopatía esquelética progresiva, a veces asociada a una cardiomiopatía dilatada o a una dilatación del ventrículo izquierdo.


Las mujeres portadoras sintomáticas suelen presentarse más tarde que los varones con DMD o DMO. La debilidad muscular es generalmente menos grave que en los varones afectados y suele ser proximal y, a diferencia de los varones, tiene una distribución asimétrica. Los miembros superiores pueden ser más débiles que los inferiores. También se han notificado mialgias y calambres. El nivel de creatina quinasa en suero está elevado. Algunos pacientes pueden presentar únicamente manifestaciones cardíacas.

Discapacidad intelectual no sindrómica ligada al X

El síndrome de duplicación de MECP2 es un trastorno del neurodesarrollo ligado al cromosoma X que se caracteriza por un retraso mental de severo a profundo, hipotonía infantil, rasgos dismórficos leves, escaso desarrollo del habla, rasgos autistas, convulsiones, espasticidad progresiva e infecciones recurrentes. Sólo afecta a los varones, aunque las mujeres portadoras pueden presentar algunos rasgos neuropsiquiátricos leves, como ansiedad. Las duplicaciones submicroscópicas de Xq28 que engloban a MECP2 se consideran eventos no recurrentes, porque las ubicaciones de los puntos de rotura y los tamaños de los reordenamientos varían entre los individuos afectados.




c.3087G>A ; g.26102-57302794 ; NM_004006.2(DMD):c.8608C>T ; NM_004006.2(DMD):c.2804-1G>A ; NM_004006.2(DMD):c.8069T>G ; g.31645986-31773985 ; c.1664G>A ; NM_004006.2(DMD):c.4471_4472delAA ; NM_004006.2(DMD):c.5899C>T ; c.3076G>T ; NM_004006.2(DMD):c.9337C>T ; NM_004006.2(DMD):c.3432+3A>G ; NM_004006.2(DMD):c.4806A>T ; NM_004006.2(DMD):c.9361+1G>A ; c.171G>A ; NM_004006.2(DMD):c.2816T>A ; NM_004006.2(DMD):c.627delA ; NM_004006.2(DMD):c.10033C>T ; c.2380+2T>C ; NM_004006.2(DMD):c.2804-2A>T ; c.6936del ; NM_004006.2(DMD):c.2547delT ; c.2758C>T ; NM_004006.2(DMD):c.6000T>A ; c.220del ; g.32557406-32754551 ; c.1900_1903dup ; c.1734del ; NM_004006.2(DMD):c.1286C>A ; NM_004006.2(DMD):c.676_678delAAG ; NM_004006.2(DMD):c.3295C>T ; NM_004006.2(DMD):c.2125delC ; g.31540244-32059446 ; NM_004006.2(DMD):c.6986dupA ; NM_004006.2(DMD):c.8443C>T ; c.2803+1G>A ; c.2587del ; g.32341945-32596022 ; NM_004006.2(DMD):c.3432+1G>A ; c.2266_2267del ; c.2866C>T ; NM_004006.2(DMD):c.6238delC ; NM_004006.2(DMD):c.9650-2A>G ; g.31724913-31806626 ; NM_004006.2(DMD):c.9862G>T ; g.10679-36186635 ; NM_004006.2(DMD):c.8064_8065delTA ; NM_004006.2(DMD):c.1341_1342dupAG ; g.32203741-32353533 ; g.31744885-32562211 ; NM_004006.2(DMD):c.1012G>T ; c.3124A>T ; NM_004006.2(DMD):c.8652_8653delCT ; NM_004006.2(DMD):c.433C>T ; c.277C>T ; NM_004006.2:c.2169-3_2169-1delinsAA ; c.7764dup ; NM_004006.2(DMD):c.3276+1G>A ; g.32501716-32932295 ; g.31856886-32482971 ; NM_004006.2(DMD):c.10141C>T ; NM_004006.2(DMD):c.6906G>A ; NM_004006.2(DMD):c.1261C>T ; NM_004006.2(DMD):c.10086+1G>A ; NM_004006.2(DMD):c.10446_10447delCT ; NM_004006.2(DMD):c.2484T>G ; NM_004006.2(DMD):c.4375C>T ; g.251879-35885004 ; g.31745624-31876916 ; g.31121669-33339588 ; g.30093911-34060667 ; c.489G>A ; g.31180370-31206667 ; g.10679-52213731 ; c.4486del ; NM_004006.2(DMD):c.9164-1G>C ; NM_004006.2(DMD):c.9854_9863delTGAGACTGGA ; g.31632068-31954142 ; NM_004006.2(DMD):c.1371delG ; NM_004006.2(DMD):c.2281_2285delGAAAA ; c.5570_5571dup ; c.2929dup ; c.6964del ; NM_004006.2(DMD):c.6391_6392delCA ; c.1900A>T ; NM_004006.2(DMD):c.615T>A ; g.32631403-32907656 ; c.530+1del ; NM_004006.2(DMD):c.1048G>T ; NM_004006.2(DMD):c.2755A>T ; c.2479del ; NM_004006.2(DMD):c.3747delG ; NM_004006.2(DMD):c.2815_2816delTT ; c.4409_4412dup ; c.6943G>T ; c.977-1G>T ; NM_004006.2(DMD):c.6182delC ; NM_004006.2(DMD):c.4518+5G>A ; g.10701-49071220 ; g.251880-51643625 ; NM_004006.2(DMD):c.1529_1530delTC ; NM_004006.2(DMD):c.6373C>T ; g.32380341-32412502 ; NM_004006.2(DMD):c.2803+1G>T ; c.6340A>T ; NM_004006.2(DMD):c.5773G>T ; c.3697del ; g.32341945-32816915 ; c.6763-2A>G ; c.4735G>T ; c.5671A>T ; c.5807T>A ; g.31744863-31846787 ; g.31627435-31774446 ; g.31679229-31968838 ; NM_004006.2(DMD):c.1306dupG ; g.32697662-32699472 ; NM_004006.2(DMD):c.7682G>A ; c.4500del ; NM_004006.2(DMD):c.6392_6393insCA ; c.1159C>T ; NM_004006.2(DMD):c.137_138dupAT ; g.31444405-31806767 ; g.32452761-32645074 ; NM_004006.2(DMD):c.5530C>T ; NM_004006.2(DMD):c.6982A>T ; c.3022A>T ; c.2523del ; NM_004006.2(DMD):c.9568C>T ; g.31819658-31932544 ; NM_004006.2(DMD):c.583C>T ; c.8086del ; NM_004006.2(DMD):c.5363C>G ; g.31898812-32022323 ; NM_004006.2(DMD):c.4405C>T ; NM_004006.2(DMD):c.2332C>T ; NM_004006.2(DMD):c.4117C>T ; g.31679229-31932544 ; g.32662366-32758964 ; NM_004006.2(DMD):c.8656C>T ; NM_004006.2(DMD):c.2302C>T ; NM_004006.2(DMD):c.2380+1G>C ; c.6014_6017del ; c.204dup ; NM_004006.2(DMD):c.5353C>T ; NM_004006.2(DMD):c.6292C>T ; c.2137C>T ; NM_004006.2(DMD):c.2294_2297delCCAT ; c.5313dup ; c.199G>T ; g.32432957-32823439 ; g.32267823-32372572 ; NM_004006.2(DMD):c.3639dupA ; g.31147275-31173604 ; c.1193C>G ; c.6226G>T ; c.6834del ; g.13020141-143473520 ; NM_004006.2(DMD):c.10454delT ; g.31870708-32353592 ; NM_004006.2(DMD):c.8944C>T ; g.10701-53131191 ; NM_004006.2(DMD):c.7894C>T ; NM_004006.2(DMD):c.412_413delAA ; NM_004006.2(DMD):c.4843A>T ; NM_004006.2(DMD):c.1332-9A>G ; NM_004006.2(DMD):c.2650C>T ; NM_004006.2(DMD):c.8713C>T ; g.31874956-31932544 ; NM_004006.2(DMD):c.8374_8375delAA ; NM_004006.2(DMD):c.5554C>T ; NM_004006.2(DMD):c.7683G>A ; g.31518752-31636035 ; g.31609490-32699472 ; NM_004006.2(DMD):c.1070delC ; NM_004006.2(DMD):c.9361+1G>C ; g.31929292-31968838 ; g.32364355-32390415 ; NM_004006.2(DMD):c.133C>T ; g.32216645-32651039 ; NM_004006.2:c.3246_3247insTTTCTAAAAA ; NM_004006.2(DMD):c.1489C>T ; g.32275729-32353585 ; g.31695292-31840818 ; NM_004006.2(DMD):c.9564-1G>A ; NM_004006.2(DMD):c.3779_3785delCTTTGGAinsGG ; g.31773859-31932544 ; g.31627435-31932544 ; g.31836597-31932544 ; NM_004006.2(DMD):c.3121C>T ; NM_004006.2(DMD):c.5697delA ; NM_004006.2(DMD):c.7771G>T ; NM_004006.2(DMD):c.7922delA ; g.31640772-31665565 ; g.31431098-31525874 ; g.32411633-33020588 ; g.31121669-31134568 ; NM_004006.2(DMD):c.1886C>A ; g.31931923-31932544 ; g.31965009-31968838 ; g.33019769-33020588 ; NM_004006.2(DMD):c.5287C>T ; g.31189847-31945183 ; NM_004006.2(DMD):c.5640T>A ; g.31133877-31134568 ; g.32380341-32380904 ; c.3087G>A ; g.26102-57302794 ; NM_004006.2(DMD):c.8608C>T ; NM_004006.2(DMD):c.2804-1G>A ; NM_004006.2(DMD):c.8069T>G ; g.31645986-31773985 ; c.1664G>A ; NM_004006.2(DMD):c.4471_4472delAA ; NM_004006.2(DMD):c.5899C>T ; c.3076G>T ; NM_004006.2(DMD):c.9337C>T ; NM_004006.2(DMD):c.3432+3A>G ; NM_004006.2(DMD):c.4806A>T ; NM_004006.2(DMD):c.9361+1G>A ; c.171G>A ; NM_004006.2(DMD):c.2816T>A ; NM_004006.2(DMD):c.627delA ; NM_004006.2(DMD):c.10033C>T ; c.2380+2T>C ; NM_004006.2(DMD):c.2804-2A>T ; c.6936del ; NM_004006.2(DMD):c.2547delT ; c.2758C>T ; NM_004006.2(DMD):c.6000T>A ; c.220del ; g.32557406-32754551 ; c.1900_1903dup ; c.1734del ; NM_004006.2(DMD):c.1286C>A ; NM_004006.2(DMD):c.676_678delAAG ; NM_004006.2(DMD):c.3295C>T ; NM_004006.2(DMD):c.2125delC ; g.31540244-32059446 ; NM_004006.2(DMD):c.6986dupA ; NM_004006.2(DMD):c.8443C>T ; c.2803+1G>A ; c.2587del ; g.32341945-32596022 ; NM_004006.2(DMD):c.3432+1G>A ; c.2266_2267del ; c.2866C>T ; NM_004006.2(DMD):c.6238delC ; NM_004006.2(DMD):c.9650-2A>G ; g.31724913-31806626 ; NM_004006.2(DMD):c.9862G>T ; g.10679-36186635 ; NM_004006.2(DMD):c.8064_8065delTA ; NM_004006.2(DMD):c.1341_1342dupAG ; g.32203741-32353533 ; g.31744885-32562211 ; NM_004006.2(DMD):c.1012G>T ; c.3124A>T ; NM_004006.2(DMD):c.8652_8653delCT ; NM_004006.2(DMD):c.433C>T ; c.277C>T ; NM_004006.2:c.2169-3_2169-1delinsAA ; c.7764dup ; NM_004006.2(DMD):c.3276+1G>A ; g.32501716-32932295 ; g.31856886-32482971 ; NM_004006.2(DMD):c.10141C>T ; NM_004006.2(DMD):c.6906G>A ; NM_004006.2(DMD):c.1261C>T ; NM_004006.2(DMD):c.10086+1G>A ; NM_004006.2(DMD):c.10446_10447delCT ; NM_004006.2(DMD):c.2484T>G ; NM_004006.2(DMD):c.4375C>T ; g.251879-35885004 ; g.31745624-31876916 ; g.31121669-33339588 ; g.30093911-34060667 ; c.489G>A ; g.31180370-31206667 ; g.10679-52213731 ; c.4486del ; NM_004006.2(DMD):c.9164-1G>C ; NM_004006.2(DMD):c.9854_9863delTGAGACTGGA ; g.31632068-31954142 ; NM_004006.2(DMD):c.1371delG ; NM_004006.2(DMD):c.2281_2285delGAAAA ; c.5570_5571dup ; c.2929dup ; c.6964del ; NM_004006.2(DMD):c.6391_6392delCA ; c.1900A>T ; NM_004006.2(DMD):c.615T>A ; g.32631403-32907656 ; c.530+1del ; NM_004006.2(DMD):c.1048G>T ; NM_004006.2(DMD):c.2755A>T ; c.2479del ; NM_004006.2(DMD):c.3747delG ; NM_004006.2(DMD):c.2815_2816delTT ; c.4409_4412dup ; c.6943G>T ; c.977-1G>T ; NM_004006.2(DMD):c.6182delC ; NM_004006.2(DMD):c.4518+5G>A ; g.10701-49071220 ; g.251880-51643625 ; NM_004006.2(DMD):c.1529_1530delTC ; NM_004006.2(DMD):c.6373C>T ; g.32380341-32412502 ; NM_004006.2(DMD):c.2803+1G>T ; c.6340A>T ; NM_004006.2(DMD):c.5773G>T ; c.3697del ; g.32341945-32816915 ; c.6763-2A>G ; c.4735G>T ; c.5671A>T ; c.5807T>A ; g.31744863-31846787 ; g.31627435-31774446 ; g.31679229-31968838 ; NM_004006.2(DMD):c.1306dupG ; g.32697662-32699472 ; NM_004006.2(DMD):c.7682G>A ; c.4500del ; NM_004006.2(DMD):c.6392_6393insCA ; c.1159C>T ; NM_004006.2(DMD):c.137_138dupAT ; g.31444405-31806767 ; g.32452761-32645074 ; NM_004006.2(DMD):c.5530C>T ; NM_004006.2(DMD):c.6982A>T ; c.3022A>T ; c.2523del ; NM_004006.2(DMD):c.9568C>T ; g.31819658-31932544 ; NM_004006.2(DMD):c.583C>T ; c.8086del ; NM_004006.2(DMD):c.5363C>G ; g.31898812-32022323 ; NM_004006.2(DMD):c.4405C>T ; NM_004006.2(DMD):c.2332C>T ; NM_004006.2(DMD):c.4117C>T ; g.31679229-31932544 ; g.32662366-32758964 ; NM_004006.2(DMD):c.8656C>T ; NM_004006.2(DMD):c.2302C>T ; NM_004006.2(DMD):c.2380+1G>C ; c.6014_6017del ; c.204dup ; NM_004006.2(DMD):c.5353C>T ; NM_004006.2(DMD):c.6292C>T ; c.2137C>T ; NM_004006.2(DMD):c.2294_2297delCCAT ; c.5313dup ; c.199G>T ; g.32432957-32823439 ; g.32267823-32372572 ; NM_004006.2(DMD):c.3639dupA ; g.31147275-31173604 ; c.1193C>G ; c.6226G>T ; c.6834del ; g.13020141-143473520 ; NM_004006.2(DMD):c.10454delT ; g.31870708-32353592 ; NM_004006.2(DMD):c.8944C>T ; g.10701-53131191 ; NM_004006.2(DMD):c.7894C>T ; NM_004006.2(DMD):c.412_413delAA ; NM_004006.2(DMD):c.4843A>T ; NM_004006.2(DMD):c.1332-9A>G ; NM_004006.2(DMD):c.2650C>T ; NM_004006.2(DMD):c.8713C>T ; g.31874956-31932544 ; NM_004006.2(DMD):c.8374_8375delAA ; NM_004006.2(DMD):c.5554C>T ; NM_004006.2(DMD):c.7683G>A ; g.31518752-31636035 ; g.31609490-32699472 ; NM_004006.2(DMD):c.1070delC ; NM_004006.2(DMD):c.9361+1G>C ; g.31929292-31968838 ; g.32364355-32390415 ; NM_004006.2(DMD):c.133C>T ; g.32216645-32651039 ; NM_004006.2:c.3246_3247insTTTCTAAAAA ; NM_004006.2(DMD):c.1489C>T ; g.32275729-32353585 ; g.31695292-31840818 ; NM_004006.2(DMD):c.9564-1G>A ; NM_004006.2(DMD):c.3779_3785delCTTTGGAinsGG ; g.31773859-31932544 ; g.31627435-31932544 ; g.31836597-31932544 ; NM_004006.2(DMD):c.3121C>T ; NM_004006.2(DMD):c.5697delA ; NM_004006.2(DMD):c.7771G>T ; NM_004006.2(DMD):c.7922delA ; g.31640772-31665565 ; g.31431098-31525874 ; g.32411633-33020588 ; g.31121669-31134568 ; NM_004006.2(DMD):c.1886C>A ; g.31931923-31932544 ; g.31965009-31968838 ; g.33019769-33020588 ; NM_004006.2(DMD):c.5287C>T ; g.31189847-31945183 ; NM_004006.2(DMD):c.5640T>A ; g.31133877-31134568 ; g.32380341-32380904



Síndrome de microdeleción 1p21.3

El síndrome de microdeleción 1p21.3 es una anomalía cromosómica extremadamente rara que se caracteriza por un grave retraso del habla y del lenguaje, una deficiencia intelectual y un trastorno del espectro autista (véase este término).


El síndrome de microdeleción 1p21.3 se caracteriza por un grave retraso en el habla y el lenguaje, una deficiencia intelectual de leve a moderada, rasgos del trastorno del espectro autista (véase este término) y pequeños rasgos faciales dismórficos como orejas largas, ojos hundidos, una punta nasal ancha y un labio inferior grueso. Los individuos afectados tienen un desarrollo motor grueso normal sin anomalías importantes, suelen ser muy tímidos y amistosos y tienen tendencia a comer en exceso.

Deficiencia de dihidropirimidina deshidrogenasa

La deficiencia de dihidropirimidina deshidrogenasa muestra una gran variabilidad fenotípica, que va desde la ausencia de síntomas hasta un trastorno convulsivo con retraso motor y mental en pacientes homocigotos. Además, los portadores homocigóticos y heterocigóticos de la mutación pueden desarrollar una toxicidad grave tras la administración del fármaco antineoplásico 5-fluorouracilo (5FU), que también es catabolizado por la enzima DPYD.


Trastorno raro del metabolismo de las pirimidinas que se caracteriza por un fenotipo variable que va desde la ausencia de síntomas hasta una grave afectación neurológica con retraso del desarrollo, discapacidad intelectual y convulsiones. Otros signos y síntomas pueden incluir hipotonía, microcefalia, anomalías oculares (como microftalmia, nistagmo y estrabismo) y comportamiento autista, entre otros. El análisis de orina suele mostrar niveles elevados de uracilo y timina. Los pacientes corren el riesgo de sufrir una toxicidad grave tras la administración del agente antineoplásico 5-fluorouracilo.


NM_000110.3(DPYD):c.1109_1110delTA ; NM_000110.3(DPYD):c.1109_1110delTA



Miopatía congénita, tipo Paradas

Distrofia muscular congénita poco frecuente que se caracteriza por la aparición temprana de hipotonía, retraso en el desarrollo motor y debilidad muscular generalizada de progresión variable. Se ha informado de la afectación predominante de los músculos flexores de la pelvis y del cuello, así como de la afectación temprana de los isquiotibiales y del gastrocnemio medial, visible en la resonancia magnética muscular. Los niveles de creatina quinasa en suero están notablemente elevados (en algunos casos ya desde la primera infancia). La biopsia muscular muestra la ausencia de disferlina.



Miopatía distal con inicio en la tibia anterior

La miopatía distal con inicio en la tibia anterior es una enfermedad neuromuscular genética poco frecuente que se caracteriza por una debilidad muscular progresiva que comienza en los músculos de la tibia anterior y que posteriormente afecta a los músculos de las extremidades inferiores y superiores, y que se asocia a un aumento de los niveles de creatina quinasa en suero y a la ausencia de disferlina en la biopsia muscular. Los pacientes se vuelven dependientes de la silla de ruedas.


El trastorno se inicia entre los 14 y los 28 años de edad y los músculos tibiales anteriores son el primer grupo muscular afectado. El trastorno tiene un curso rápidamente progresivo que afecta sucesivamente a los músculos proximales inferiores y superiores, y los pacientes quedan confinados a una silla de ruedas entre los 11 y los 22 años desde el inicio. Los músculos craneales no se ven afectados. El nivel de creatina quinasa en suero está aumentado de 20 a 70 veces el valor normal y los estudios histopatológicos del músculo muestran cambios miopáticos moderados sin vacuolas.

Distrofia muscular de cinturas relacionada con la disferlina R2

Subtipo de distrofia muscular de cinturas autosómica recesiva que se caracteriza por la aparición en la adolescencia tardía o en la edad adulta temprana de debilidad proximal lentamente progresiva y atrofia de los músculos de la cintura escapular y pélvica. Los músculos cardíacos y respiratorios no están implicados. Con frecuencia se observa hipertrofia de los músculos de la pantorrilla y niveles séricos de creatina quinasa muy elevados.


La edad de inicio oscila entre los 15 y los 25 años, con dificultad para subir escaleras, fatiga, debilidad y creatina quinasa sérica marcadamente elevada. La EMG mostró cambios miopáticos y las biopsias del músculo esquelético mostraron cambios miopáticos graves con variación del tamaño de las fibras, división de las fibras, aumento del tejido conectivo y algunos cambios necróticos. La progresión de la enfermedad fue relativamente lenta.

Miopatía de Miyoshi

Miopatía distal recesiva que se caracteriza por la debilidad del compartimento posterior de la extremidad inferior distal (músculos gastrocnemio y sóleo) y que se asocia con dificultades para ponerse de pie en la punta de los pies.


La edad típica de aparición del MM se sitúa entre los 15 y los 30 años (la mediana es de 19 años) y la enfermedad se caracteriza por una atrofia muscular generalmente simétrica, especialmente de los músculos de la pantorrilla (sóleo y gastrocnemio). Raramente se ha descrito la aparición de los músculos tibiales anteriores. Se pierden los reflejos de estiramiento de los músculos del tobillo y se encuentran dificultades para caminar de puntillas o subir escaleras. La mialgia inducida por el ejercicio y las molestias en las pantorrillas pueden ser un síntoma temprano. Los músculos del compartimento anterior de las extremidades inferiores distales también acaban debilitándose. A medida que la enfermedad progresa, los pacientes desarrollarán debilidad en las piernas y brazos proximales en diversos grados. La disminución de las funciones respiratorias se ha notificado sólo en unos pocos pacientes con la enfermedad de moderada a grave. No se han descrito síntomas bulbares ni de otro tipo.


NM_003494.3(DYSF):c.610C>T ; c.5992G>T ; NM_003494.3(DYSF):c.3641delC ; c.3175-2A>T ; NM_001130978.1(DYSF):c.5264A>G ; NM_003494.3(DYSF):c.3444_3445delTGinsAA ; NM_003494.3(DYSF):c.1053+1G>A ; NM_003494.3(DYSF):c.937+1G>A ; c.3957del ; NM_003494.3(DYSF):c.5341-2A>C ; c.3477C>A ; NM_003494.3(DYSF):c.2870_2874delAGACC ; NM_001130987.1(DYSF):c.1372G>A ; c.4108_4109del ; NM_003494.3(DYSF):c.3041A>G ; c.1620del ; NM_001130978.1(DYSF):c.1813C>T ; NM_003494.3(DYSF):c.5836_5839delCAGC ; NM_001130987.1(DYSF):c.853C>T ; NM_003494.3(DYSF):c.5509G>A ; NM_003494.3(DYSF):c.1368C>A ; NM_003494.3(DYSF):c.5644C>T ; NM_003494.3(DYSF):c.5525+1G>A ; NM_003494.3(DYSF):c.2997G>T ; c.3708del ; NM_001130978.1(DYSF):c.1873G>T ; NM_003494.3(DYSF):c.1398-2A>G ; NM_003494.3(DYSF):c.4253G>A ; c.1861G>C ; NM_003494.3(DYSF):c.1481-1G>A ; NM_003494.3(DYSF):c.5077C>T ; NM_003494.3(DYSF):c.5266C>T ; NM_003494.3(DYSF):c.1392dupA ; NM_003494.3(DYSF):c.895G>A ; NM_003494.3(DYSF):c.5429G>A ; NM_003494.3(DYSF):c.5698_5699delAG ; NM_001130978.1(DYSF):c.895G>T ; c.3903+1del ; NM_003494.3(DYSF):c.663+1G>C ; NM_001130978.1(DYSF):c.200_201delTGinsAT ; NM_003494.3(DYSF):c.1398-1G>A ; NM_003494.3(DYSF):c.3112C>T ; NM_003494.3(DYSF):c.6124C>T ; NM_003494.3(DYSF):c.3805G>T ; NM_003494.3(DYSF):c.1663C>T ; NM_003494.4:c.4872_4876delGCCCGinsCCCC ; NM_003494.3(DYSF):c.3478C>T ; NM_003494.3(DYSF):c.701G>A ; NM_003494.3(DYSF):c.1284+2T>C ; NM_003494.3(DYSF):c.4090C>T ; NM_003494.3(DYSF):c.4756C>T ; NM_003494.3(DYSF):c.1638+2T>A ; NM_003494.3(DYSF):c.2869C>T ; NM_003494.3(DYSF):c.5497G>T ; NM_003494.3(DYSF):c.5594delG ; NM_003494.3(DYSF):c.5429+1G>T ; NM_003494.3(DYSF):c.5979dupA ; NM_003494.3(DYSF):c.5713C>T ; NM_003494.3(DYSF):c.1834C>T ; NM_003494.3(DYSF):c.393_394delCC ; NM_003494.3(DYSF):c.610C>T ; c.5992G>T ; NM_003494.3(DYSF):c.3641delC ; c.3175-2A>T ; NM_001130978.1(DYSF):c.5264A>G ; NM_003494.3(DYSF):c.3444_3445delTGinsAA ; NM_003494.3(DYSF):c.1053+1G>A ; NM_003494.3(DYSF):c.937+1G>A ; c.3957del ; NM_003494.3(DYSF):c.5341-2A>C ; c.3477C>A ; NM_003494.3(DYSF):c.2870_2874delAGACC ; NM_001130987.1(DYSF):c.1372G>A ; c.4108_4109del ; NM_003494.3(DYSF):c.3041A>G ; c.1620del ; NM_001130978.1(DYSF):c.1813C>T ; NM_003494.3(DYSF):c.5836_5839delCAGC ; NM_001130987.1(DYSF):c.853C>T ; NM_003494.3(DYSF):c.5509G>A ; NM_003494.3(DYSF):c.1368C>A ; NM_003494.3(DYSF):c.5644C>T ; NM_003494.3(DYSF):c.5525+1G>A ; NM_003494.3(DYSF):c.2997G>T ; c.3708del ; NM_001130978.1(DYSF):c.1873G>T ; NM_003494.3(DYSF):c.1398-2A>G ; NM_003494.3(DYSF):c.4253G>A ; c.1861G>C ; NM_003494.3(DYSF):c.1481-1G>A ; NM_003494.3(DYSF):c.5077C>T ; NM_003494.3(DYSF):c.5266C>T ; NM_003494.3(DYSF):c.1392dupA ; NM_003494.3(DYSF):c.895G>A ; NM_003494.3(DYSF):c.5429G>A ; NM_003494.3(DYSF):c.5698_5699delAG ; NM_001130978.1(DYSF):c.895G>T ; c.3903+1del ; NM_003494.3(DYSF):c.663+1G>C ; NM_001130978.1(DYSF):c.200_201delTGinsAT ; NM_003494.3(DYSF):c.1398-1G>A ; NM_003494.3(DYSF):c.3112C>T ; NM_003494.3(DYSF):c.6124C>T ; NM_003494.3(DYSF):c.3805G>T ; NM_003494.3(DYSF):c.1663C>T ; NM_003494.4:c.4872_4876delGCCCGinsCCCC ; NM_003494.3(DYSF):c.3478C>T ; NM_003494.3(DYSF):c.701G>A ; NM_003494.3(DYSF):c.1284+2T>C ; NM_003494.3(DYSF):c.4090C>T ; NM_003494.3(DYSF):c.4756C>T ; NM_003494.3(DYSF):c.1638+2T>A ; NM_003494.3(DYSF):c.2869C>T ; NM_003494.3(DYSF):c.5497G>T ; NM_003494.3(DYSF):c.5594delG ; NM_003494.3(DYSF):c.5429+1G>T ; NM_003494.3(DYSF):c.5979dupA ; NM_003494.3(DYSF):c.5713C>T ; NM_003494.3(DYSF):c.1834C>T ; NM_003494.3(DYSF):c.393_394delCC




La oligodoncia es una rara anomalía dental del desarrollo en humanos caracterizada por la ausencia de seis o más dientes.


Las características clínicas de la oligodoncia incluyen la ausencia de seis o más dientes, la falta de desarrollo de la altura del hueso alveolar maxilar y mandibular y la reducción de la altura facial inferior. También se observan variaciones en la morfología de los dientes y problemas en el desarrollo, la erupción y la exfoliación de los mismos.

Displasia ectodérmica hipohidrótica ligada al X



La displasia ectodérmica hipohidrótica o anhidrótica (HED/EDA) se caracteriza por una tríada de signos que comprenden pelo escaso (hipotricosis), dientes anormales o ausentes (anodoncia o hipodoncia) e incapacidad para sudar (anhidrosis o hipohidrosis). Las manifestaciones clínicas típicas también incluyen la sequedad de la piel, los ojos, las vías respiratorias y las membranas mucosas, presumiblemente debido al desarrollo defectuoso de varias glándulas exocrinas. La displasia ectodérmica hipohidrótica puede asociarse a rasgos dismórficos (protuberancias en la frente, ojeras, nariz evertida y labios prominentes) y, en ocasiones, a la ausencia de pezones. La displasia ectodérmica 1, debida a una mutación en el gen EDA, es la forma más frecuente de displasia ectodérmica hipohidrótica.


NM_001399.4(EDA):c.187G>A ; NM_001399.4(EDA):c.183C>G ; NM_001399.4(EDA):c.467G>A ; NM_001399.5(EDA):c.573_574insT ; NM_001399.4(EDA):c.463C>T ; NM_001399.4(EDA):c.466C>T ; NM_001399.4(EDA):c.671G>C ; NM_001399.4(EDA):c.826C>T ; NM_001399.4(EDA):c.1045G>A ; NM_001399.4(EDA):c.181T>C ; NM_001399.4(EDA):c.187G>A ; NM_001399.4(EDA):c.183C>G ; NM_001399.4(EDA):c.467G>A ; NM_001399.5(EDA):c.573_574insT ; NM_001399.4(EDA):c.463C>T ; NM_001399.4(EDA):c.466C>T ; NM_001399.4(EDA):c.671G>C ; NM_001399.4(EDA):c.826C>T ; NM_001399.4(EDA):c.1045G>A ; NM_001399.4(EDA):c.181T>C



Síndrome de Wolcott-Rallison

El síndrome de Wolcott-Rallison (WRS) es una enfermedad genética muy rara, caracterizada por una diabetes mellitus neonatal permanente (PNDM) con displasia epifisaria múltiple y otras manifestaciones clínicas, incluyendo episodios recurrentes de insuficiencia hepática aguda.


La diabetes se presenta de forma precoz, generalmente antes de los seis meses de edad, es permanente y dependiente de la insulina desde el inicio. La displasia esquelética se manifiesta generalmente en el primer o segundo año de vida, y está asociada a la baja estatura (enanismo con tronco corto). La mineralización deficiente o los cambios displásicos, que afectan a los huesos largos, la pelvis y las vértebras, pero normalmente no al cráneo, pueden observarse en la radiografía desde el inicio de la diabetes. La disfunción hepática es un tercer rasgo característico y la complicación más peligrosa para la vida, y se manifiesta por la elevación de las enzimas hepáticas, el agrandamiento del hígado y la insuficiencia hepática aguda recurrente. Otras manifestaciones varían entre los pacientes en cuanto al tipo y la gravedad e incluyen disfunción renal, insuficiencia del páncreas exocrino, déficit intelectual, hipotiroidismo, neutropenia e infecciones recurrentes. La evolución clínica es variable, incluso dentro de la misma hermandad.


NM_004836.6(EIF2AK3):c.1763G>A ; NM_004836.6(EIF2AK3):c.994G>T ; NM_004836.6(EIF2AK3):c.1763G>A ; NM_004836.6(EIF2AK3):c.994G>T



Distrofia muscular de Emery-Dreifuss ligada al X



La tríada clínica se compone de contracturas articulares de los tendones de Aquiles, del codo y del cuello posterior (que comienzan durante la primera infancia y empeoran hasta provocar una limitación del movimiento articular). Presenta debilidad y atrofia muscular lentamente progresiva (al principio y generalmente con una distribución humeroperoneal, pero más tarde se vuelve más difusa). Anomalías cardíacas (defectos de conducción, alteraciones del ritmo y miocardiopatía dilatada) que suelen manifestarse entre la 2ª y la 3ª década de la vida y que pueden conducir a la muerte súbita (a veces la característica de presentación de la enfermedad) y a accidentes isquémicos por embolia. El curso y la gravedad de la enfermedad varían entre las familias y entre los pacientes de una misma familia.


NM_000117.2(EMD):c.547C>A ; c.631_635del ; NM_000117.2(EMD):c.547C>A ; c.631_635del



Síndrome COFS

El síndrome de contractura congénita letal de tipo 1 es un raro síndrome de artrogriposis genética caracterizado por una acinesia fetal total (detectable desde la 13ª semana de gestación) acompañada de hidropesía, micrognatia, hipoplasia pulmonar, pterigia y múltiples contracturas articulares (normalmente contracturas de flexión en los codos y de extensión en las rodillas), que conducen invariablemente a la muerte antes de la 32ª semana de gestación. La falta de motoneuronas del cuerno anterior, la atrofia severa de la médula espinal ventral y la hipoplasia muscular esquelética severa son hallazgos neuropatológicos característicos, sin evidencia de anomalías estructurales de otros órganos.


El síndrome COFS constituye la forma extrema prenatal del síndrome de Cockayne (véase este término). Clínicamente, se encuentran los siguientes criterios: microcefalia congénita, catarata congénita y/o microftalmia, artrogriposis, retraso severo del desarrollo psicomotor, retraso del crecimiento talla-peso (principalmente postnatal) y dismorfismo facial (sutura metópica prominente, micrognatismo). La hipotonía axial contrasta con la hipertonía periférica y se asocia a dificultades de alimentación. Puede observarse fotosensibilidad cutánea, neuropatía periférica, pérdida auditiva neurosensorial y retinopatía pigmentaria.


La tricotiodistrofia o TTD es un grupo heterogéneo de trastornos caracterizados por un cabello corto y quebradizo con bajo contenido en azufre (debido a una síntesis anormal de las queratinas que contienen azufre).


Dentro del espectro de los síndromes TTD hay numerosos síndromes que afectan principalmente a los órganos derivados del neuroectodermo. El aspecto clínico se caracteriza siempre por un cabello frágil y quebradizo, a menudo combinado con retraso del crecimiento y déficit intelectual, ictiosis congénita y anomalías ungueales, entre otros síntomas. Las anomalías suelen ser evidentes al nacer, con una expresión clínica variable. Las variantes de TTD, según sus diferentes asociaciones, son: Síndrome BIDS (o TTD tipo D o síndrome del cabello quebradizo de Amish), síndrome IBIDS (o síndrome de Tay o TTD tipoE), síndrome PIBIDS (o TTD tipo F), síndrome de Sabinas (TTD tipo B), síndrome SIBIDS, ONMRS (síndrome de Itin) y síndrome de Pollitt (TTD tipo C).

Xeroderma pigmentoso

Un raro trastorno de la biogénesis del peroxisoma (la variante más grave del espectro de trastornos de la biogénesis del peroxisoma) caracterizado por defectos de migración neuronal en el cerebro, rasgos craneofaciales dismórficos, hipotonía profunda, convulsiones neonatales y disfunción hepática.


La gravedad de las manifestaciones clínicas y la edad de aparición son extremadamente variables y dependen en parte de la exposición a la luz solar y del grupo de complementación. Aproximadamente el 50% de los individuos afectados tienen una sensibilidad solar aguda desde los primeros meses de vida, presentando quemaduras solares graves y/o eritema persistente que tarda semanas en resolverse. Otros no muestran ninguna reacción de quemadura solar y desarrollan gradualmente pecas marcadas en los lugares expuestos al sol. Los individuos tienen la piel seca y lesiones hipo o hiperpigmentadas. El riesgo de padecer cánceres de piel no melanoma es más de 10.000 veces mayor, y el de melanoma por debajo de los 20 años es 2.000 veces mayor en comparación con la población general. Los pacientes con XP clásico desarrollan cáncer de piel generalmente antes de los 20 años, mientras que los pacientes con la variante XP empiezan a desarrollar cáncer de piel a los 20-30 años aproximadamente. Las anomalías oculares incluyen queratitis que dan lugar a opacificación y vascularización de la córnea. La fotofobia es frecuente. El carcinoma de células escamosas ocular y el melanoma son comunes. Se han notificado anomalías neurológicas de diversa gravedad en aproximadamente el 30% de los casos. Estas incluyen microcefalia adquirida, disminución o ausencia de reflejos tendinosos profundos, pérdida de audición neurosensorial progresiva, espasticidad, ataxia, convulsiones y deterioro cognitivo progresivo. El síndrome de Sanctis-Cacchione es un término que originalmente se atribuía a los casos de XP con graves anomalías neurológicas, pero ya no es de uso general.

Complejo de Xeroderma pigmentoso-Síndrome de Cockayne

El complejo de xeroderma pigmentoso/síndrome de Cockayne (complejo XP/CS) se caracteriza por los rasgos cutáneos del xeroderma pigmentoso (XP) (véase este término) junto con los rasgos sistémicos y neurológicos del síndrome de Cockayne (CS; véase este término).


La enfermedad se manifiesta durante la infancia. Los pacientes presentan lesiones cutáneas sensibles a los rayos UV que generalmente evolucionan a cáncer de piel, y también desarrollan manifestaciones características del SC como microcefalia, hidrocefalia, caquexia, envejecimiento prematuro, enanismo, atrofia cutánea, arteriosclerosis, pérdida progresiva de la audición, déficit cognitivo, espasticidad, ataxia, retinopatía pigmentaria y atrofia óptica. A diferencia de las anomalías neurológicas de la XP, que son predominantemente secundarias a la degeneración neuronal, en el complejo XP/CS se observa la desmielinización típica del CS.


c.950-2A>G ; NM_000400.3(ERCC2):c.1454T>C ; c.949+1G>A ; c.1308-1G>A ; NM_000400.3(ERCC2):c.2176C>T ; NM_000400.3(ERCC2):c.1381C>G ; c.567G>A ; c.1354C>T ; c.719-1G>A ; NM_000400.3(ERCC2):c.1621A>C ; c.2230_2233dup ; NM_000400.3(ERCC2):c.2047C>T ; NM_000400.3(ERCC2):c.1972C>T ; NM_000400.3(ERCC2):c.1703_1704delTT ; c.950-2A>G ; NM_000400.3(ERCC2):c.1454T>C ; c.949+1G>A ; c.1308-1G>A ; NM_000400.3(ERCC2):c.2176C>T ; NM_000400.3(ERCC2):c.1381C>G ; c.567G>A ; c.1354C>T ; c.719-1G>A ; NM_000400.3(ERCC2):c.1621A>C ; c.2230_2233dup ; NM_000400.3(ERCC2):c.2047C>T ; NM_000400.3(ERCC2):c.1972C>T ; NM_000400.3(ERCC2):c.1703_1704delTT




La tricotiodistrofia o TTD es un grupo heterogéneo de trastornos caracterizados por un cabello corto y quebradizo con bajo contenido en azufre (debido a una síntesis anormal de las queratinas que contienen azufre).


Dentro del espectro de los síndromes TTD hay numerosos síndromes que afectan principalmente a los órganos derivados del neuroectodermo. El aspecto clínico se caracteriza siempre por un cabello frágil y quebradizo, a menudo combinado con retraso del crecimiento y déficit intelectual, ictiosis congénita y anomalías ungueales, entre otros síntomas. Las anomalías suelen ser evidentes al nacer, con una expresión clínica variable. Las variantes de TTD, según sus diferentes asociaciones, son: Síndrome BIDS (o TTD tipo D o síndrome del cabello quebradizo de Amish), síndrome IBIDS (o síndrome de Tay o TTD tipoE), síndrome PIBIDS (o TTD tipo F), síndrome de Sabinas (TTD tipo B), síndrome SIBIDS, ONMRS (síndrome de Itin) y síndrome de Pollitt (TTD tipo C).

Xeroderma pigmentoso

Un raro trastorno de la biogénesis del peroxisoma (la variante más grave del espectro de trastornos de la biogénesis del peroxisoma) caracterizado por defectos de migración neuronal en el cerebro, rasgos craneofaciales dismórficos, hipotonía profunda, convulsiones neonatales y disfunción hepática.


La gravedad de las manifestaciones clínicas y la edad de aparición son extremadamente variables y dependen en parte de la exposición a la luz solar y del grupo de complementación. Aproximadamente el 50% de los individuos afectados tienen una sensibilidad solar aguda desde los primeros meses de vida, presentando quemaduras solares graves y/o eritema persistente que tarda semanas en resolverse. Otros no muestran ninguna reacción de quemadura solar y desarrollan gradualmente pecas marcadas en los lugares expuestos al sol. Los individuos tienen la piel seca y lesiones hipo o hiperpigmentadas. El riesgo de padecer cánceres de piel no melanoma es más de 10.000 veces mayor, y el de melanoma por debajo de los 20 años es 2.000 veces mayor en comparación con la población general. Los pacientes con XP clásico desarrollan cáncer de piel generalmente antes de los 20 años, mientras que los pacientes con la variante XP empiezan a desarrollar cáncer de piel a los 20-30 años aproximadamente. Las anomalías oculares incluyen queratitis que dan lugar a opacificación y vascularización de la córnea. La fotofobia es frecuente. El carcinoma de células escamosas ocular y el melanoma son comunes. Se han notificado anomalías neurológicas de diversa gravedad en aproximadamente el 30% de los casos. Estas incluyen microcefalia adquirida, disminución o ausencia de reflejos tendinosos profundos, pérdida de audición neurosensorial progresiva, espasticidad, ataxia, convulsiones y deterioro cognitivo progresivo. El síndrome de Sanctis-Cacchione es un término que originalmente se atribuía a los casos de XP con graves anomalías neurológicas, pero ya no es de uso general.

Complejo de Xeroderma pigmentoso-Síndrome de Cockayne

El complejo de xeroderma pigmentoso/síndrome de Cockayne (complejo XP/CS) se caracteriza por los rasgos cutáneos del xeroderma pigmentoso (XP) (véase este término) junto con los rasgos sistémicos y neurológicos del síndrome de Cockayne (CS; véase este término).


La enfermedad se manifiesta durante la infancia. Los pacientes presentan lesiones cutáneas sensibles a los rayos UV que generalmente evolucionan a cáncer de piel, y también desarrollan manifestaciones características del SC como microcefalia, hidrocefalia, caquexia, envejecimiento prematuro, enanismo, atrofia cutánea, arteriosclerosis, pérdida progresiva de la audición, déficit cognitivo, espasticidad, ataxia, retinopatía pigmentaria y atrofia óptica. A diferencia de las anomalías neurológicas de la XP, que son predominantemente secundarias a la degeneración neuronal, en el complejo XP/CS se observa la desmielinización típica del CS.


NM_000122.1(ERCC3):c.1273C>T ; NM_000122.1(ERCC3):c.1633C>T ; NM_000122.1(ERCC3):c.296T>C ; c.1858del ; c.1757del ; NM_000122.1(ERCC3):c.1273C>T ; NM_000122.1(ERCC3):c.1633C>T ; NM_000122.1(ERCC3):c.296T>C ; c.1858del ; c.1757del



Síndrome de Cockayne tipo 1

El síndrome de Cockayne (SC) es una enfermedad multisistémica caracterizada por una estatura baja, un aspecto facial característico, envejecimiento prematuro, fotosensibilidad, disfunción neurológica progresiva y déficit intelectual.


La gravedad de la enfermedad y la edad de aparición son variables. En el SC clásico de tipo I, los primeros síntomas suelen aparecer durante el primer año de vida. También se han descrito casos de inicio temprano con síntomas más graves (tipo II) y casos de inicio tardío con síntomas más leves (tipo III). Entre los signos más comunes de la enfermedad se encuentran el retraso progresivo del crecimiento, el déficit intelectual, la ataxia cerebelosa, la espasticidad, la neuropatía desmielinizante periférica, la retinopatía pigmentaria, la pérdida auditiva neurosensorial y las anomalías dentales (presencia de caries). El aspecto facial típico incluye microcefalia, orejas grandes, nariz fina y enoftalmia. En algunos pacientes se observan cataratas y fotosensibilidad cutánea. La lipoatrofia subcutánea está presente y puede dar lugar a signos de envejecimiento prematuro de la piel. El síndrome COFS (véase este término) es la forma prenatal extrema del espectro clínico del SC, caracterizada por microftalmia congénita y artrogriposis.

Anemia de Fanconi

Se trata de un raro trastorno genético multisistémico caracterizado por pancitopenia progresiva con insuficiencia de la médula ósea, malformaciones congénitas variables y predisposición a desarrollar tumores hematológicos o sólidos.


Los primeros signos de la anemia de Fanconi (AF) suelen ser rasgos no hematológicos. Las anomalías de las extremidades suelen afectar a las mismas, son unilaterales o (normalmente asimétricas) bilaterales. También pueden presentarse anomalías menores, como baja talla y peso al nacer, microcefalia y/o microftalmia. Son frecuentes las anomalías en la pigmentación de la piel (manchas café con leche) y la hipoplasia de la eminencia tenar. Casi el 20% de los pacientes presentan malformaciones del oído con o sin pérdida de audición. Las malformaciones congénitas pueden afectar a otros sistemas orgánicos y variar dentro de las familias. La baja estatura es sindrómica y/o está asociada a endocrinopatías. La fertilidad se ve afectada con frecuencia en los varones y está muy alterada en la mitad de las mujeres. Cuando las malformaciones congénitas no son prominentes, el diagnóstico puede retrasarse hasta la aparición de anomalías hematológicas. La insuficiencia de la médula ósea (FMO) se produce a una edad media de 7 años, desarrollándose en el 90% de los pacientes a los 40 años. Las primeras manifestaciones son la macrocitosis (muy temprana) y la trombocitopenia. En los pacientes con mosaicismo somático, los recuentos sanguíneos pueden permanecer normales hasta la aparición de una neoplasia hematológica. En general, los pacientes tienen una gran predisposición a los tumores sólidos (con mayor frecuencia en la cabeza y el cuello o en las regiones anogenitales).

Xeroderma pigmentoso

Un raro trastorno de la biogénesis del peroxisoma (la variante más grave del espectro de trastornos de la biogénesis del peroxisoma) caracterizado por defectos de migración neuronal en el cerebro, rasgos craneofaciales dismórficos, hipotonía profunda, convulsiones neonatales y disfunción hepática.


La gravedad de las manifestaciones clínicas y la edad de aparición son extremadamente variables y dependen en parte de la exposición a la luz solar y del grupo de complementación. Aproximadamente el 50% de los individuos afectados tienen una sensibilidad solar aguda desde los primeros meses de vida, presentando quemaduras solares graves y/o eritema persistente que tarda semanas en resolverse. Otros no muestran ninguna reacción de quemadura solar y desarrollan gradualmente pecas marcadas en los lugares expuestos al sol. Los individuos tienen la piel seca y lesiones hipo o hiperpigmentadas. El riesgo de padecer cánceres de piel no melanoma es más de 10.000 veces mayor, y el de melanoma por debajo de los 20 años es 2.000 veces mayor en comparación con la población general. Los pacientes con XP clásico desarrollan cáncer de piel generalmente antes de los 20 años, mientras que los pacientes con la variante XP empiezan a desarrollar cáncer de piel a los 20-30 años aproximadamente. Las anomalías oculares incluyen queratitis que dan lugar a opacificación y vascularización de la córnea. La fotofobia es frecuente. El carcinoma de células escamosas ocular y el melanoma son comunes. Se han notificado anomalías neurológicas de diversa gravedad en aproximadamente el 30% de los casos. Estas incluyen microcefalia adquirida, disminución o ausencia de reflejos tendinosos profundos, pérdida de audición neurosensorial progresiva, espasticidad, ataxia, convulsiones y deterioro cognitivo progresivo. El síndrome de Sanctis-Cacchione es un término que originalmente se atribuía a los casos de XP con graves anomalías neurológicas, pero ya no es de uso general.

Complejo de Xeroderma pigmentoso-Síndrome de Cockayne

El complejo de xeroderma pigmentoso/síndrome de Cockayne (complejo XP/CS) se caracteriza por los rasgos cutáneos del xeroderma pigmentoso (XP) (véase este término) junto con los rasgos sistémicos y neurológicos del síndrome de Cockayne (CS; véase este término).


La enfermedad se manifiesta durante la infancia. Los pacientes presentan lesiones cutáneas sensibles a los rayos UV que generalmente evolucionan a cáncer de piel, y también desarrollan manifestaciones características del SC como microcefalia, hidrocefalia, caquexia, envejecimiento prematuro, enanismo, atrofia cutánea, arteriosclerosis, pérdida progresiva de la audición, déficit cognitivo, espasticidad, ataxia, retinopatía pigmentaria y atrofia óptica. A diferencia de las anomalías neurológicas de la XP, que son predominantemente secundarias a la degeneración neuronal, en el complejo XP/CS se observa la desmielinización típica del CS.


c.1467dup ; c.2T>C ; c.2281_2284del ; c.540_541del ; NM_005236.2(ERCC4):c.706T>C ; c.49G>T ; c.1467dup ; c.2T>C ; c.2281_2284del ; c.540_541del ; NM_005236.2(ERCC4):c.706T>C ; c.49G>T



Síndrome COFS

El síndrome de contractura congénita letal de tipo 1 es un raro síndrome de artrogriposis genética caracterizado por una acinesia fetal total (detectable desde la 13ª semana de gestación) acompañada de hidropesía, micrognatia, hipoplasia pulmonar, pterigia y múltiples contracturas articulares (normalmente contracturas de flexión en los codos y de extensión en las rodillas), que conducen invariablemente a la muerte antes de la 32ª semana de gestación. La falta de motoneuronas del cuerno anterior, la atrofia severa de la médula espinal ventral y la hipoplasia muscular esquelética severa son hallazgos neuropatológicos característicos, sin evidencia de anomalías estructurales de otros órganos.


El síndrome COFS constituye la forma extrema prenatal del síndrome de Cockayne (véase este término). Clínicamente, se encuentran los siguientes criterios: microcefalia congénita, catarata congénita y/o microftalmia, artrogriposis, retraso severo del desarrollo psicomotor, retraso del crecimiento talla-peso (principalmente postnatal) y dismorfismo facial (sutura metópica prominente, micrognatismo). La hipotonía axial contrasta con la hipertonía periférica y se asocia a dificultades de alimentación. Puede observarse fotosensibilidad cutánea, neuropatía periférica, pérdida auditiva neurosensorial y retinopatía pigmentaria.

Xeroderma pigmentoso

Un raro trastorno de la biogénesis del peroxisoma (la variante más grave del espectro de trastornos de la biogénesis del peroxisoma) caracterizado por defectos de migración neuronal en el cerebro, rasgos craneofaciales dismórficos, hipotonía profunda, convulsiones neonatales y disfunción hepática.


La gravedad de las manifestaciones clínicas y la edad de aparición son extremadamente variables y dependen en parte de la exposición a la luz solar y del grupo de complementación. Aproximadamente el 50% de los individuos afectados tienen una sensibilidad solar aguda desde los primeros meses de vida, presentando quemaduras solares graves y/o eritema persistente que tarda semanas en resolverse. Otros no muestran ninguna reacción de quemadura solar y desarrollan gradualmente pecas marcadas en los lugares expuestos al sol. Los individuos tienen la piel seca y lesiones hipo o hiperpigmentadas. El riesgo de padecer cánceres de piel no melanoma es más de 10.000 veces mayor, y el de melanoma por debajo de los 20 años es 2.000 veces mayor en comparación con la población general. Los pacientes con XP clásico desarrollan cáncer de piel generalmente antes de los 20 años, mientras que los pacientes con la variante XP empiezan a desarrollar cáncer de piel a los 20-30 años aproximadamente. Las anomalías oculares incluyen queratitis que dan lugar a opacificación y vascularización de la córnea. La fotofobia es frecuente. El carcinoma de células escamosas ocular y el melanoma son comunes. Se han notificado anomalías neurológicas de diversa gravedad en aproximadamente el 30% de los casos. Estas incluyen microcefalia adquirida, disminución o ausencia de reflejos tendinosos profundos, pérdida de audición neurosensorial progresiva, espasticidad, ataxia, convulsiones y deterioro cognitivo progresivo. El síndrome de Sanctis-Cacchione es un término que originalmente se atribuía a los casos de XP con graves anomalías neurológicas, pero ya no es de uso general.

Complejo de Xeroderma pigmentoso-Síndrome de Cockayne

El complejo de xeroderma pigmentoso/síndrome de Cockayne (complejo XP/CS) se caracteriza por los rasgos cutáneos del xeroderma pigmentoso (XP) (véase este término) junto con los rasgos sistémicos y neurológicos del síndrome de Cockayne (CS; véase este término).


La enfermedad se manifiesta durante la infancia. Los pacientes presentan lesiones cutáneas sensibles a los rayos UV que generalmente evolucionan a cáncer de piel, y también desarrollan manifestaciones características del SC como microcefalia, hidrocefalia, caquexia, envejecimiento prematuro, enanismo, atrofia cutánea, arteriosclerosis, pérdida progresiva de la audición, déficit cognitivo, espasticidad, ataxia, retinopatía pigmentaria y atrofia óptica. A diferencia de las anomalías neurológicas de la XP, que son predominantemente secundarias a la degeneración neuronal, en el complejo XP/CS se observa la desmielinización típica del CS.


NM_000123.3(ERCC5):c.526C>T ; c.464dup ; c.381-2A>G ; NM_000123.3(ERCC5):c.787C>T ; NM_000123.3(ERCC5):c.215C>A ; NM_000123.3(ERCC5):c.2573T>C ; NM_000123.3(ERCC5):c.406C>T ; c.88+2T>C ; c.2144dup ; NM_000123.3(ERCC5):c.2751del ; NM_000123.3(ERCC5):c.526C>T ; c.464dup ; c.381-2A>G ; NM_000123.3(ERCC5):c.787C>T ; NM_000123.3(ERCC5):c.215C>A ; NM_000123.3(ERCC5):c.2573T>C ; NM_000123.3(ERCC5):c.406C>T ; c.88+2T>C ; c.2144dup ; NM_000123.3(ERCC5):c.2751del



Síndrome de Cockayne tipo 1

El síndrome de Cockayne (SC) es una enfermedad multisistémica caracterizada por una estatura baja, un aspecto facial característico, envejecimiento prematuro, fotosensibilidad, disfunción neurológica progresiva y déficit intelectual.


La gravedad de la enfermedad y la edad de aparición son variables. En el SC clásico de tipo I, los primeros síntomas suelen aparecer durante el primer año de vida. También se han descrito casos de inicio temprano con síntomas más graves (tipo II) y casos de inicio tardío con síntomas más leves (tipo III). Entre los signos más comunes de la enfermedad se encuentran el retraso progresivo del crecimiento, el déficit intelectual, la ataxia cerebelosa, la espasticidad, la neuropatía desmielinizante periférica, la retinopatía pigmentaria, la pérdida auditiva neurosensorial y las anomalías dentales (presencia de caries). El aspecto facial típico incluye microcefalia, orejas grandes, nariz fina y enoftalmia. En algunos pacientes se observan cataratas y fotosensibilidad cutánea. La lipoatrofia subcutánea está presente y puede dar lugar a signos de envejecimiento prematuro de la piel. El síndrome COFS (véase este término) es la forma prenatal extrema del espectro clínico del SC, caracterizada por microftalmia congénita y artrogriposis.

Síndrome de Cockayne tipo 2

El síndrome de Cockayne (SC) es una enfermedad multisistémica caracterizada por una estatura baja, un aspecto facial característico, envejecimiento prematuro, fotosensibilidad, disfunción neurológica progresiva y déficit intelectual.


La gravedad de la enfermedad y la edad de aparición son variables. En el SC clásico de tipo I, los primeros síntomas suelen aparecer durante el primer año de vida. También se han descrito casos de inicio temprano con síntomas más graves (tipo II) y casos de inicio tardío con síntomas más leves (tipo III). Entre los signos más comunes de la enfermedad se encuentran el retraso progresivo del crecimiento, el déficit intelectual, la ataxia cerebelosa, la espasticidad, la neuropatía desmielinizante periférica, la retinopatía pigmentaria, la pérdida auditiva neurosensorial y las anomalías dentales (presencia de caries). El aspecto facial típico incluye microcefalia, orejas grandes, nariz fina y enoftalmia. En algunos pacientes se observan cataratas y fotosensibilidad cutánea. La lipoatrofia subcutánea está presente y puede dar lugar a signos de envejecimiento prematuro de la piel. El síndrome COFS (véase este término) es la forma prenatal extrema del espectro clínico del SC, caracterizada por microftalmia congénita y artrogriposis.

Síndrome de Cockayne tipo 3

El síndrome de Cockayne (SC) es una enfermedad multisistémica caracterizada por una estatura baja, un aspecto facial característico, envejecimiento prematuro, fotosensibilidad, disfunción neurológica progresiva y déficit intelectual.


La gravedad de la enfermedad y la edad de aparición son variables. En el SC clásico de tipo I, los primeros síntomas suelen aparecer durante el primer año de vida. También se han descrito casos de inicio temprano con síntomas más graves (tipo II) y casos de inicio tardío con síntomas más leves (tipo III). Entre los signos más comunes de la enfermedad se encuentran el retraso progresivo del crecimiento, el déficit intelectual, la ataxia cerebelosa, la espasticidad, la neuropatía desmielinizante periférica, la retinopatía pigmentaria, la pérdida auditiva neurosensorial y las anomalías dentales (presencia de caries). El aspecto facial típico incluye microcefalia, orejas grandes, nariz fina y enoftalmia. En algunos pacientes se observan cataratas y fotosensibilidad cutánea. La lipoatrofia subcutánea está presente y puede dar lugar a signos de envejecimiento prematuro de la piel. El síndrome COFS (véase este término) es la forma prenatal extrema del espectro clínico del SC, caracterizada por microftalmia congénita y artrogriposis.

Síndrome COFS

El síndrome de contractura congénita letal de tipo 1 es un raro síndrome de artrogriposis genética caracterizado por una acinesia fetal total (detectable desde la 13ª semana de gestación) acompañada de hidropesía, micrognatia, hipoplasia pulmonar, pterigia y múltiples contracturas articulares (normalmente contracturas de flexión en los codos y de extensión en las rodillas), que conducen invariablemente a la muerte antes de la 32ª semana de gestación. La falta de motoneuronas del cuerno anterior, la atrofia severa de la médula espinal ventral y la hipoplasia muscular esquelética severa son hallazgos neuropatológicos característicos, sin evidencia de anomalías estructurales de otros órganos.


El síndrome COFS constituye la forma extrema prenatal del síndrome de Cockayne (véase este término). Clínicamente, se encuentran los siguientes criterios: microcefalia congénita, catarata congénita y/o microftalmia, artrogriposis, retraso severo del desarrollo psicomotor, retraso del crecimiento talla-peso (principalmente postnatal) y dismorfismo facial (sutura metópica prominente, micrognatismo). La hipotonía axial contrasta con la hipertonía periférica y se asocia a dificultades de alimentación. Puede observarse fotosensibilidad cutánea, neuropatía periférica, pérdida auditiva neurosensorial y retinopatía pigmentaria.

NO RARA EN EUROPA: Insuficiencia ovárica primaria

La insuficiencia ovárica prematura es un trastorno heterogéneo. Los términos "insuficiencia ovárica hipergonadotrópica" y "disgenesia ovárica hipergonadotrópica" se han utilizado para indicar un grupo de trastornos en los que la amenorrea asociada a niveles elevados de gonadotropinas séricas se produce mucho antes de los 40 años.


La insuficiencia ovárica prematura-11 (POF11) se caracteriza por una amenorrea secundaria y una insuficiencia ovárica hipergonadotrópica, con niveles elevados de hormona foliculoestimulante (FSH) en suero antes de los 40 años.

Síndrome de sensibilidad a los rayos UV

Fotodermatosis rara que se caracteriza por una fotosensibilidad cutánea y una ligera despigmentación, sin un mayor riesgo de desarrollar tumores cutáneos. También puede observarse telangiectasia, pero no otras anomalías clínicas. Los pacientes se presentan en la infancia o la niñez, el modo de herencia es autosómico recesivo.


El síndrome de sensibilidad a los rayos UV-1 es un trastorno autosómico recesivo que se caracteriza por la fotosensibilidad cutánea y la aparición de pecas leves, sin un mayor riesgo de tumores cutáneos. Las células de los pacientes muestran una recuperación alterada de la síntesis de ARN (RRS) tras la irradiación UV debido a una reparación preferente defectuosa del daño en el ADN en los genes que transcriben activamente, aunque la reparación no programada del ADN es normal. Los hallazgos celulares son consistentes con un defecto en la reparación por escisión de nucleótidos acoplada a la transcripción (TC-NER) del daño por UV.


NM_000124.3(ERCC6):c.207dup ; NM_000124.3(ERCC6):c.1550G>A ; NM_000124.3(ERCC6):c.3862C>T ; c.2587C>T ; NM_000124.3(ERCC6):c.422+1G>A ; NM_000124.3(ERCC6):c.1357C>T ; NM_000124.3(ERCC6):c.2203C>T ; NM_000124.3(ERCC6):c.3591_3592dup ; NM_000124.3(ERCC6):c.2047C>T ; c.48_49del ; NM_000124.3(ERCC6):c.207dup ; NM_000124.3(ERCC6):c.1550G>A ; NM_000124.3(ERCC6):c.3862C>T ; c.2587C>T ; NM_000124.3(ERCC6):c.422+1G>A ; NM_000124.3(ERCC6):c.1357C>T ; NM_000124.3(ERCC6):c.2203C>T ; NM_000124.3(ERCC6):c.3591_3592dup ; NM_000124.3(ERCC6):c.2047C>T ; c.48_49del



Síndrome de Cockayne tipo 1

El síndrome de Cockayne (SC) es una enfermedad multisistémica caracterizada por una estatura baja, un aspecto facial característico, envejecimiento prematuro, fotosensibilidad, disfunción neurológica progresiva y déficit intelectual.


La gravedad de la enfermedad y la edad de aparición son variables. En el SC clásico de tipo I, los primeros síntomas suelen aparecer durante el primer año de vida. También se han descrito casos de inicio temprano con síntomas más graves (tipo II) y casos de inicio tardío con síntomas más leves (tipo III). Entre los signos más comunes de la enfermedad se encuentran el retraso progresivo del crecimiento, el déficit intelectual, la ataxia cerebelosa, la espasticidad, la neuropatía desmielinizante periférica, la retinopatía pigmentaria, la pérdida auditiva neurosensorial y las anomalías dentales (presencia de caries). El aspecto facial típico incluye microcefalia, orejas grandes, nariz fina y enoftalmia. En algunos pacientes se observan cataratas y fotosensibilidad cutánea. La lipoatrofia subcutánea está presente y puede dar lugar a signos de envejecimiento prematuro de la piel. El síndrome COFS (véase este término) es la forma prenatal extrema del espectro clínico del SC, caracterizada por microftalmia congénita y artrogriposis.

Síndrome de Cockayne tipo 2

El síndrome de Cockayne (SC) es una enfermedad multisistémica caracterizada por una estatura baja, un aspecto facial característico, envejecimiento prematuro, fotosensibilidad, disfunción neurológica progresiva y déficit intelectual.


La gravedad de la enfermedad y la edad de aparición son variables. En el SC clásico de tipo I, los primeros síntomas suelen aparecer durante el primer año de vida. También se han descrito casos de inicio temprano con síntomas más graves (tipo II) y casos de inicio tardío con síntomas más leves (tipo III). Entre los signos más comunes de la enfermedad se encuentran el retraso progresivo del crecimiento, el déficit intelectual, la ataxia cerebelosa, la espasticidad, la neuropatía desmielinizante periférica, la retinopatía pigmentaria, la pérdida auditiva neurosensorial y las anomalías dentales (presencia de caries). El aspecto facial típico incluye microcefalia, orejas grandes, nariz fina y enoftalmia. En algunos pacientes se observan cataratas y fotosensibilidad cutánea. La lipoatrofia subcutánea está presente y puede dar lugar a signos de envejecimiento prematuro de la piel. El síndrome COFS (véase este término) es la forma prenatal extrema del espectro clínico del SC, caracterizada por microftalmia congénita y artrogriposis.

Síndrome de Cockayne tipo 3

El síndrome de Cockayne (SC) es una enfermedad multisistémica caracterizada por una estatura baja, un aspecto facial característico, envejecimiento prematuro, fotosensibilidad, disfunción neurológica progresiva y déficit intelectual.


La gravedad de la enfermedad y la edad de aparición son variables. En el SC clásico de tipo I, los primeros síntomas suelen aparecer durante el primer año de vida. También se han descrito casos de inicio temprano con síntomas más graves (tipo II) y casos de inicio tardío con síntomas más leves (tipo III). Entre los signos más comunes de la enfermedad se encuentran el retraso progresivo del crecimiento, el déficit intelectual, la ataxia cerebelosa, la espasticidad, la neuropatía desmielinizante periférica, la retinopatía pigmentaria, la pérdida auditiva neurosensorial y las anomalías dentales (presencia de caries). El aspecto facial típico incluye microcefalia, orejas grandes, nariz fina y enoftalmia. En algunos pacientes se observan cataratas y fotosensibilidad cutánea. La lipoatrofia subcutánea está presente y puede dar lugar a signos de envejecimiento prematuro de la piel. El síndrome COFS (véase este término) es la forma prenatal extrema del espectro clínico del SC, caracterizada por microftalmia congénita y artrogriposis.

Síndrome de sensibilidad a los rayos UV

Fotodermatosis rara que se caracteriza por una fotosensibilidad cutánea y una ligera despigmentación, sin un mayor riesgo de desarrollar tumores cutáneos. También puede observarse telangiectasia, pero no otras anomalías clínicas. Los pacientes se presentan en la infancia o la niñez, el modo de herencia es autosómico recesivo.


El síndrome de sensibilidad a los rayos UV-1 es un trastorno autosómico recesivo que se caracteriza por la fotosensibilidad cutánea y la aparición de pecas leves, sin un mayor riesgo de tumores cutáneos. Las células de los pacientes muestran una recuperación alterada de la síntesis de ARN (RRS) tras la irradiación UV debido a una reparación preferente defectuosa del daño en el ADN en los genes que transcriben activamente, aunque la reparación no programada del ADN es normal. Los hallazgos celulares son consistentes con un defecto en la reparación por escisión de nucleótidos acoplada a la transcripción (TC-NER) del daño por UV.


NM_000082.3(ERCC8):c.37G>T ; NM_000082.3:c.966C>A ; c.593_594dup ; NM_000082.3(ERCC8):c.618-1G>A ; NM_000082.3(ERCC8):c.37G>T ; NM_000082.3:c.966C>A ; c.593_594dup ; NM_000082.3(ERCC8):c.618-1G>A



Síndrome de Roberts

El síndrome de Roberts (RBS) se caracteriza por un retraso del crecimiento pre y postnatal, defectos graves de reducción simétrica de las extremidades, anomalías craneofaciales y déficit intelectual grave. La focomelia del SC es una forma más leve del SBR.


Los miembros superiores se ven afectados con mayor frecuencia y gravedad que los inferiores. El defecto es mayoritariamente mesomélico, siendo el radio el más afectado en los miembros superiores y el peroné en los inferiores. Los defectos más graves dan lugar a la focomelia. También pueden producirse pulgares aplásicos o hipoplásicos, oligodactilia, clinodactilia o sindactilia. Las anomalías craneofaciales incluyen microcefalia (más grave en los varones que en las mujeres), alas nasales hipoplásicas, hipoplasia malar, hipertelorismo, micrognatia, hemangioma capilar, exoftalmos, fisuras palpebrales inclinadas hacia abajo, orejas displásicas o pequeñas, córnea nublada o cataratas, y labio y paladar hendido. Existe una correlación entre el grado de malformaciones de las extremidades y de la cara. Pueden aparecer otras malformaciones como defectos cardíacos congénitos, riñón quístico y genitales grandes (falo o clítoris agrandados). En los pacientes que sobreviven al periodo neonatal se observa un grave déficit intelectual.


NM_001017420.2(ESCO2):c.308_309delAA ; NM_001017420.2(ESCO2):c.505C>T ; NM_001017420.2(ESCO2):c.604C>T ; c.296_297dup ; NM_001017420.2(ESCO2):c.1615T>G ; NM_001017420.2(ESCO2):c.875_878delACAG ; NM_001017420.2(ESCO2):c.879_880delAG ; NM_001017420.3(ESCO2):c.1597dup ; NM_001017420.2(ESCO2):c.1269G>A ; NM_001017420.2(ESCO2):c.308_309delAA ; NM_001017420.2(ESCO2):c.505C>T ; NM_001017420.2(ESCO2):c.604C>T ; c.296_297dup ; NM_001017420.2(ESCO2):c.1615T>G ; NM_001017420.2(ESCO2):c.875_878delACAG ; NM_001017420.2(ESCO2):c.879_880delAG ; NM_001017420.3(ESCO2):c.1597dup ; NM_001017420.2(ESCO2):c.1269G>A



Deficiencia múltiple de acil-CoA deshidrogenasa, tipo leve

La deficiencia múltiple de deshidrogenación de acil-CoA (MADD) es un trastorno de la oxidación de ácidos grasos y aminoácidos y es un trastorno clínicamente heterogéneo que va desde una presentación neonatal grave con acidosis metabólica, cardiomiopatía y enfermedad hepática, hasta una enfermedad leve de la infancia/adulto con descompensación metabólica episódica, debilidad muscular e insuficiencia respiratoria.


Los pacientes con MADD se clasifican en 3 amplios fenotipos clínicos 1) inicio neonatal con anomalías congénitas, 2) inicio neonatal sin anomalías, (denominados conjuntamente MADD-severa (S); véase este término) y 3) inicio leve y/o tardío (MADD-leve (M); véase este término). El primer grupo de pacientes con MADD-S suele ser prematuro y presenta hipoglucemia no cetósica grave, hipotonía, hepatomegalia y acidosis metabólica grave en las primeras 24 horas de vida. Suelen tener riñones displásicos con múltiples quistes y también pueden presentar dismorfismo facial (orejas de implantación baja, frente alta, hipertelorismo y cara media hipoplásica), pies de balancín y anomalías de los genitales externos. La muerte suele producirse en la primera semana de vida. El segundo grupo de pacientes suele presentarse en las primeras 24-48 horas de vida con hipotonía, taquipnea, hepatomegalia, acidosis metabólica e hipoglucemia hipocetósica. La mayoría mueren durante la(s) primera(s) semana(s) de vida, pero algunos han sobrevivido durante varios meses, muriendo normalmente con una cardiomiopatía grave. Los pacientes con MADD-M muestran un amplio espectro clínico de la enfermedad que va desde la aparición de episodios intermitentes de vómitos, acidosis metabólica e hipoglucemia hipocetósica (+/- afectación cardíaca) durante los primeros meses de vida hasta la presentación en adolescentes/adultos con enfermedad aguda tipo Reye con cetoacidosis y miopatía por almacenamiento de lípidos. Este último subgrupo suele responder a dosis farmacológicas de riboflavina (rr-MADD).

Deficiencia múltiple de acil-CoA deshidrogenasa, tipo neonatal grave

La deficiencia múltiple de deshidrogenación de acil-CoA (MADD) es un trastorno de la oxidación de ácidos grasos y aminoácidos y es un trastorno clínicamente heterogéneo que va desde una presentación neonatal grave con acidosis metabólica, cardiomiopatía y enfermedad hepática, hasta una enfermedad leve en la infancia/adulto con descompensación metabólica episódica, debilidad muscular e insuficiencia respiratoria.


Los pacientes con MADD se clasifican en 3 amplios fenotipos clínicos: 1) inicio neonatal con anomalías congénitas, 2) inicio neonatal sin anomalías, (denominados conjuntamente MADD-severa (S); véase este término) y 3) inicio leve y/o tardío (MADD-leve (M); véase este término). El primer grupo de pacientes con MADD-S suele ser prematuro y presenta hipoglucemia no cetósica grave, hipotonía, hepatomegalia y acidosis metabólica grave en las primeras 24 horas de vida. Suelen tener riñones displásicos con múltiples quistes y también pueden presentar dismorfismo facial (orejas de implantación baja, frente alta, hipertelorismo y cara media hipoplásica), pies de balancín y anomalías de los genitales externos. La muerte suele producirse en la primera semana de vida. El segundo grupo de pacientes suele presentarse en las primeras 24-48 horas de vida con hipotonía, taquipnea, hepatomegalia, acidosis metabólica e hipoglucemia hipocetósica. La mayoría mueren durante la(s) primera(s) semana(s) de vida, pero algunos han sobrevivido durante varios meses, muriendo normalmente con una cardiomiopatía grave. Los pacientes con MADD-M muestran un amplio espectro clínico de la enfermedad que va desde la aparición de episodios intermitentes de vómitos, acidosis metabólica e hipoglucemia hipocetósica (+/- afectación cardíaca) durante los primeros meses de vida hasta la presentación en adolescentes/adultos con enfermedad aguda tipo Reye con cetoacidosis y miopatía por almacenamiento de lípidos. Este último subgrupo suele responder a dosis farmacológicas de riboflavina (rr-MADD).


NM_000126.3(ETFA):c.470T>G ; NM_000126.3(ETFA):c.797C>T ; NM_000126.3(ETFA):c.470T>G ; NM_000126.3(ETFA):c.797C>T



Deficiencia múltiple de acil-CoA deshidrogenasa, tipo leve

La deficiencia múltiple de deshidrogenación de acil-CoA (MADD) es un trastorno de la oxidación de ácidos grasos y aminoácidos y es un trastorno clínicamente heterogéneo que va desde una presentación neonatal grave con acidosis metabólica, cardiomiopatía y enfermedad hepática, hasta una enfermedad leve de la infancia/adulto con descompensación metabólica episódica, debilidad muscular e insuficiencia respiratoria.


Los pacientes con MADD se clasifican en 3 amplios fenotipos clínicos 1) inicio neonatal con anomalías congénitas, 2) inicio neonatal sin anomalías, (denominados conjuntamente MADD-severa (S); véase este término) y 3) inicio leve y/o tardío (MADD-leve (M); véase este término). El primer grupo de pacientes con MADD-S suele ser prematuro y presenta hipoglucemia no cetósica grave, hipotonía, hepatomegalia y acidosis metabólica grave en las primeras 24 horas de vida. Suelen tener riñones displásicos con múltiples quistes y también pueden presentar dismorfismo facial (orejas de implantación baja, frente alta, hipertelorismo y cara media hipoplásica), pies de balancín y anomalías de los genitales externos. La muerte suele producirse en la primera semana de vida. El segundo grupo de pacientes suele presentarse en las primeras 24-48 horas de vida con hipotonía, taquipnea, hepatomegalia, acidosis metabólica e hipoglucemia hipocetósica. La mayoría mueren durante la(s) primera(s) semana(s) de vida, pero algunos han sobrevivido durante varios meses, muriendo normalmente con una cardiomiopatía grave. Los pacientes con MADD-M muestran un amplio espectro clínico de la enfermedad que va desde la aparición de episodios intermitentes de vómitos, acidosis metabólica e hipoglucemia hipocetósica (+/- afectación cardíaca) durante los primeros meses de vida hasta la presentación en adolescentes/adultos con enfermedad aguda tipo Reye con cetoacidosis y miopatía por almacenamiento de lípidos. Este último subgrupo suele responder a dosis farmacológicas de riboflavina (rr-MADD).

Deficiencia múltiple de acil-CoA deshidrogenasa, tipo neonatal grave

La deficiencia múltiple de deshidrogenación de acil-CoA (MADD) es un trastorno de la oxidación de ácidos grasos y aminoácidos y es un trastorno clínicamente heterogéneo que va desde una presentación neonatal grave con acidosis metabólica, cardiomiopatía y enfermedad hepática, hasta una enfermedad leve en la infancia/adulto con descompensación metabólica episódica, debilidad muscular e insuficiencia respiratoria.


Los pacientes con MADD se clasifican en 3 amplios fenotipos clínicos: 1) inicio neonatal con anomalías congénitas, 2) inicio neonatal sin anomalías, (denominados conjuntamente MADD-severa (S); véase este término) y 3) inicio leve y/o tardío (MADD-leve (M); véase este término). El primer grupo de pacientes con MADD-S suele ser prematuro y presenta hipoglucemia no cetósica grave, hipotonía, hepatomegalia y acidosis metabólica grave en las primeras 24 horas de vida. Suelen tener riñones displásicos con múltiples quistes y también pueden presentar dismorfismo facial (orejas de implantación baja, frente alta, hipertelorismo y cara media hipoplásica), pies de balancín y anomalías de los genitales externos. La muerte suele producirse en la primera semana de vida. El segundo grupo de pacientes suele presentarse en las primeras 24-48 horas de vida con hipotonía, taquipnea, hepatomegalia, acidosis metabólica e hipoglucemia hipocetósica. La mayoría mueren durante la(s) primera(s) semana(s) de vida, pero algunos han sobrevivido durante varios meses, muriendo normalmente con una cardiomiopatía grave. Los pacientes con MADD-M muestran un amplio espectro clínico de la enfermedad que va desde la aparición de episodios intermitentes de vómitos, acidosis metabólica e hipoglucemia hipocetósica (+/- afectación cardíaca) durante los primeros meses de vida hasta la presentación en adolescentes/adultos con enfermedad aguda tipo Reye con cetoacidosis y miopatía por almacenamiento de lípidos. Este último subgrupo suele responder a dosis farmacológicas de riboflavina (rr-MADD).


NM_001985.2:c.278_279insG ; c.61C>T ; NM_001985.2(ETFB):c.382G>A ; NM_001985.2(ETFB):c.491G>A ; NM_001985.2:c.278_279insG ; c.61C>T ; NM_001985.2(ETFB):c.382G>A ; NM_001985.2(ETFB):c.491G>A



Deficiencia múltiple de acil-CoA deshidrogenasa, tipo leve

La deficiencia múltiple de deshidrogenación de acil-CoA (MADD) es un trastorno de la oxidación de ácidos grasos y aminoácidos y es un trastorno clínicamente heterogéneo que va desde una presentación neonatal grave con acidosis metabólica, cardiomiopatía y enfermedad hepática, hasta una enfermedad leve de la infancia/adulto con descompensación metabólica episódica, debilidad muscular e insuficiencia respiratoria.


Los pacientes con MADD se clasifican en 3 amplios fenotipos clínicos 1) inicio neonatal con anomalías congénitas, 2) inicio neonatal sin anomalías, (denominados conjuntamente MADD-severa (S); véase este término) y 3) inicio leve y/o tardío (MADD-leve (M); véase este término). El primer grupo de pacientes con MADD-S suele ser prematuro y presenta hipoglucemia no cetósica grave, hipotonía, hepatomegalia y acidosis metabólica grave en las primeras 24 horas de vida. Suelen tener riñones displásicos con múltiples quistes y también pueden presentar dismorfismo facial (orejas de implantación baja, frente alta, hipertelorismo y cara media hipoplásica), pies de balancín y anomalías de los genitales externos. La muerte suele producirse en la primera semana de vida. El segundo grupo de pacientes suele presentarse en las primeras 24-48 horas de vida con hipotonía, taquipnea, hepatomegalia, acidosis metabólica e hipoglucemia hipocetósica. La mayoría mueren durante la(s) primera(s) semana(s) de vida, pero algunos han sobrevivido durante varios meses, muriendo normalmente con una cardiomiopatía grave. Los pacientes con MADD-M muestran un amplio espectro clínico de la enfermedad que va desde la aparición de episodios intermitentes de vómitos, acidosis metabólica e hipoglucemia hipocetósica (+/- afectación cardíaca) durante los primeros meses de vida hasta la presentación en adolescentes/adultos con enfermedad aguda tipo Reye con cetoacidosis y miopatía por almacenamiento de lípidos. Este último subgrupo suele responder a dosis farmacológicas de riboflavina (rr-MADD).

Deficiencia múltiple de acil-CoA deshidrogenasa, tipo neonatal grave

La deficiencia múltiple de deshidrogenación de acil-CoA (MADD) es un trastorno de la oxidación de ácidos grasos y aminoácidos y es un trastorno clínicamente heterogéneo que va desde una presentación neonatal grave con acidosis metabólica, cardiomiopatía y enfermedad hepática, hasta una enfermedad leve en la infancia/adulto con descompensación metabólica episódica, debilidad muscular e insuficiencia respiratoria.


Los pacientes con MADD se clasifican en 3 amplios fenotipos clínicos: 1) inicio neonatal con anomalías congénitas, 2) inicio neonatal sin anomalías, (denominados conjuntamente MADD-severa (S); véase este término) y 3) inicio leve y/o tardío (MADD-leve (M); véase este término). El primer grupo de pacientes con MADD-S suele ser prematuro y presenta hipoglucemia no cetósica grave, hipotonía, hepatomegalia y acidosis metabólica grave en las primeras 24 horas de vida. Suelen tener riñones displásicos con múltiples quistes y también pueden presentar dismorfismo facial (orejas de implantación baja, frente alta, hipertelorismo y cara media hipoplásica), pies de balancín y anomalías de los genitales externos. La muerte suele producirse en la primera semana de vida. El segundo grupo de pacientes suele presentarse en las primeras 24-48 horas de vida con hipotonía, taquipnea, hepatomegalia, acidosis metabólica e hipoglucemia hipocetósica. La mayoría mueren durante la(s) primera(s) semana(s) de vida, pero algunos han sobrevivido durante varios meses, muriendo normalmente con una cardiomiopatía grave. Los pacientes con MADD-M muestran un amplio espectro clínico de la enfermedad que va desde la aparición de episodios intermitentes de vómitos, acidosis metabólica e hipoglucemia hipocetósica (+/- afectación cardíaca) durante los primeros meses de vida hasta la presentación en adolescentes/adultos con enfermedad aguda tipo Reye con cetoacidosis y miopatía por almacenamiento de lípidos. Este último subgrupo suele responder a dosis farmacológicas de riboflavina (rr-MADD).


NM_004453.3(ETFDH):c.1001T>C ; NM_004453.3(ETFDH):c.524G>T ; NM_004453.3(ETFDH):c.1832G>A ; NM_004453.3(ETFDH):c.1367C>T ; NM_004453.3(ETFDH):c.2T>C ; NM_004453.3(ETFDH):c.1234G>T ; NM_004453.3(ETFDH):c.1823delG ; NM_004453.3(ETFDH):c.250G>A ; NM_004453.3(ETFDH):c.1570_1571delCT ; NM_004453.3(ETFDH):c.413T>G ; NM_004453.3(ETFDH):c.1001T>C ; NM_004453.3(ETFDH):c.524G>T ; NM_004453.3(ETFDH):c.1832G>A ; NM_004453.3(ETFDH):c.1367C>T ; NM_004453.3(ETFDH):c.2T>C ; NM_004453.3(ETFDH):c.1234G>T ; NM_004453.3(ETFDH):c.1823delG ; NM_004453.3(ETFDH):c.250G>A ; NM_004453.3(ETFDH):c.1570_1571delCT ; NM_004453.3(ETFDH):c.413T>G



Encefalopatía etilmalónica

La encefalopatía por ácido etilmalónico (EE) se define por una elevada excreción de ácido etilmalónico (EMA) con petequias recurrentes, acrocianosis ortostática y diarrea crónica, asociada a un retraso en el neurodesarrollo, regresión psicomotora e hipotonía con anomalías en la resonancia magnética cerebral.


La enfermedad se manifiesta en el nacimiento o en los primeros meses de vida. Puede haber tetraplejia espástica. Además del aumento de la excreción de EMA, el ácido metilsuccínico y las acilglicinas C4-C6 (isobutiril-, isovaleril-, 2-metilbutiril-, hexanoilglicina) también pueden encontrarse en cantidades pequeñas, pero elevadas, en la orina. Los niveles sanguíneos de las C4-C6-carnitinas (butiril-, isobutiril-, isovaleril- y hexanoilcarnitina) pueden ser elevados.


NM_014297.4(ETHE1):c.604dup ; NM_014297.4(ETHE1):c.440_450delACAGCATGGCC ; NM_014297.3(ETHE1):c.487C>T ; NM_014297.3(ETHE1):c.488G>A ; NM_014297.4(ETHE1):c.221dupA ; NM_014297.4(ETHE1):c.554T>G ; NM_014297.4(ETHE1):c.604dup ; NM_014297.4(ETHE1):c.440_450delACAGCATGGCC ; NM_014297.3(ETHE1):c.487C>T ; NM_014297.3(ETHE1):c.488G>A ; NM_014297.4(ETHE1):c.221dupA ; NM_014297.4(ETHE1):c.554T>G



Retinitis pigmentaria

La retinosis pigmentaria (RP) es una distrofia hereditaria de la retina que conduce a la pérdida progresiva de los fotorreceptores y del epitelio pigmentario de la retina y que provoca la ceguera generalmente después de varias décadas.


La retinosis pigmentaria es lentamente progresiva pero implacable. Sin embargo, existe una amplia variabilidad en la edad de inicio, la tasa de progresión y las manifestaciones clínicas secundarias. Los individuos afectados suelen desarrollar primero ceguera nocturna (nictalopía) debido a la pérdida de la función de los bastones, a menudo en la adolescencia o antes. A continuación, desarrollan un deterioro del campo visual periférico y, con el tiempo, la pérdida de la visión central, normalmente en etapas tardías, a menudo en torno a la mediana edad. La pérdida de agudeza visual central puede producirse a cualquier edad como resultado de un edema macular cistoide o de la pérdida de fotorreceptores. Las cataratas subcapsulares posteriores son frecuentes y su gravedad depende de la edad. También puede encontrarse una reducción de la visión de los colores. El examen del fondo de ojo revela depósitos de pigmento de espícula ósea, vasos retinianos atenuados, atrofia de la retina y palidez del nervio óptico. La gravedad está parcialmente correlacionada con el patrón de herencia: los casos ligados al cromosoma X son los más graves, los casos autosómicos recesivos y de ocurrencia única tienen una gravedad intermedia, y los autosómicos dominantes son los más favorables.


c.8692_8695dup ; c.6170del ; NM_001142800.1(EYS):c.9405T>A ; c.6102dup ; c.571dup ; c.8632G>T ; c.7822C>T ; c.4597_4613del ; NM_001142800.1(EYS):c.490C>T ; c.4462_4469dup ; c.9362_9365del ; NM_001142800.1(EYS):c.4350_4356delTATAGCT ; NM_001142800.1(EYS):c.7095T>G ; NM_001142800.1(EYS):c.8648_8655del8 ; NM_001142800.1:c.8408dupA ; c.1211dupA ; NM_001142800.1(EYS):c.5928-2A>G ; NM_001142800.1(EYS):c.103C>T ; c.5757dup ; c.4120C>T ; NC_000006.12:g.65495181del ; c.9099del ; NM_001142800.1(EYS):c.4045C>T ; NM_001142800.1(EYS):c.5857G>T ; NM_001142800.1(EYS):c.2826_2827delAT ; c.8692_8695dup ; c.6170del ; NM_001142800.1(EYS):c.9405T>A ; c.6102dup ; c.571dup ; c.8632G>T ; c.7822C>T ; c.4597_4613del ; NM_001142800.1(EYS):c.490C>T ; c.4462_4469dup ; c.9362_9365del ; NM_001142800.1(EYS):c.4350_4356delTATAGCT ; NM_001142800.1(EYS):c.7095T>G ; NM_001142800.1(EYS):c.8648_8655del8 ; NM_001142800.1:c.8408dupA ; c.1211dupA ; NM_001142800.1(EYS):c.5928-2A>G ; NM_001142800.1(EYS):c.103C>T ; c.5757dup ; c.4120C>T ; NC_000006.12:g.65495181del ; c.9099del ; NM_001142800.1(EYS):c.4045C>T ; NM_001142800.1(EYS):c.5857G>T ; NM_001142800.1(EYS):c.2826_2827delAT



Deficiencia congénita del factor XI

Trastorno hemorrágico hereditario poco frecuente que se caracteriza por la reducción de los niveles y/o la actividad del factor XI (FXI), lo que da lugar a síntomas hemorrágicos moderados, que suelen producirse tras un traumatismo o una intervención quirúrgica.


La hemorragia puede manifestarse a cualquier edad, y suele producirse después de la circuncisión, las extracciones dentales, los traumatismos o la cirugía (en particular, la cirugía en las áreas otorrinolaringológica y urogenital). Los pacientes no suelen presentar hemorragias espontáneas, pero las mujeres pueden presentar menorragia. Las hemorragias suelen ser moderadas. Los pacientes no diagnosticados y no tratados pueden desarrollar hematomas importantes tras una intervención quirúrgica.


NM_000128.4:c.901T>C ; NM_000128.3(F11):c.1613C>T ; NM_000128.4:c.403G>T ; NM_000128.3(F11):c.1693G>A ; NM_000128.3(F11):c.438C>A ; NM_000128.3(F11):c.1211C>A ; NM_000128.3(F11):c.166T>C ; NM_000128.4:c.901T>C ; NM_000128.3(F11):c.1613C>T ; NM_000128.4:c.403G>T ; NM_000128.3(F11):c.1693G>A ; NM_000128.3(F11):c.438C>A ; NM_000128.3(F11):c.1211C>A ; NM_000128.3(F11):c.166T>C



Hemofilia A leve

La hemofilia A leve es una forma de hemofilia A (véase este término) caracterizada por una pequeña deficiencia de factor VIII que provoca hemorragias anormales como consecuencia de lesiones menores o tras una intervención quirúrgica o una extracción dental.


La actividad biológica del factor VIII se sitúa entre el 5 y el 40%. No se producen hemorragias espontáneas.

Hemofilia A moderadamente grave

La hemofilia A moderadamente grave es una forma de hemofilia A (véase este término) caracterizada por una deficiencia de factor VIII que provoca hemorragias anormales como consecuencia de lesiones menores o tras una intervención quirúrgica o una extracción dental.


La actividad biológica del factor VIII se sitúa entre el 1% y el 5%. Las hemorragias espontáneas son raras.

Hemofilia severa A

La hemofilia A grave es una forma de hemofilia A (véase este término) caracterizada por una gran deficiencia de factor VIII que provoca frecuentes hemorragias espontáneas y hemorragias anormales como consecuencia de lesiones menores, o tras una intervención quirúrgica o una extracción dental.


La actividad biológica del factor VIII es inferior al 1%.

Forma sintomática de hemofilia A en mujeres portadoras

La hemofilia A sintomática en mujeres portadoras es una forma de hemofilia A (véase este término) que se manifiesta en algunas mujeres con mutaciones en el gen F8 (Xq28), que codifica el factor VIII de coagulación.


Los síntomas incluyen hemorragias anormales como resultado de lesiones menores, o tras una cirugía o una extracción dental. Ocasionalmente pueden producirse hemorragias espontáneas.


NM_000132.3(F8):c.872A>G ; c.788-1G>C ; c.6130del ; c.3251C>G ; c.4339dup ; c.4382_4383del ; c.3152del ; c.1438_1439del ; c.6070dup ; NM_000132.3(F8):c.687_688delAG ; c.889del ; c.415C>T ; c.1941_1944del ; c.3833del ; c.985dup ; c.2373dup ; c.3053del ; c.4619del ; c.4935G>A ; c.446del ; c.355C>T ; NM_000132.3(F8):c.1630G>A ; c.3409_3410del ; c.4999del ; c.5243del ; c.1538-2A>T ; c.1165del ; c.4719_4729del ; c.4662_4663del ; c.3907_3911del ; c.3991_3992del ; c.1653T>G ; NM_000132.3(F8):c.6464_6465delAA ; c.63_64del ; c.4408G>T ; c.3385del ; c.3031A>T ; NM_000132.3(F8):c.5879G>T ; c.4035del ; NM_000132.3(F8):c.1293delG ; c.516del ; c.1904-1G>A ; c.6136dup ; c.3913C>T ; c.4474A>T ; c.616G>T ; c.4934G>A ; c.89del ; c.1990_1991del ; c.420T>A ; c.3735_3744delinsATTTCTTTTTCTTT ; c.3863dup ; c.4969C>T ; NM_000132.3(F8):c.404A>G ; c.5301C>A ; c.6089dup ; c.985del ; c.5348_5357del ; c.1357G>T ; c.5697del ; c.510del ; c.709C>T ; c.3624del ; c.3402del ; NM_000132.3(F8):c.943delG ; c.729del ; c.6120_6135del ; c.3607G>T ; c.566C>A ; c.4450del ; c.5964_5967dup ; c.3421C>T ; c.496-2A>G ; c.3417dup ; c.3298A>T ; c.4942C>T ; c.3982C>T ; c.4156C>T ; NM_000132.3(F8):c.907delG ; c.1996_1999dup ; c.560T>A ; NM_000132.3:c.770_771insCC ; c.628_635del ; c.6115+1G>A ; c.4006C>T ; c.169+1G>T ; NM_000132.3(F8):c.849delT ; c.3827C>G ; c.5343T>A ; c.392del ; c.3967C>T ; c.5254del ; c.120del ; c.1410_1413del ; c.173del ; c.2412_2421del ; c.4492del ; c.974_975del ; c.1925_1928del ; c.1675G>T ; c.6116-2A>G ; c.169+1G>A ; c.850G>T ; c.787+2T>C ; c.4895dup ; NM_000132.3(F8):c.986G>A ; c.4697_4701dup ; c.4430_4431del ; c.4926del ; c.3344del ; c.2409del ; c.3902del ; c.5220-1G>A ; c.3540del ; c.591G>A ; c.1338del ; c.3844A>T ; c.4658del ; NM_000132.3(F8):c.1952A>C ; c.519_523del ; c.6194G>A ; c.2404C>T ; NM_000132.3(F8):c.1988C>T ; c.4199del ; c.4549_4550del ; c.3964C>T ; c.1443+2T>C ; c.5689_5690del ; c.3500dup ; c.788-1G>A ; c.4339del ; c.1394C>G ; c.5010del ; c.4265_4266del ; c.3496A>T ; c.607del ; c.73del ; c.1336dup ; c.195C>A ; c.4922dup ; c.1189dup ; c.948_951del ; c.3631A>T ; c.525C>A ; c.935del ; c.1442_1443dup ; c.3565dup ; c.2058_2059del ; c.160_161del ; c.128dup ; c.4425_4426del ; c.5251A>T ; c.4841del ; c.4072C>T ; c.6078_6079del ; c.3651del ; c.3772del ; c.3302_3303del ; c.6250A>T ; c.4806del ; c.4094_4100del ; NM_000132.3(F8):c.6865C>T ; c.1A>G ; c.3371C>A ; c.3652del ; c.4687del ; c.4492_4496del ; c.4363C>T ; c.3203_3204del ; c.3493G>T ; c.1538-1G>T ; c.2384_2388del ; c.6099del ; c.4318del ; c.92del ; c.201_202dup ; c.335_336del ; c.2032A>T ; c.4694_4697del ; c.4814C>A ; c.2462_2463del ; NM_000132.3:c.3150_3151insTC ; c.4996C>T ; c.6084del ; c.1202G>A ; NM_000132.3(F8):c.3548_3549delAA ; c.3922G>T ; c.3736del ; c.5337del ; c.5675dup ; c.3860del ; c.4446dup ; c.2089_2090del ; c.452_462del ; c.4280del ; c.4345del ; c.4345G>T ; c.4542del ; c.4201C>T ; c.4242dup ; c.333del ; c.185C>G ; c.4460del ; NM_000132.3:c.514_515insTCAAGATA ; c.3300del ; c.871G>T ; NM_000132.3(F8):c.6263C>T ; c.482del ; NM_000132.3(F8):c.7031G>A ; c.4770T>A ; c.72del ; c.1175C>G ; c.1390G>T ; c.6253G>T ; c.3416_3417del ; NM_000132.3(F8):c.1596_1597insG ; c.796G>T ; c.3994_3997del ; c.5953del ; c.4519del ; c.472C>T ; c.2397del ; c.1203G>A ; c.465G>A ; c.5960_5961del ; c.1595G>A ; c.4895del ; c.5766C>A ; c.6116_6117del ; c.5696dup ; c.4561C>T ; c.4272del ; c.224del ; c.2419dup ; c.685_686del ; c.98G>A ; c.471G>A ; NM_000132.3(F8):c.4473C>A ; c.4712_4715del ; NM_000132.3(F8):c.1175C>A ; c.1560del ; NM_000132.3(F8):c.6016G>T ; c.4918G>T ; c.3490del ; c.1311del ; c.5923dup ; c.495+1G>A ; c.5914_5915del ; c.680G>A ; c.4987A>T ; c.6120T>A ; c.3984dup ; c.4483del ; c.4483G>T ; NM_000132.3:c.1440_1441insA ; c.4473C>G ; c.2338del ; c.4686del ; c.4103del ; NM_000132.3(F8):c.2029T>C ; c.1200_1201del ; c.4805_4806del ; c.1947_1950del ; c.4798A>T ; NM_000132.3(F8):c.6912_6916delAAATC ; NM_000132.3(F8):c.4858delC ; c.3224del ; NM_000132.3(F8):c.493C>T ; c.6273+1G>A ; NM_000132.3(F8):c.1214T>G ; c.4899del ; c.60del ; c.5227_5228del ; c.4241C>A ; c.5869C>T ; c.5752del ; c.788-1G>T ; c.96del ; c.2000del ; c.919del ; c.4423C>T ; c.4512del ; c.2360del ; NM_000132.3(F8):c.5719_5720insA ; c.1596G>A ; c.3505del ; c.5271del ; c.6115+2T>C ; c.583del ; c.695_698del ; c.4848del ; c.3887del ; c.3830del ; c.3168_3187del ; NM_000132.3(F8):c.1075_1078delAATG ; c.1996_1999del ; c.3710del ; NM_000132.3(F8):c.832G>A ; c.1331_1332del ; c.3766G>T ; c.514_515del ; c.3851_3852del ; c.1443+1G>A ; NM_000132.3(F8):c.1726G>T ; c.3756del ; NM_000132.3(F8):c.4293_4297delCTCTT ; c.355del ; c.334G>T ; c.4720del ; c.4543_4544delinsA ; c.2102_2106del ; c.4492_4493del ; NM_000132.3(F8):c.1078_1079delGA ; c.421G>T ; c.265+1G>T ; NM_000132.3(F8):c.6533G>A ; c.4672_4675del ; c.3255_3258del ; c.64_65del ; c.3289C>T ; NM_000132.3(F8):c.199_200delAA ; c.143+1G>A ; NM_000132.3(F8):c.822G>A ; c.788-2A>T ; NM_000132.3(F8):c.872A>G ; c.788-1G>C ; c.6130del ; c.3251C>G ; c.4339dup ; c.4382_4383del ; c.3152del ; c.1438_1439del ; c.6070dup ; NM_000132.3(F8):c.687_688delAG ; c.889del ; c.415C>T ; c.1941_1944del ; c.3833del ; c.985dup ; c.2373dup ; c.3053del ; c.4619del ; c.4935G>A ; c.446del ; c.355C>T ; NM_000132.3(F8):c.1630G>A ; c.3409_3410del ; c.4999del ; c.5243del ; c.1538-2A>T ; c.1165del ; c.4719_4729del ; c.4662_4663del ; c.3907_3911del ; c.3991_3992del ; c.1653T>G ; NM_000132.3(F8):c.6464_6465delAA ; c.63_64del ; c.4408G>T ; c.3385del ; c.3031A>T ; NM_000132.3(F8):c.5879G>T ; c.4035del ; NM_000132.3(F8):c.1293delG ; c.516del ; c.1904-1G>A ; c.6136dup ; c.3913C>T ; c.4474A>T ; c.616G>T ; c.4934G>A ; c.89del ; c.1990_1991del ; c.420T>A ; c.3735_3744delinsATTTCTTTTTCTTT ; c.3863dup ; c.4969C>T ; NM_000132.3(F8):c.404A>G ; c.5301C>A ; c.6089dup ; c.985del ; c.5348_5357del ; c.1357G>T ; c.5697del ; c.510del ; c.709C>T ; c.3624del ; c.3402del ; NM_000132.3(F8):c.943delG ; c.729del ; c.6120_6135del ; c.3607G>T ; c.566C>A ; c.4450del ; c.5964_5967dup ; c.3421C>T ; c.496-2A>G ; c.3417dup ; c.3298A>T ; c.4942C>T ; c.3982C>T ; c.4156C>T ; NM_000132.3(F8):c.907delG ; c.1996_1999dup ; c.560T>A ; NM_000132.3:c.770_771insCC ; c.628_635del ; c.6115+1G>A ; c.4006C>T ; c.169+1G>T ; NM_000132.3(F8):c.849delT ; c.3827C>G ; c.5343T>A ; c.392del ; c.3967C>T ; c.5254del ; c.120del ; c.1410_1413del ; c.173del ; c.2412_2421del ; c.4492del ; c.974_975del ; c.1925_1928del ; c.1675G>T ; c.6116-2A>G ; c.169+1G>A ; c.850G>T ; c.787+2T>C ; c.4895dup ; NM_000132.3(F8):c.986G>A ; c.4697_4701dup ; c.4430_4431del ; c.4926del ; c.3344del ; c.2409del ; c.3902del ; c.5220-1G>A ; c.3540del ; c.591G>A ; c.1338del ; c.3844A>T ; c.4658del ; NM_000132.3(F8):c.1952A>C ; c.519_523del ; c.6194G>A ; c.2404C>T ; NM_000132.3(F8):c.1988C>T ; c.4199del ; c.4549_4550del ; c.3964C>T ; c.1443+2T>C ; c.5689_5690del ; c.3500dup ; c.788-1G>A ; c.4339del ; c.1394C>G ; c.5010del ; c.4265_4266del ; c.3496A>T ; c.607del ; c.73del ; c.1336dup ; c.195C>A ; c.4922dup ; c.1189dup ; c.948_951del ; c.3631A>T ; c.525C>A ; c.935del ; c.1442_1443dup ; c.3565dup ; c.2058_2059del ; c.160_161del ; c.128dup ; c.4425_4426del ; c.5251A>T ; c.4841del ; c.4072C>T ; c.6078_6079del ; c.3651del ; c.3772del ; c.3302_3303del ; c.6250A>T ; c.4806del ; c.4094_4100del ; NM_000132.3(F8):c.6865C>T ; c.1A>G ; c.3371C>A ; c.3652del ; c.4687del ; c.4492_4496del ; c.4363C>T ; c.3203_3204del ; c.3493G>T ; c.1538-1G>T ; c.2384_2388del ; c.6099del ; c.4318del ; c.92del ; c.201_202dup ; c.335_336del ; c.2032A>T ; c.4694_4697del ; c.4814C>A ; c.2462_2463del ; NM_000132.3:c.3150_3151insTC ; c.4996C>T ; c.6084del ; c.1202G>A ; NM_000132.3(F8):c.3548_3549delAA ; c.3922G>T ; c.3736del ; c.5337del ; c.5675dup ; c.3860del ; c.4446dup ; c.2089_2090del ; c.452_462del ; c.4280del ; c.4345del ; c.4345G>T ; c.4542del ; c.4201C>T ; c.4242dup ; c.333del ; c.185C>G ; c.4460del ; NM_000132.3:c.514_515insTCAAGATA ; c.3300del ; c.871G>T ; NM_000132.3(F8):c.6263C>T ; c.482del ; NM_000132.3(F8):c.7031G>A ; c.4770T>A ; c.72del ; c.1175C>G ; c.1390G>T ; c.6253G>T ; c.3416_3417del ; NM_000132.3(F8):c.1596_1597insG ; c.796G>T ; c.3994_3997del ; c.5953del ; c.4519del ; c.472C>T ; c.2397del ; c.1203G>A ; c.465G>A ; c.5960_5961del ; c.1595G>A ; c.4895del ; c.5766C>A ; c.6116_6117del ; c.5696dup ; c.4561C>T ; c.4272del ; c.224del ; c.2419dup ; c.685_686del ; c.98G>A ; c.471G>A ; NM_000132.3(F8):c.4473C>A ; c.4712_4715del ; NM_000132.3(F8):c.1175C>A ; c.1560del ; NM_000132.3(F8):c.6016G>T ; c.4918G>T ; c.3490del ; c.1311del ; c.5923dup ; c.495+1G>A ; c.5914_5915del ; c.680G>A ; c.4987A>T ; c.6120T>A ; c.3984dup ; c.4483del ; c.4483G>T ; NM_000132.3:c.1440_1441insA ; c.4473C>G ; c.2338del ; c.4686del ; c.4103del ; NM_000132.3(F8):c.2029T>C ; c.1200_1201del ; c.4805_4806del ; c.1947_1950del ; c.4798A>T ; NM_000132.3(F8):c.6912_6916delAAATC ; NM_000132.3(F8):c.4858delC ; c.3224del ; NM_000132.3(F8):c.493C>T ; c.6273+1G>A ; NM_000132.3(F8):c.1214T>G ; c.4899del ; c.60del ; c.5227_5228del ; c.4241C>A ; c.5869C>T ; c.5752del ; c.788-1G>T ; c.96del ; c.2000del ; c.919del ; c.4423C>T ; c.4512del ; c.2360del ; NM_000132.3(F8):c.5719_5720insA ; c.1596G>A ; c.3505del ; c.5271del ; c.6115+2T>C ; c.583del ; c.695_698del ; c.4848del ; c.3887del ; c.3830del ; c.3168_3187del ; NM_000132.3(F8):c.1075_1078delAATG ; c.1996_1999del ; c.3710del ; NM_000132.3(F8):c.832G>A ; c.1331_1332del ; c.3766G>T ; c.514_515del ; c.3851_3852del ; c.1443+1G>A ; NM_000132.3(F8):c.1726G>T ; c.3756del ; NM_000132.3(F8):c.4293_4297delCTCTT ; c.355del ; c.334G>T ; c.4720del ; c.4543_4544delinsA ; c.2102_2106del ; c.4492_4493del ; NM_000132.3(F8):c.1078_1079delGA ; c.421G>T ; c.265+1G>T ; NM_000132.3(F8):c.6533G>A ; c.4672_4675del ; c.3255_3258del ; c.64_65del ; c.3289C>T ; NM_000132.3(F8):c.199_200delAA ; c.143+1G>A ; NM_000132.3(F8):c.822G>A ; c.788-2A>T



Hemofilia B leve

La hemofilia B leve es una forma de hemofilia B (véase este término) caracterizada por una pequeña deficiencia de factor IX que provoca una hemorragia anormal como resultado de lesiones menores, o tras una cirugía o extracción dental.


La actividad biológica del factor IX se sitúa entre el 5 y el 40%. No se producen hemorragias espontáneas.

Hemofilia B moderadamente grave

La hemofilia B moderadamente grave es una forma de hemofilia B (véase este término) caracterizada por una deficiencia de factor IX que provoca hemorragias anormales como consecuencia de lesiones menores o tras una intervención quirúrgica o una extracción dental.


La actividad biológica del factor IX se sitúa entre el 1% y el 5%. Las hemorragias espontáneas son raras.

Hemofilia B grave

La hemofilia B grave es una forma de hemofilia B (véase este término) caracterizada por una gran deficiencia de factor IX que provoca frecuentes hemorragias espontáneas y hemorragias anormales como consecuencia de lesiones menores, o tras una intervención quirúrgica o una extracción dental.


La actividad biológica del factor IX es inferior al 1%.

Forma sintomática de hemofilia B en mujeres portadoras

La hemofilia B sintomática en mujeres portadoras es una forma de hemofilia B (véase este término) que se manifiesta en algunas mujeres con mutaciones en el gen F9 (Xq28), que codifica el factor de coagulación IX.


Los síntomas incluyen hemorragias anormales como resultado de lesiones menores, o después de una cirugía o extracción de dientes. Ocasionalmente pueden producirse hemorragias espontáneas.


NM_000133.3(F9):c.1031T>C ; NM_000133.3(F9):c.79G>A ; NM_000133.3(F9):c.52T>C ; NM_000133.3(F9):c.1136G>A ; NM_000133.3(F9):c.82T>C ; NM_000133.3(F9):c.1150C>T ; NM_000133.3(F9):c.1031T>C ; NM_000133.3(F9):c.79G>A ; NM_000133.3(F9):c.52T>C ; NM_000133.3(F9):c.1136G>A ; NM_000133.3(F9):c.82T>C ; NM_000133.3(F9):c.1150C>T



Tirosinemia tipo 1

El síndrome de Walker-Warburg (WWS) es una forma rara de distrofia muscular congénita asociada a anomalías cerebrales y oculares.


La HT1 es clínicamente heterogénea. Los síntomas pueden comenzar durante los primeros meses (tipo agudo), en la segunda mitad del primer año (tipo subagudo) o en los años siguientes hasta la edad adulta (tipo crónico). En el tipo agudo, predominan las manifestaciones de insuficiencia hepática (diátesis hemorrágica, hipoglucemia, ascitis, etc.) con frecuentes sepsis y un rápido deterioro. Suele haber una enfermedad tubular proximal leve. El tipo subagudo presenta un cuadro clínico similar, pero menos grave, y suele presentar hepatomegalia o raquitismo hipofosfatémico (debido a la disfunción tubular). Las enfermedades intercurrentes pueden precipitar una crisis hepática. El tipo crónico se presenta con hepatomegalia secundaria a la cirrosis y, a menudo, tubulopatía, lo que conduce al raquitismo y a la insuficiencia renal. Las crisis neurológicas son síntomas de presentación poco frecuentes; sin embargo, pueden complicar cualquier tipo de la enfermedad cuando no se tratan. Las crisis se asemejan a las de la porfiria aguda intermitente, y se manifiestan con parestesias dolorosas (que hacen que los pacientes adopten una posición oftálmica, se automutilen), signos autonómicos (hipertensión, taquicardia, íleo) y descompensación respiratoria. Todos los pacientes tienen un alto riesgo de desarrollar un carcinoma hepatocelular (CHC) secundario a la cirrosis.


c.837+1G>A ; c.982C>T ; NM_000137.2(FAH):c.786G>A ; NM_000137.2(FAH):c.707-1G>A ; NM_000137.3:c.782C>T ; NM_000137.2(FAH):c.401C>A ; c.939del ; NM_000137.2(FAH):c.1027G>T ; NM_000137.2(FAH):c.1009G>A ; NM_000137.2(FAH):c.47A>T ; NM_000137.2(FAH):c.192G>T ; NM_000137.2(FAH):c.456G>A ; NM_000137.2(FAH):c.1062+5G>A ; NM_000137.2(FAH):c.554-1G>T ; NM_000137.2(FAH):c.1141A>G ; NM_000137.2(FAH):c.1090G>T ; NM_000137.2(FAH):c.1069G>T ; c.837+1G>A ; c.982C>T ; NM_000137.2(FAH):c.786G>A ; NM_000137.2(FAH):c.707-1G>A ; NM_000137.3:c.782C>T ; NM_000137.2(FAH):c.401C>A ; c.939del ; NM_000137.2(FAH):c.1027G>T ; NM_000137.2(FAH):c.1009G>A ; NM_000137.2(FAH):c.47A>T ; NM_000137.2(FAH):c.192G>T ; NM_000137.2(FAH):c.456G>A ; NM_000137.2(FAH):c.1062+5G>A ; NM_000137.2(FAH):c.554-1G>T ; NM_000137.2(FAH):c.1141A>G ; NM_000137.2(FAH):c.1090G>T ; NM_000137.2(FAH):c.1069G>T



Anemia de Fanconi

Se trata de un raro trastorno genético multisistémico caracterizado por pancitopenia progresiva con insuficiencia de la médula ósea, malformaciones congénitas variables y predisposición a desarrollar tumores hematológicos o sólidos.


Los primeros signos de la anemia de Fanconi (AF) suelen ser rasgos no hematológicos. Las anomalías de las extremidades suelen afectar a las mismas, son unilaterales o (normalmente asimétricas) bilaterales. También pueden presentarse anomalías menores, como baja talla y peso al nacer, microcefalia y/o microftalmia. Son frecuentes las anomalías en la pigmentación de la piel (manchas café con leche) y la hipoplasia de la eminencia tenar. Casi el 20% de los pacientes presentan malformaciones del oído con o sin pérdida de audición. Las malformaciones congénitas pueden afectar a otros sistemas orgánicos y variar dentro de las familias. La baja estatura es sindrómica y/o está asociada a endocrinopatías. La fertilidad se ve afectada con frecuencia en los varones y está muy alterada en la mitad de las mujeres. Cuando las malformaciones congénitas no son prominentes, el diagnóstico puede retrasarse hasta la aparición de anomalías hematológicas. La insuficiencia de la médula ósea (FMO) se produce a una edad media de 7 años, desarrollándose en el 90% de los pacientes a los 40 años. Las primeras manifestaciones son la macrocitosis (muy temprana) y la trombocitopenia. En los pacientes con mosaicismo somático, los recuentos sanguíneos pueden permanecer normales hasta la aparición de una neoplasia hematológica. En general, los pacientes tienen una gran predisposición a los tumores sólidos (con mayor frecuencia en la cabeza y el cuello o en las regiones anogenitales).


NM_000135.3(FANCA):c.2303T>C ; NM_000135.3(FANCA):c.3558dup ; NM_000135.4:c.3788_3790delTCT ; c.233_236del ; c.3763G>T ; c.4130C>G ; NM_000135.2(FANCA):c.1115_1118delTTGG ; NM_000135.3(FANCA):c.2303T>C ; NM_000135.3(FANCA):c.3558dup ; NM_000135.4:c.3788_3790delTCT ; c.233_236del ; c.3763G>T ; c.4130C>G ; NM_000135.2(FANCA):c.1115_1118delTTGG



Anemia de Fanconi

Se trata de un raro trastorno genético multisistémico caracterizado por pancitopenia progresiva con insuficiencia de la médula ósea, malformaciones congénitas variables y predisposición a desarrollar tumores hematológicos o sólidos.


Los primeros signos de la anemia de Fanconi (AF) suelen ser rasgos no hematológicos. Las anomalías de las extremidades suelen afectar a las mismas, son unilaterales o (normalmente asimétricas) bilaterales. También pueden presentarse anomalías menores, como baja talla y peso al nacer, microcefalia y/o microftalmia. Son frecuentes las anomalías en la pigmentación de la piel (manchas café con leche) y la hipoplasia de la eminencia tenar. Casi el 20% de los pacientes presentan malformaciones del oído con o sin pérdida de audición. Las malformaciones congénitas pueden afectar a otros sistemas orgánicos y variar dentro de las familias. La baja estatura es sindrómica y/o está asociada a endocrinopatías. La fertilidad se ve afectada con frecuencia en los varones y está muy alterada en la mitad de las mujeres. Cuando las malformaciones congénitas no son prominentes, el diagnóstico puede retrasarse hasta la aparición de anomalías hematológicas. La insuficiencia de la médula ósea (FMO) se produce a una edad media de 7 años, desarrollándose en el 90% de los pacientes a los 40 años. Las primeras manifestaciones son la macrocitosis (muy temprana) y la trombocitopenia. En los pacientes con mosaicismo somático, los recuentos sanguíneos pueden permanecer normales hasta la aparición de una neoplasia hematológica. En general, los pacientes tienen una gran predisposición a los tumores sólidos (con mayor frecuencia en la cabeza y el cuello o en las regiones anogenitales).


NM_000136.2(FANCC):c.1642C>T ; c.1015del ; NM_000136.2(FANCC):c.37C>T ; NM_000136.2(FANCC):c.67delG ; NM_000136.2(FANCC):c.1103_1104delTG ; NM_000136.2(FANCC):c.1487T>G ; NM_000136.2(FANCC):c.996+1G>T ; NM_000136.2(FANCC):c.1642C>T ; c.1015del ; NM_000136.2(FANCC):c.37C>T ; NM_000136.2(FANCC):c.67delG ; NM_000136.2(FANCC):c.1103_1104delTG ; NM_000136.2(FANCC):c.1487T>G ; NM_000136.2(FANCC):c.996+1G>T



Anemia de Fanconi

Se trata de un raro trastorno genético multisistémico caracterizado por pancitopenia progresiva con insuficiencia de la médula ósea, malformaciones congénitas variables y predisposición a desarrollar tumores hematológicos o sólidos.


Los primeros signos de la anemia de Fanconi (AF) suelen ser rasgos no hematológicos. Las anomalías de las extremidades suelen afectar a las mismas, son unilaterales o (normalmente asimétricas) bilaterales. También pueden presentarse anomalías menores, como baja talla y peso al nacer, microcefalia y/o microftalmia. Son frecuentes las anomalías en la pigmentación de la piel (manchas café con leche) y la hipoplasia de la eminencia tenar. Casi el 20% de los pacientes presentan malformaciones del oído con o sin pérdida de audición. Las malformaciones congénitas pueden afectar a otros sistemas orgánicos y variar dentro de las familias. La baja estatura es sindrómica y/o está asociada a endocrinopatías. La fertilidad se ve afectada con frecuencia en los varones y está muy alterada en la mitad de las mujeres. Cuando las malformaciones congénitas no son prominentes, el diagnóstico puede retrasarse hasta la aparición de anomalías hematológicas. La insuficiencia de la médula ósea (FMO) se produce a una edad media de 7 años, desarrollándose en el 90% de los pacientes a los 40 años. Las primeras manifestaciones son la macrocitosis (muy temprana) y la trombocitopenia. En los pacientes con mosaicismo somático, los recuentos sanguíneos pueden permanecer normales hasta la aparición de una neoplasia hematológica. En general, los pacientes tienen una gran predisposición a los tumores sólidos (con mayor frecuencia en la cabeza y el cuello o en las regiones anogenitales).


c.510+1G>A ; c.907_908dup ; NM_004629.1(FANCG):c.313G>T ; NM_004629.1(FANCG):c.1480+1G>C ; c.1795_1804del ; NM_004629.1(FANCG):c.1077-2A>G ; NM_004629.1(FANCG):c.637_643del ; c.510+1G>A ; c.907_908dup ; NM_004629.1(FANCG):c.313G>T ; NM_004629.1(FANCG):c.1480+1G>C ; c.1795_1804del ; NM_004629.1(FANCG):c.1077-2A>G ; NM_004629.1(FANCG):c.637_643del



Aciduria fumárica

La aciduria fumárica (AF), un trastorno metabólico autosómico recesivo, se caracteriza en la mayoría de los casos por una aparición temprana pero con signos clínicos inespecíficos: hipotonía, deterioro psicomotor grave, convulsiones, dificultad respiratoria, dificultades de alimentación y frecuentes malformaciones cerebrales, junto con una facies característica. Algunos pacientes presentan sólo un deterioro intelectual moderado.


Los recién nacidos suelen ser microcefálicos y pueden presentar dismorfismos faciales. La encefalopatía grave se manifiesta con mala alimentación, retraso en el desarrollo, hipotonía, letargo y ataques epilépticos. En los casos más graves, las puntuaciones de APGAR son bajas inmediatamente después del nacimiento, y pueden producirse bradicardia e insuficiencia respiratoria. La mayoría de los niños no consiguen fijar la vista y son incapaces de hablar o caminar. Los individuos menos gravemente afectados sobreviven más allá de la infancia, aunque la mayoría presenta un deterioro cognitivo moderado. Se ha informado de que algunos pacientes sólo presentan déficits cognitivos moderados. También se ha informado de un mayor riesgo de ciertos tumores, en particular la leiomiomatosis familiar (véase este término).

Leiomiomatosis hereditaria y cáncer de células renales

La leiomiomatosis hereditaria y el cáncer de células renales (HLRCC) es un síndrome canceroso hereditario caracterizado por una predisposición a los leiomiomas cutáneos y uterinos y, en algunas familias, al cáncer de células renales.


La aparición de la enfermedad puede producirse a cualquier edad, pero es más frecuente en adultos jóvenes y pacientes de edad avanzada. Los leiomiomas cutáneos benignos múltiples o únicos son comunes y suelen presentarse alrededor de los 25 años (rango de 10 a 47 años) como pápulas o nódulos firmes de color piel a marrón claro. Suelen localizarse en el tronco y las extremidades, pero a veces en la cara. Tienden a aumentar de tamaño y número con la edad y suelen ser sensibles al tacto y/o al frío y, en algunos, son dolorosos. Los leiomiomas uterinos (presentes en el 77% de las mujeres con HLRCC), también conocidos como fibromas, suelen aparecer alrededor de los 30 años, pero la edad de diagnóstico puede oscilar entre los 18 y los 52 años. Los síntomas de dolor pélvico y sangrado menstrual irregular o abundante suelen aparecer antes de que se descubran. Los tumores renales (edad media de presentación: 44 años) son menos frecuentes en este síndrome (10-16% de los casos) y pueden presentarse con dolor de espalda, aunque algunos pueden ser asintomáticos. Se trata principalmente de un carcinoma de células renales de tipo papilar II y suelen ser agresivos, a menudo progresando rápidamente hacia la enfermedad metastásica y la muerte.

Feocromocitoma-paraganglioma hereditario

Un tumor hereditario y poco frecuente de tipo feocromocitoma/paraganglioma que surge de las células cromafines neuroendocrinas de la médula suprarrenal (feocromocitoma) o de cualquier paraganglio desde la base del cráneo hasta el suelo pélvico (paraganglioma). Las manifestaciones clínicas suelen estar relacionadas con un exceso de producción de catecolaminas que provoca elevaciones sostenidas o paroxísticas de la presión arterial, dolor de cabeza, sudoración profusa episódica, palpitaciones, palidez y aprensión o ansiedad. Los tumores hereditarios de feocromocitoma/paraganglioma tienden a presentarse a edades más tempranas, a ser multifocales, bilaterales y recurrentes, o a tener múltiples neoplasias sincrónicas.




NM_000143.3(FH):c.1093A>G ; c.901dup ; NM_000143.3(FH):c.1293delA ; NM_000143.3(FH):c.1067T>A ; NM_000143.3(FH):c.697C>T ; NM_000143.3(FH):c.1236+1G>C ; NM_000143.3(FH):c.1446_1449delAAAG ; NM_000143.3(FH):c.1394A>G ; NM_000143.3(FH):c.760C>T ; NM_000143.3(FH):c.320A>C ; NM_000143.3(FH):c.793G>A ; NM_000143.3(FH):c.1255T>C ; NM_000143.3(FH):c.698G>A ; NM_000143.3(FH):c.1200delT ; NM_000143.3(FH):c.1189G>A ; NM_000143.3(FH):c.1093A>G ; c.901dup ; NM_000143.3(FH):c.1293delA ; NM_000143.3(FH):c.1067T>A ; NM_000143.3(FH):c.697C>T ; NM_000143.3(FH):c.1236+1G>C ; NM_000143.3(FH):c.1446_1449delAAAG ; NM_000143.3(FH):c.1394A>G ; NM_000143.3(FH):c.760C>T ; NM_000143.3(FH):c.320A>C ; NM_000143.3(FH):c.793G>A ; NM_000143.3(FH):c.1255T>C ; NM_000143.3(FH):c.698G>A ; NM_000143.3(FH):c.1200delT ; NM_000143.3(FH):c.1189G>A



Distrofia muscular congénita con afectación cerebelosa

La distrofia muscular congénita con afectación cerebelosa es una distrofia muscular congénita poco frecuente debida a una distroglicanopatía que se caracteriza por debilidad muscular proximal con tendencia a la hipertrofia y pseudohipertrofia muscular, deterioro cognitivo variable, microcefalia, hipoplasia cerebelosa con o sin quistes y otras anomalías estructurales del cerebro.


La distrofia muscular congénita-distroglicanopatía con anomalías cerebrales y oculares (tipo A), que incluye tanto el síndrome de Walker-Warburg (WWS), más grave, como la enfermedad músculo-ojo-cerebro (MEB), algo menos grave, es un trastorno autosómico recesivo con malformaciones cerebrales y oculares características, retraso mental profundo, distrofia muscular congénita y muerte, generalmente en los primeros años de vida. Representa el extremo más grave de un espectro fenotípico de trastornos similares resultantes de la glicosilación defectuosa de DAG1 (128239), conocidos colectivamente como "distroglicanopatías".

Distrofia muscular congénita con discapacidad intelectual

La MDDGB5 es una distrofia muscular congénita autosómica recesiva que presenta un retraso en el desarrollo intelectual y anomalías estructurales en el cerebro.


La distrofia muscular congénita con discapacidad intelectual es una distrofia muscular congénita rara, genética, debida a un trastorno de distroglicanopatía que se caracteriza por un amplio espectro fenotípico que incluye hipotonía y debilidad muscular presentes en el nacimiento o en la primera infancia y un desarrollo motor retrasado o detenido, asociado a una discapacidad intelectual de leve a grave y a anomalías cerebrales variables en los estudios de neuroimagen. Pueden asociarse dificultades de alimentación, deformidades articulares y de la columna vertebral, insuficiencia respiratoria y anomalías oculares (por ejemplo, estrabismo, distrofia de la retina, apraxia oculomotora). Se observa una disminución o ausencia de alfa-distroglicano en la tinción muscular inmunohistoquímica y una elevación de la creatina quinasa en suero.

Distrofia muscular congénita sin discapacidad intelectual

La MDDGB5 es una distrofia muscular congénita autosómica recesiva con un desarrollo intelectual deficiente y anomalías estructurales del cerebro.


La distrofia muscular congénita con discapacidad intelectual es una distrofia muscular congénita rara, genética, debida a un trastorno de distroglicanopatía que se caracteriza por un amplio espectro fenotípico que incluye hipotonía y debilidad muscular presentes en el nacimiento o en la primera infancia y un desarrollo motor retrasado o detenido, asociado a una discapacidad intelectual de leve a grave y a anomalías cerebrales variables en los estudios de neuroimagen. Pueden asociarse dificultades de alimentación, deformidades articulares y de la columna vertebral, insuficiencia respiratoria y anomalías oculares (por ejemplo, estrabismo, distrofia de la retina, apraxia oculomotora). Se observa una disminución o ausencia de alfa-distroglicano en la tinción muscular inmunohistoquímica y una elevación de la creatina quinasa en suero.

Distrofia muscular de cinturas relacionada con el FKRP R9

Una forma de distrofia muscular de cinturas de extremidades autosómica recesiva que presenta una edad de inicio muy variable y un espectro fenotípico caracterizado típicamente por una debilidad proximal lentamente progresiva de la musculatura de la cintura pélvica y de los hombros (que afecta predominantemente a las extremidades inferiores), frecuentemente asociada con marcha de pato, aleteo escapular, hipertrofia de pantorrillas y lengua, mialgia inducida por el ejercicio, debilidad muscular abdominal, cardiomiopatía, afectación de los músculos respiratorios y mioglobinuria y/o niveles séricos elevados de creatina-cinasa.


La edad de aparición está correlacionada con el genotipo y la expresión residual de la proteína relacionada con la fukutina. Así, los pacientes homocigotos para la mutación común y leve (c.826C>A) suelen tener un inicio en la tercera década, mientras que los pacientes heterocigotos compuestos para esta mutación tienen un inicio antes de los 10 años, y pierden la deambulación alrededor de los 20 años y necesitan ventilación asistida entre 5 y 10 años después. Los síntomas que se manifiestan comienzan en las extremidades inferiores, con dificultades para levantarse de una silla, subir escaleras y correr. Más tarde, la debilidad proximal comienza en los brazos, con un visible alabeo escapular. Cabe destacar que un tercio de los pacientes puede presentar mioglobinuria al realizar un esfuerzo físico, antes de que se note la debilidad. Los pacientes pueden desarrollar una cardiomiopatía que requiere tratamiento médico. En raros casos, se requiere un trasplante cardíaco. La fracción de eyección del ventrículo izquierdo disminuye una media del 0,4% al año. Los pacientes homocigotos para la mutación c.826C>A en FKRP pierden la deambulación alrededor de los 60 años y pueden necesitar ventilación asistida por la noche, pero el momento en que se producen estas pérdidas es muy variable.

Enfermedad músculo-ojo-cerebro

Distrofia muscular congénita poco frecuente debida a una distroglicanopatía que se caracteriza por una distrofia muscular de aparición temprana, hipotonía muscular grave, retraso mental severo y malformaciones cerebrales y oculares típicas, como paquigiria, polimicrogiria, agiria, anomalías estructurales del tronco cerebral y del cerebelo, miopía grave, glaucoma, hipoplasia del nervio óptico y de la retina. Los pacientes pueden presentar convulsiones, macrocefalia o microcefalia, microftalmia y contracturas congénitas. Dependiendo de la gravedad, se adquiere una función motora limitada. Se han descrito casos menos graves.


La distrofia muscular congénita-distroglicanopatía con anomalías cerebrales y oculares (tipo A), que incluye tanto el síndrome de Walker-Warburg (WWS), más grave, como la enfermedad músculo-ojo-cerebro (MEB), ligeramente menos grave, es un trastorno autosómico recesivo con malformaciones cerebrales y oculares características, retraso mental profundo, distrofia muscular congénita y muerte generalmente en los primeros años de vida. Representa el extremo más grave de un espectro fenotípico de trastornos similares resultantes de la glicosilación defectuosa de DAG1, conocidos colectivamente como "distroglicanopatías".

Síndrome de Walker-Warburg

Se trata de un raro trastorno genético del metabolismo del cobre que se presenta con manifestaciones hepáticas, neurológicas, psiquiátricas u oftalmológicas inespecíficas debido a la alteración de la excreción biliar de cobre y al consecuente depósito excesivo de cobre en el organismo.


Los pacientes se presentan al nacer con hipotonía severa generalizada, debilidad muscular, desarrollo psicomotor ausente o muy pobre, afectación ocular y convulsiones. La resonancia magnética cerebral muestra lisencefalia adoquinada de tipo II, hidrocefalia (véanse estos términos), hipoplasia severa del tronco cerebral y del cerebelo (es posible la malformación de Dandy-Walker, véase este término). También se observan anomalías en la materia blanca.


NM_024301.4(FKRP):c.1343C>T ; NM_000352.5:c.160C>T ; NM_024301.4(FKRP):c.1387A>G ; NM_024301.4(FKRP):c.1154C>A ; NM_024301.4(FKRP):c.1343C>T ; NM_000352.5:c.160C>T ; NM_024301.4(FKRP):c.1387A>G ; NM_024301.4(FKRP):c.1154C>A



Distrofia muscular congénita sin discapacidad intelectual

La MDDGB5 es una distrofia muscular congénita autosómica recesiva con un desarrollo intelectual deficiente y anomalías estructurales del cerebro.


La distrofia muscular congénita con discapacidad intelectual es una distrofia muscular congénita rara, genética, debida a un trastorno de distroglicanopatía que se caracteriza por un amplio espectro fenotípico que incluye hipotonía y debilidad muscular presentes en el nacimiento o en la primera infancia y un desarrollo motor retrasado o detenido, asociado a una discapacidad intelectual de leve a grave y a anomalías cerebrales variables en los estudios de neuroimagen. Pueden asociarse dificultades de alimentación, deformidades articulares y de la columna vertebral, insuficiencia respiratoria y anomalías oculares (por ejemplo, estrabismo, distrofia de la retina, apraxia oculomotora). Se observa una disminución o ausencia de alfa-distroglicano en la tinción muscular inmunohistoquímica y una elevación de la creatina quinasa en suero.

Distrofia muscular congénita, tipo Fukuyama

La distrofia muscular de tipo Fukuyama (FCMD) es una distrofia muscular progresiva congénita que se caracteriza por una malformación cerebral (lisencefalia en empedrado), cambios distróficos en el músculo esquelético, déficit intelectual grave, epilepsia y deterioro motor.


El inicio de la enfermedad suele producirse en la primera infancia. Los síntomas iniciales incluyen una succión deficiente, llanto débil, flacidez y retraso en el desarrollo. Hay debilidad muscular simétrica generalizada e hipotonía. Los pacientes presentan contracturas de las caderas, las rodillas y las articulaciones interfalángicas. Los rasgos posteriores incluyen un aspecto facial miopático, pseudohipertrofia de las pantorrillas y los antebrazos, y anomalías oftalmológicas (deterioro visual y displasia de la retina). La afectación cardíaca progresiva y las alteraciones de la deglución y la alimentación (que conducen a una neumonía por aspiración recurrente y a la muerte) se producen en los bebés con FCMD grave y en los pacientes de más de diez años de edad. Las convulsiones (convulsiones tónico-clónicas generalizadas, convulsiones parciales complejas y convulsiones parciales con generalización secundaria, espasmos infantiles, convulsiones tónicas y convulsiones mioclónicas) se producen en más del 50% de los individuos afectados (la edad media de inicio de las convulsiones es de 1 a 3 años). Todos los pacientes tienen un déficit intelectual grave y el cociente intelectual (CI) suele estar entre 30 y 60.

Miocardiopatía dilatada familiar aislada

Una rara miocardiopatía familiar caracterizada por la dilatación del ventrículo izquierdo y el deterioro progresivo de la función ventricular sistólica, en ausencia de condiciones de carga anormales o de una enfermedad arterial coronaria suficiente para causar un deterioro sistólico global. La enfermedad puede causar insuficiencia cardíaca o arritmia. La enfermedad es aislada cuando no hay manifestaciones cardíacas o extracardíacas adicionales atípicas


.La enfermedad se define por la presencia de dos criterios clínicos principales: un acortamiento fraccional del ventrículo izquierdo (VI) inferior al 25% y/o una fracción de eyección del VI inferior al 45% con un diámetro diastólico final del VI superior al 117% del valor previsto (corregido por la edad y la superficie corporal según la fórmula de Henry), en ausencia de condiciones de carga anormales o de una enfermedad arterial coronaria suficiente para causar un deterioro sistólico global. La enfermedad puede desarrollarse a cualquier edad, en ambos sexos. La masa del VI suele estar muy aumentada en este trastorno, pero el grosor de la pared del VI es normal. Puede haber síntomas de insuficiencia cardíaca y arritmias. Otras presentaciones incluyen la detección incidental de cardiomegalia asintomática y síntomas relacionados con trastornos de la conducción coexistentes o complicaciones tromboembólicas. Normalmente, hay antecedentes de MCD en la familia.

Distrofia muscular de cinturas relacionada con Fukutin R13

Forma de distrofia muscular de cinturas caracterizada por un inicio infantil de hipotonía, debilidad axial y proximal de los miembros inferiores (con debilidad severa observada después de enfermedades febriles), cardiomiopatía e inteligencia normal o reducida. En algunos casos también se ha descrito hipertrofia de pantorrillas, muslos y tríceps.


La FCMD/MEB es una distrofia muscular severa autosómica recesiva con malformaciones cerebrales y oculares características, convulsiones y retraso mental. La afectación cardíaca en la FCMD/MEB se produce en la segunda década de vida en aquellos que sobreviven. El síndrome de Walker-Warburg relacionado con la FKTN es una manifestación más grave del trastorno, con muerte generalmente en el primer año de vida.

Enfermedad músculo-ojo-cerebro

Distrofia muscular congénita poco frecuente debida a una distroglicanopatía que se caracteriza por una distrofia muscular de aparición temprana, hipotonía muscular grave, retraso mental severo y malformaciones cerebrales y oculares típicas, como paquigiria, polimicrogiria, agiria, anomalías estructurales del tronco cerebral y del cerebelo, miopía grave, glaucoma, hipoplasia del nervio óptico y de la retina. Los pacientes pueden presentar convulsiones, macrocefalia o microcefalia, microftalmia y contracturas congénitas. Dependiendo de la gravedad, se adquiere una función motora limitada. Se han descrito casos menos graves.


La distrofia muscular congénita-distroglicanopatía con anomalías cerebrales y oculares (tipo A), que incluye tanto el síndrome de Walker-Warburg (WWS), más grave, como la enfermedad músculo-ojo-cerebro (MEB), ligeramente menos grave, es un trastorno autosómico recesivo con malformaciones cerebrales y oculares características, retraso mental profundo, distrofia muscular congénita y muerte generalmente en los primeros años de vida. Representa el extremo más grave de un espectro fenotípico de trastornos similares resultantes de la glicosilación defectuosa de DAG1, conocidos colectivamente como "distroglicanopatías".

Síndrome de Walker-Warburg

Se trata de un raro trastorno genético del metabolismo del cobre que se presenta con manifestaciones hepáticas, neurológicas, psiquiátricas u oftalmológicas inespecíficas debido a la alteración de la excreción biliar de cobre y al consecuente depósito excesivo de cobre en el organismo.


Los pacientes se presentan al nacer con hipotonía severa generalizada, debilidad muscular, desarrollo psicomotor ausente o muy pobre, afectación ocular y convulsiones. La resonancia magnética cerebral muestra lisencefalia adoquinada de tipo II, hidrocefalia (véanse estos términos), hipoplasia severa del tronco cerebral y del cerebelo (es posible la malformación de Dandy-Walker, véase este término). También se observan anomalías en la materia blanca.


NM_001079802.1(FKTN):c.509C>A ; NM_006731.2(FKTN):c.411C>A ; NM_001079802.1(FKTN):c.509C>A ; NM_006731.2(FKTN):c.411C>A



Enfermedad por almacenamiento de glucógeno debida a la deficiencia de glucosa-6-fosfatasa tipo Ia

La glucogenosis por deficiencia de glucosa-6-fosfatasa (G6P) tipo a, o enfermedad por almacenamiento de glucógeno (EAG) tipo 1a, es un tipo de glucogenosis por deficiencia de G6P (consulte este término).


La enfermedad puede manifestarse al nacer por un agrandamiento del hígado o, más comúnmente, entre los tres y cuatro meses de edad por síntomas de hipoglucemia inducida rápidamente (temblores, convulsiones, cianosis y apnea). Los pacientes presentan una alteración de la homeostasis de la glucosa que suele caracterizarse por una mala tolerancia al ayuno, una hepatomegalia importante (a veces de ocho a diez centímetros por debajo del margen costal derecho), retraso del crecimiento (baja estatura y retraso de la pubertad), que generalmente mejora con una dieta adecuada, osteopenia y, en algunos casos, osteoporosis, aspecto facial de muñeca redonda con las mejillas llenas, hipotonía leve, nefromegalia y disfunción plaquetaria que puede provocar epistaxis frecuentes. Puede haber diarrea. Las complicaciones tardías son hepáticas (adenomas con rara pero posible transformación en carcinoma hepatocelular) y renales (hiperfiltración glomerular que conduce a proteinuria y a veces a insuficiencia renal), pero también incluyen anemia, a veces grave, y un riesgo de daño cerebral hipoglucémico. En pocos casos se ha notificado hipertensión pulmonar.


NM_000151.3(G6PC):c.497T>G ; NM_000151.3(G6PC):c.508C>T ; NM_000151.3(G6PC):c.379_380dupTA ; NM_000151.3(G6PC):c.551G>A ; NM_000151.3(G6PC):c.248G>A ; NM_000151.3(G6PC):c.447-1G>A ; NM_000151.4:c.247C>T ; NM_000151.3(G6PC):c.229T>C ; NM_000151.3(G6PC):c.1039C>T ; NM_000151.3(G6PC):c.562G>C ; NM_000151.3(G6PC):c.230+1G>C ; NM_000151.3(G6PC):c.113A>T ; NM_000151.3(G6PC):c.883C>T ; NM_000151.3(G6PC):c.370G>A ; NM_000151.3(G6PC):c.497T>G ; NM_000151.3(G6PC):c.508C>T ; NM_000151.3(G6PC):c.379_380dupTA ; NM_000151.3(G6PC):c.551G>A ; NM_000151.3(G6PC):c.248G>A ; NM_000151.3(G6PC):c.447-1G>A ; NM_000151.4:c.247C>T ; NM_000151.3(G6PC):c.229T>C ; NM_000151.3(G6PC):c.1039C>T ; NM_000151.3(G6PC):c.562G>C ; NM_000151.3(G6PC):c.230+1G>C ; NM_000151.3(G6PC):c.113A>T ; NM_000151.3(G6PC):c.883C>T ; NM_000151.3(G6PC):c.370G>A



Enfermedad por almacenamiento de glucógeno debida a la deficiencia de maltasa ácida, de inicio infantil

La enfermedad por almacenamiento de glucógeno debida a la deficiencia de maltasa ácida, de inicio infantil, es la forma más grave de la enfermedad por almacenamiento de glucógeno debida a la deficiencia de maltasa ácida, caracterizada por cardiomegalia con dificultad respiratoria, debilidad muscular y dificultades de alimentación. Suele ser mortal.


La enfermedad por almacenamiento de glucógeno II, un trastorno autosómico recesivo, es la enfermedad por almacenamiento lisosómico prototípica. En la forma infantil clásica (enfermedad de Pompe), la cardiomiopatía y la hipotonía muscular son los rasgos cardinales; en las formas juvenil y adulta, la afectación de los músculos esqueléticos domina el cuadro clínico.

Enfermedad de almacenamiento de glucógeno por deficiencia de maltasa ácida, de inicio tardío

Enfermedad de almacenamiento de glucógeno por deficiencia de maltasa ácida, de aparición tardía (AMDL), una forma de enfermedad de almacenamiento de glucógeno por deficiencia de maltasa ácida (AMD), una miopatía metabólica degenerativa que afecta particularmente a los músculos respiratorios y esqueléticos, se caracteriza por una acumulación de glucógeno en los lisosomas.


La enfermedad por almacenamiento de glucógeno II, un trastorno autosómico recesivo, es la enfermedad por almacenamiento lisosómico prototípica. En la forma infantil clásica (enfermedad de Pompe), la cardiomiopatía y la hipotonía muscular son los rasgos cardinales; en las formas juvenil y adulta, la afectación de los músculos esqueléticos domina el cuadro clínico.


c.1847dup ; NM_000152.4(GAA):c.1933G>T ; NM_000152.3(GAA):c.1548G>A ; c.1431del ; c.546+2_546+5del ; NM_000152.4(GAA):c.1912G>T ; NM_000152.4(GAA):c.1115A>T ; NM_000152.4(GAA):c.546G>C ; NM_000152.4(GAA):c.1935C>A ; NM_000152.3(GAA):c.307T>G ; c.698del ; NM_000152.3(GAA):c.525delT ; NM_000152.4(GAA):c.1585_1586delTCinsGT ; NM_000152.3:c.1827_1828insA ; NM_000152.3(GAA):c.655G>A ; NM_000152.3(GAA):c.2238G>A ; c.1327-2A>G ; NM_000152.3(GAA):c.2560C>T ; c.1650dup ; NM_000152.4(GAA):c.1465G>A ; NM_000152.4(GAA):c.1561G>A ; NM_000152.4(GAA):c.2512C>T ; NM_000152.3(GAA):c.1552-3C>G ; NM_000152.4(GAA):c.2066_2070dup ; NM_000152.4(GAA):c.1799G>A ; NM_000152.4(GAA):c.2238G>C ; NM_000152.4(GAA):c.2012T>G ; NM_000152.4(GAA):c.768dup ; c.2041-1G>A ; NM_000152.3(GAA):c.2237G>A ; NM_000152.5:c.1064T>C ; NM_000152.4(GAA):c.1316T>A ; NM_000152.4(GAA):c.2544del ; NM_000152.4(GAA):c.1927G>A ; NM_000152.4(GAA):c.877G>A ; NM_000152.3(GAA):c.2015G>A ; NM_000152.3(GAA):c.118C>T ; NM_000152.4(GAA):c.1634C>T ; NM_000152.4(GAA):c.546G>A ; NM_000152.3(GAA):c.925G>A ; NM_000152.4(GAA):c.2105G>T ; c.1847dup ; NM_000152.4(GAA):c.1933G>T ; NM_000152.3(GAA):c.1548G>A ; c.1431del ; c.546+2_546+5del ; NM_000152.4(GAA):c.1912G>T ; NM_000152.4(GAA):c.1115A>T ; NM_000152.4(GAA):c.546G>C ; NM_000152.4(GAA):c.1935C>A ; NM_000152.3(GAA):c.307T>G ; c.698del ; NM_000152.3(GAA):c.525delT ; NM_000152.4(GAA):c.1585_1586delTCinsGT ; NM_000152.3:c.1827_1828insA ; NM_000152.3(GAA):c.655G>A ; NM_000152.3(GAA):c.2238G>A ; c.1327-2A>G ; NM_000152.3(GAA):c.2560C>T ; c.1650dup ; NM_000152.4(GAA):c.1465G>A ; NM_000152.4(GAA):c.1561G>A ; NM_000152.4(GAA):c.2512C>T ; NM_000152.3(GAA):c.1552-3C>G ; NM_000152.4(GAA):c.2066_2070dup ; NM_000152.4(GAA):c.1799G>A ; NM_000152.4(GAA):c.2238G>C ; NM_000152.4(GAA):c.2012T>G ; NM_000152.4(GAA):c.768dup ; c.2041-1G>A ; NM_000152.3(GAA):c.2237G>A ; NM_000152.5:c.1064T>C ; NM_000152.4(GAA):c.1316T>A ; NM_000152.4(GAA):c.2544del ; NM_000152.4(GAA):c.1927G>A ; NM_000152.4(GAA):c.877G>A ; NM_000152.3(GAA):c.2015G>A ; NM_000152.3(GAA):c.118C>T ; NM_000152.4(GAA):c.1634C>T ; NM_000152.4(GAA):c.546G>A ; NM_000152.3(GAA):c.925G>A ; NM_000152.4(GAA):c.2105G>T



Enfermedad de Krabbe del adulto

Un raro trastorno lisosómico que afecta a la materia blanca del sistema nervioso central y periférico y que se caracteriza por una neurodegeneración cuya gravedad depende de la edad de aparición (infantil, infantil tardía, juvenil, adolescente y adulta).


La forma infantil tiene un inicio entre los 2 y 6 meses de edad y se divide en 3 etapas. En la primera etapa, los síntomas incluyen irritabilidad, rigidez, mal control de la cabeza, dificultades para alimentarse, cierre intermitente del pulgar, episodios de aumento de la temperatura y retraso del desarrollo. En la segunda etapa, se producen episodios hipertónicos con opistótonos, convulsiones mioclónicas, regresión del desarrollo, puñetazos y déficits de visión. En la tercera etapa, se produce hipotonía, ceguera y sordera. Los pacientes evolucionan hacia un estado vegetativo y suelen morir antes de los 2-3 años de edad, generalmente debido a infecciones respiratorias. En las formas infantil/juvenil tardía (1-16 años) y adulta (>16 años), los síntomas que se presentan varían mucho y la progresión es variable (generalmente más lenta en los pacientes mayores). Los pacientes con inicio infantil/juvenil tardío se parecen más a los pacientes infantiles, mientras que los primeros signos en las formas adultas suelen ser debilidad, trastornos de la marcha (paraparesia espástica o ataxia), parestesias quemantes, hemiplejía y/o pérdida de visión, con o sin neuropatía periférica. La regresión cognitiva es variable y a menudo está ausente en las formas adultas. En las formas de inicio tardío, la enfermedad progresa a un ritmo más lento que en los pacientes infantiles, y algunos adultos viven hasta la sexta década con síntomas leves.

Enfermedad de Krabbe infantil

Un raro trastorno lisosómico que afecta a la materia blanca del sistema nervioso central y periférico y que se caracteriza por una neurodegeneración cuya gravedad depende de la edad de aparición (infantil, infantil tardía, juvenil, adolescente y adulta).


La forma infantil tiene un inicio entre los 2 y 6 meses de edad y se divide en 3 etapas. En la primera etapa, los síntomas incluyen irritabilidad, rigidez, mal control de la cabeza, dificultades para alimentarse, cierre intermitente del pulgar, episodios de aumento de la temperatura y retraso del desarrollo. En la segunda etapa, se producen episodios hipertónicos con opistótonos, convulsiones mioclónicas, regresión del desarrollo, puñetazos y déficits de visión. En la tercera etapa, se produce hipotonía, ceguera y sordera. Los pacientes evolucionan hacia un estado vegetativo y suelen morir antes de los 2-3 años de edad, generalmente debido a infecciones respiratorias. En las formas infantil/juvenil tardía (1-16 años) y adulta (>16 años), los síntomas que se presentan varían mucho y la progresión es variable (generalmente más lenta en los pacientes mayores). Los pacientes con inicio infantil/juvenil tardío se parecen más a los pacientes infantiles, mientras que los primeros signos en las formas adultas suelen ser debilidad, trastornos de la marcha (paraparesia espástica o ataxia), parestesias quemantes, hemiplejía y/o pérdida de visión, con o sin neuropatía periférica. La regresión cognitiva es variable y a menudo está ausente en las formas adultas. En las formas de inicio tardío, la enfermedad progresa a un ritmo más lento que en los pacientes infantiles, y algunos adultos viven hasta la sexta década con síntomas leves.

Enfermedad de Krabbe tardía-infantil/juvenil

Trastorno lisosómico raro que afecta a la sustancia blanca del sistema nervioso central y periférico y que se caracteriza por una neurodegeneración cuya gravedad depende de la edad de aparición (infantil, infantil tardía, juvenil, adolescente y adulta).


La forma infantil tiene un inicio entre los 2 y 6 meses de edad y se divide en 3 etapas. En la primera etapa, los síntomas incluyen irritabilidad, rigidez, mal control de la cabeza, dificultades para alimentarse, cierre intermitente del pulgar, episodios de aumento de la temperatura y retraso del desarrollo. En la segunda etapa, se producen episodios hipertónicos con opistótonos, convulsiones mioclónicas, regresión del desarrollo, puñetazos y déficits de visión. En la tercera etapa, se produce hipotonía, ceguera y sordera. Los pacientes evolucionan hacia un estado vegetativo y suelen morir antes de los 2-3 años de edad, generalmente debido a infecciones respiratorias. En las formas infantil/juvenil tardía (1-16 años) y adulta (>16 años), los síntomas que se presentan varían mucho y la progresión es variable (generalmente más lenta en los pacientes mayores). Los pacientes con inicio infantil/juvenil tardío se parecen más a los pacientes infantiles, mientras que los primeros signos en las formas adultas suelen ser debilidad, trastornos de la marcha (paraparesia espástica o ataxia), parestesias quemantes, hemiplejía y/o pérdida de visión, con o sin neuropatía periférica. La regresión cognitiva es variable y a menudo está ausente en las formas adultas. En las formas de inicio tardío, la enfermedad progresa a un ritmo más lento que en los pacientes infantiles, y algunos adultos viven hasta la sexta década con síntomas leves.


NM_000153.3(GALC):c.1161+2T>G ; NM_000153.3(GALC):c.1153G>T ; NM_000153.4(GALC):c.1814dup ; NM_000153.4:c.1796T>G ; c.1695del ; c.1488_1489del ; NM_000153.3(GALC):c.388G>A ; c.655C>T ; NM_000153.3(GALC):c.1591C>T ; NM_000153.3(GALC):c.1592G>A ; NM_000153.3(GALC):c.628A>T ; NM_000153.3:c.1723_1724insT ; NM_000153.3(GALC):c.205C>T ; c.1964del ; c.582+1G>A ; c.2056T>C ; c.1489+2_1489+3del ; NM_000153.3(GALC):c.1488_1489+2delTGGT ; NM_000153.3(GALC):c.658C>T ; NM_000153.3(GALC):c.1700A>C ; NM_000153.3(GALC):c.953C>G ; NM_000153.3(GALC):c.1586C>T ; NM_000153.3(GALC):c.1472delA ; NC_000014.9:g.87984523C>T ; NC_000014.9:g.87965534T>C ; NM_000153.3(GALC):c.430delA ; NM_000153.3(GALC):c.1161+2T>G ; NM_000153.3(GALC):c.1153G>T ; NM_000153.4(GALC):c.1814dup ; NM_000153.4:c.1796T>G ; c.1695del ; c.1488_1489del ; NM_000153.3(GALC):c.388G>A ; c.655C>T ; NM_000153.3(GALC):c.1591C>T ; NM_000153.3(GALC):c.1592G>A ; NM_000153.3(GALC):c.628A>T ; NM_000153.3:c.1723_1724insT ; NM_000153.3(GALC):c.205C>T ; c.1964del ; c.582+1G>A ; c.2056T>C ; c.1489+2_1489+3del ; NM_000153.3(GALC):c.1488_1489+2delTGGT ; NM_000153.3(GALC):c.658C>T ; NM_000153.3(GALC):c.1700A>C ; NM_000153.3(GALC):c.953C>G ; NM_000153.3(GALC):c.1586C>T ; NM_000153.3(GALC):c.1472delA ; NC_000014.9:g.87984523C>T ; NC_000014.9:g.87965534T>C ; NM_000153.3(GALC):c.430delA



Galactosemia clásica

Se trata de una enfermedad metabólica potencialmente mortal que aparece en el periodo neonatal. Los bebés suelen desarrollar dificultades de alimentación, letargo y enfermedad hepática grave.


Las primeras manifestaciones clínicas suelen aparecer poco después del nacimiento. Los pacientes con SNC2 presentan una ictericia menos severa que los pacientes con SNC1, tienen una bilis pigmentada que contiene glucurónidos de bilirrubina y, por lo general, no presentan deterioro neurológico o intelectual. La encefalopatía por bilirrubina puede desarrollarse en etapas posteriores de la vida cuando los pacientes experimentan una infección superpuesta o estrés.


NM_000155.3(GALT):c.329-2A>C ; NM_000155.3(GALT):c.113A>C ; NM_000155.3(GALT):c.386T>C ; NM_000155.3(GALT):c.221T>C ; NM_000155.3(GALT):c.290A>G ; NM_000155.3(GALT):c.253-2A>G ; c.118G>T ; NM_000155.3(GALT):c.688-2A>C ; NM_000155.3(GALT):c.957C>A ; NM_000155.3(GALT):c.292G>A ; NM_000155.3(GALT):c.904+1G>T ; NM_000155.3(GALT):c.289_291delAAC ; NM_000155.3(GALT):c.512T>C ; NM_000155.3(GALT):c.442C>T ; NM_000155.3(GALT):c.598delC ; c.158G>A ; NM_000155.3(GALT):c.199C>T ; NM_000155.3(GALT):c.568T>C ; c.790del ; NM_000155.3(GALT):c.443G>A ; NM_000155.3(GALT):c.505C>A ; c.939G>A ; NM_000155.3(GALT):c.563A>G ; NM_000155.3(GALT):c.775C>T ; NM_000155.3(GALT):c.998G>A ; NM_000155.3(GALT):c.584T>C ; NM_000155.3(GALT):c.425T>A ; NM_000155.3(GALT):c.18delC ; NM_000155.3(GALT):c.997C>G ; NM_000155.3(GALT):c.820+13A>G ; NM_000155.3(GALT):c.997C>T ; NM_000155.3(GALT):c.203A>C ; NM_000155.3(GALT):c.1138T>C ; NM_000155.3(GALT):c.132delG ; NM_000155.3(GALT):c.692G>A ; NM_000155.3(GALT):c.947G>A ; NM_000155.3(GALT):c.580T>C ; NM_000155.3(GALT):c.220_221delCT ; NM_000155.3(GALT):c.905-2A>G ; NM_000155.3(GALT):c.265T>G ; NM_000155.3(GALT):c.71_72insA ; NM_001258332.1(GALT):c.274C>T ; NM_000155.3(GALT):c.413C>T ; NM_000155.3(GALT):c.1048delA ; NM_000155.3(GALT):c.855G>T ; NM_000155.3(GALT):c.508-1G>C ; NM_000155.3(GALT):c.985T>C ; NM_000155.3(GALT):c.626A>G ; NM_000155.3(GALT):c.41delCinsTT ; NM_000155.3(GALT):c.602G>A ; NM_000155.3(GALT):c.790_792invCTA ; NM_000155.3(GALT):c.619C>T ; NM_000155.3(GALT):c.130G>A ; NM_000155.3(GALT):c.634C>T ; NM_000155.3(GALT):c.844C>G ; NM_001258332.1(GALT):c.73delT ; NM_000155.3(GALT):c.565_578delGTATGGGCCAGCAG ; NM_000155.3(GALT):c.1052delC ; NM_000155.3(GALT):c.367C>T ; NM_000155.3(GALT):c.610C>T ; NM_000155.3(GALT):c.719_728delTAGTACTGGT ; NM_000155.3(GALT):c.404C>T ; NM_000155.3(GALT):c.428C>T ; NM_000155.3(GALT):c.329-2A>C ; NM_000155.3(GALT):c.113A>C ; NM_000155.3(GALT):c.386T>C ; NM_000155.3(GALT):c.221T>C ; NM_000155.3(GALT):c.290A>G ; NM_000155.3(GALT):c.253-2A>G ; c.118G>T ; NM_000155.3(GALT):c.688-2A>C ; NM_000155.3(GALT):c.957C>A ; NM_000155.3(GALT):c.292G>A ; NM_000155.3(GALT):c.904+1G>T ; NM_000155.3(GALT):c.289_291delAAC ; NM_000155.3(GALT):c.512T>C ; NM_000155.3(GALT):c.442C>T ; NM_000155.3(GALT):c.598delC ; c.158G>A ; NM_000155.3(GALT):c.199C>T ; NM_000155.3(GALT):c.568T>C ; c.790del ; NM_000155.3(GALT):c.443G>A ; NM_000155.3(GALT):c.505C>A ; c.939G>A ; NM_000155.3(GALT):c.563A>G ; NM_000155.3(GALT):c.775C>T ; NM_000155.3(GALT):c.998G>A ; NM_000155.3(GALT):c.584T>C ; NM_000155.3(GALT):c.425T>A ; NM_000155.3(GALT):c.18delC ; NM_000155.3(GALT):c.997C>G ; NM_000155.3(GALT):c.820+13A>G ; NM_000155.3(GALT):c.997C>T ; NM_000155.3(GALT):c.203A>C ; NM_000155.3(GALT):c.1138T>C ; NM_000155.3(GALT):c.132delG ; NM_000155.3(GALT):c.692G>A ; NM_000155.3(GALT):c.947G>A ; NM_000155.3(GALT):c.580T>C ; NM_000155.3(GALT):c.220_221delCT ; NM_000155.3(GALT):c.905-2A>G ; NM_000155.3(GALT):c.265T>G ; NM_000155.3(GALT):c.71_72insA ; NM_001258332.1(GALT):c.274C>T ; NM_000155.3(GALT):c.413C>T ; NM_000155.3(GALT):c.1048delA ; NM_000155.3(GALT):c.855G>T ; NM_000155.3(GALT):c.508-1G>C ; NM_000155.3(GALT):c.985T>C ; NM_000155.3(GALT):c.626A>G ; NM_000155.3(GALT):c.41delCinsTT ; NM_000155.3(GALT):c.602G>A ; NM_000155.3(GALT):c.790_792invCTA ; NM_000155.3(GALT):c.619C>T ; NM_000155.3(GALT):c.130G>A ; NM_000155.3(GALT):c.634C>T ; NM_000155.3(GALT):c.844C>G ; NM_001258332.1(GALT):c.73delT ; NM_000155.3(GALT):c.565_578delGTATGGGCCAGCAG ; NM_000155.3(GALT):c.1052delC ; NM_000155.3(GALT):c.367C>T ; NM_000155.3(GALT):c.610C>T ; NM_000155.3(GALT):c.719_728delTAGTACTGGT ; NM_000155.3(GALT):c.404C>T ; NM_000155.3(GALT):c.428C>T



Deficiencia de guanidinoacetato metiltransferasa

La deficiencia de guanidinoacetato metiltransferasa (GAMT) es un síndrome de deficiencia de creatina que se caracteriza por un retraso global del desarrollo/discapacidad intelectual (DD/ID), un retraso prominente del habla, trastornos del comportamiento autista/hiperactivo, convulsiones y varios tipos de manifestaciones piramidales y/o extrapiramidales.


El inicio de las manifestaciones de la deficiencia de GAMT se produce entre los 3 meses y los 3 años de edad. Los individuos afectados presentan una discapacidad intelectual de leve a grave con un déficit distintivo en el lenguaje expresivo, independientemente del grado de déficit intelectual. En la mayoría de los individuos se observan convulsiones, de diferentes tipos, que suelen ser intratables. También son frecuentes los trastornos del comportamiento, como la hiperactividad y los rasgos autistas. Los pacientes también pueden presentar trastornos del movimiento que afectan principalmente al sistema extrapiramidal y se manifiestan como corea, atetosis y ataxia.


NM_000156.5(GAMT):c.506G>A ; NM_000156.5(GAMT):c.506G>A



Enfermedad de Gaucher fetal

La enfermedad de Gaucher fetal es la forma letal perinatal de la enfermedad de Gaucher (GD; véase este término).


Esta forma es especialmente grave. La enfermedad se manifiesta en el feto con una disminución o ausencia de movimientos fetales, anasarca fetal y placentaria, hepatoesplenomegalia, ictiosis, artrogriposis, dismorfismo facial y trombocitopenia fetal. La muerte suele producirse en el útero o poco después del nacimiento (<3 meses).

Enfermedad de Gaucher tipo 1

La enfermedad de Gaucher tipo 1 es la forma crónica no neurológica de la enfermedad de Gaucher (EG; véase este término) caracterizada por organomegalia, afectación ósea y citopenia.


Aunque la enfermedad puede diagnosticarse a cualquier edad, la mitad de los pacientes tienen menos de 20 años en el momento del diagnóstico. La presentación clínica es heterogénea, con formas asintomáticas ocasionales. Se caracteriza por la asociación de astenia frecuente, retraso del crecimiento o de la pubertad, esplenomegalia (90% de los casos) que puede complicarse con infartos esplénicos (a veces sobreinfectados), hepatomegalia (80% de los casos) y en casos raros puede progresar hacia la fibrosis seguida de cirrosis. Las anomalías óseas están presentes en el 80% de los casos. Se manifiestan como deformaciones, osteopenia que a veces provoca fracturas patológicas o compresión vertebral, infartos óseos o incluso osteonecrosis aséptica. La afectación de otros órganos (afectación pulmonar, renal y cardíaca raramente sintomática) es menos frecuente. La pancitopenia es frecuente y se asocia a diversos grados de trombocitopenia (a veces grave), anemia y, menos frecuentemente, leuconeutropenia. La hipergammaglobulinemia policlonal suele estar presente y a veces se complica con una gammapatía monoclonal.

Enfermedad de Gaucher tipo 2

La enfermedad de Gaucher tipo 2 es la forma neurológica aguda de la enfermedad de Gaucher (EG; véase este término). Se caracteriza por una afectación neurológica temprana y grave del tronco encefálico, asociada a una organomegalia y que generalmente conduce a la muerte antes de los 2 años de edad.


Aunque la enfermedad puede diagnosticarse a cualquier edad, la mitad de los pacientes tienen menos de 20 años en el momento del diagnóstico. La presentación clínica es heterogénea con formas asintomáticas ocasionales. Se caracteriza por la asociación de astenia frecuente, retraso del crecimiento o de la pubertad, esplenomegalia (90% de los casos) que puede complicarse con infartos esplénicos (a veces sobreinfectados), hepatomegalia (80% de los casos) y en casos raros puede progresar hacia la fibrosis seguida de cirrosis. Las anomalías óseas están presentes en el 80% de los casos. Se manifiestan como deformaciones, osteopenia que a veces provoca fracturas patológicas o compresión vertebral, infartos óseos o incluso osteonecrosis aséptica. La afectación de otros órganos (afectación pulmonar, renal y cardíaca raramente sintomática) es menos frecuente. La pancitopenia es frecuente y se asocia a diversos grados de trombocitopenia (a veces grave), anemia y, menos frecuentemente, leuconeutropenia. La hipergammaglobulinemia policlonal suele estar presente y a veces se complica con una gammapatía monoclonal.

Enfermedad de Gaucher tipo 3

La enfermedad de Gaucher tipo 3 es la forma neurológica subaguda de la enfermedad de Gaucher (EG; véase este término) caracterizada por una encefalopatía progresiva y asociada a las manifestaciones sistémicas (organomegalia, afectación ósea, citopenia) de la EG tipo 1 (véase este término).


La enfermedad suele presentarse en lactantes de 3 a 6 meses con manifestaciones sistémicas de hepatoesplenomegalia y un síndrome neurológico grave de aparición temprana. Los primeros signos son la parálisis oculomotora o el estrabismo fijo bilateral asociados a signos bulbares, en particular graves dificultades para tragar, espasticidad progresiva y movimientos distónicos. Las convulsiones aparecen más tarde y se manifiestan como una epilepsia mioclónica refractaria al tratamiento con antiepilépticos.

Enfermedad de Gaucher-oftalmoplejía-síndrome de calcificación cardiovascular

La enfermedad de Gaucher - oftalmoplejia - calcificación cardiovascular es una variante de la enfermedad de Gaucher, también conocida como enfermedad similar a la de Gaucher que se caracteriza por la afectación cardíaca.


La principal manifestación es la calcificación progresiva de la aorta y de las válvulas aórtica y/o mitral. Otras características comunes son la esplenomegalia leve, las opacidades corneales y la oftalmoplejía supranuclear.

Enfermedad de Parkinson hereditaria de aparición tardía

La enfermedad de Parkinson hereditaria de inicio tardío (LOPD) es una forma de enfermedad de Parkinson (EP), caracterizada por una edad de inicio superior a los 50 años, temblor en reposo, molestias en la marcha y caídas, bradicinesia, rigidez y calambres dolorosos. Los pacientes suelen presentar un bajo riesgo de desarrollar síntomas no motores, distonía, discinesia y discinesia inducida por levodopa (LID).


El inicio de la LOPD es > 50 años, con síntomas predominantes que incluyen temblor en reposo (70% de los casos), molestias en la marcha y caídas (20%), bradicinesia (20%), rigidez y calambres dolorosos (8%). En comparación con la EP de inicio joven (YOPD; véase este término), se ha descrito un mayor riesgo de desarrollar congelación de la marcha y caídas, pero un menor riesgo de desarrollar distonía, discinesia y DIL. Los pacientes con LOPD hereditaria también están más afectados por diplopía grave, deterioro cognitivo y trastornos gastrointestinales y urinarios. Los pacientes con LOPD informan de una menor prevalencia de síntomas no motores, como depresión, alucinaciones, alteraciones del comportamiento (es decir, agitación o trastorno del control de los impulsos), demencia y apatía.

NO ES RARO EN EUROPA: Demencia con cuerpos de Lewy

La demencia con cuerpos de Lewy (DCL) es un trastorno neurodegenerativo caracterizado clínicamente por la demencia y el parkinsonismo, a menudo con una función cognitiva fluctuante, alucinaciones visuales, caídas, episodios sincopales y sensibilidad a la medicación neuroléptica.



NO ES RARO EN EUROPA: Enfermedad de Parkinson

La enfermedad de Parkinson fue descrita por primera vez por James Parkinson en 1817. Es el segundo trastorno neurodegenerativo más común después de la enfermedad de Alzheimer (EA), y afecta aproximadamente al 1% de la población mayor de 50 años.


La marcada variabilidad clínica se corresponde con la heterogeneidad genética: el fenotipo clásico más reconocible al instante, caracterizado por rigidez espinal, escoliosis precoz y deterioro respiratorio, se debe a mutaciones recesivas en el gen de la selenoproteína N (SEPN1), mientras que las mutaciones recesivas en el gen del receptor de rianodina del músculo esquelético (RYR1) se han asociado a una gama más amplia de características clínicas que comprenden oftalmoplejia externa, debilidad distal y emaciación o afectación predominante de la cintura de la cadera que se asemeja a la enfermedad del núcleo central (ECC). En estas últimas formas, también puede haber una continuidad histopatológica con la CCD causada por mutaciones dominantes de RYR1, lo que refleja los antecedentes genéticos comunes.


NM_001005741.2(GBA):c.431T>G ; NM_000157.4(GBA):c.160G>T ; NM_001005741.2(GBA):c.1043C>T ; c.1240G>C ; NM_001005741.2(GBA):c.354G>C ; NM_001005741.2(GBA):c.1504C>T ; NM_000157.4:c.1604G>A ; NM_001005741.2(GBA):c.1343A>T ; NM_001005741.3:c.84dupG ; NM_001005741.2(GBA):c.1309G>T ; c.1274dup ; NM_000157.3(GBA):c.1342G>C ; NM_001005741.2(GBA):c.508C>T ; NM_001005741.2(GBA):c.1090G>A ; NM_001005741.2(GBA):c.481C>T ; NM_000157.3(GBA):c.509G>T ; c.407C>A ; NM_000157.4:c.1448T>C ; NM_001005741.2(GBA):c.254G>A ; NM_000157.3(GBA):c.476G>A ; c.1098dup ; NM_001005741.2(GBA):c.1265_1319del55 ; NM_000157.4:c.1448T>G ; NM_001005741.3:c.1297G>T ; NM_001005741.2(GBA):c.1174C>G ; NM_001005741.2(GBA):c.1053G>T ; NM_001005741.2(GBA):c.1348T>A ; NM_001005741.2(GBA):c.487delG ; NM_000157.3(GBA):c.1246G>A ; NM_001005741.2(GBA):c.1240G>T ; NM_001005741.2(GBA):c.1192C>T ; NM_001005741.2(GBA):c.259C>T ; NM_001005741.2(GBA):c.1208G>C ; NM_001005741.3:c.115+1G>A ; NM_001005741.2(GBA):c.586A>C ; c.914del ; NM_001005741.2(GBA):c.1228C>G ; NM_001005741.2(GBA):c.1049A>G ; NM_001005741.2(GBA):c.1319C>T ; NM_001005741.2(GBA):c.1361C>G ; NM_001005741.2(GBA):c.1141T>G ; NM_001005741.2(GBA):c.1171G>C ; NM_001005741.3(GBA):c.497A>T ; NM_000157.3(GBA):c.475C>T ; NM_001005741.2(GBA):c.1085C>T ; NM_001005741.2(GBA):c.431T>G ; NM_000157.4(GBA):c.160G>T ; NM_001005741.2(GBA):c.1043C>T ; c.1240G>C ; NM_001005741.2(GBA):c.354G>C ; NM_001005741.2(GBA):c.1504C>T ; NM_000157.4:c.1604G>A ; NM_001005741.2(GBA):c.1343A>T ; NM_001005741.3:c.84dupG ; NM_001005741.2(GBA):c.1309G>T ; c.1274dup ; NM_000157.3(GBA):c.1342G>C ; NM_001005741.2(GBA):c.508C>T ; NM_001005741.2(GBA):c.1090G>A ; NM_001005741.2(GBA):c.481C>T ; NM_000157.3(GBA):c.509G>T ; c.407C>A ; NM_000157.4:c.1448T>C ; NM_001005741.2(GBA):c.254G>A ; NM_000157.3(GBA):c.476G>A ; c.1098dup ; NM_001005741.2(GBA):c.1265_1319del55 ; NM_000157.4:c.1448T>G ; NM_001005741.3:c.1297G>T ; NM_001005741.2(GBA):c.1174C>G ; NM_001005741.2(GBA):c.1053G>T ; NM_001005741.2(GBA):c.1348T>A ; NM_001005741.2(GBA):c.487delG ; NM_000157.3(GBA):c.1246G>A ; NM_001005741.2(GBA):c.1240G>T ; NM_001005741.2(GBA):c.1192C>T ; NM_001005741.2(GBA):c.259C>T ; NM_001005741.2(GBA):c.1208G>C ; NM_001005741.3:c.115+1G>A ; NM_001005741.2(GBA):c.586A>C ; c.914del ; NM_001005741.2(GBA):c.1228C>G ; NM_001005741.2(GBA):c.1049A>G ; NM_001005741.2(GBA):c.1319C>T ; NM_001005741.2(GBA):c.1361C>G ; NM_001005741.2(GBA):c.1141T>G ; NM_001005741.2(GBA):c.1171G>C ; NM_001005741.3(GBA):c.497A>T ; NM_000157.3(GBA):c.475C>T ; NM_001005741.2(GBA):c.1085C>T



Enfermedad del cuerpo de poliglucosa en adultos

Enfermedad de almacenamiento de glucógeno en adultos caracterizada por una disfunción progresiva de las neuronas motoras superiores e inferiores, vejiga neurógena progresiva y dificultades cognitivas que pueden llevar a la demencia.


La APBD se presenta después de los 40 años, y la incontinencia urinaria (indicativa de vejiga neurógena) suele ser la primera manifestación. La espasticidad y la debilidad progresivas también están presentes debido a la afectación de las neuronas motoras superiores e inferiores y los pacientes tienen dificultades para caminar. La gravedad de las dificultades para caminar varía entre los pacientes y algunos necesitan una silla de ruedas en una fase avanzada de la enfermedad. La pérdida sensorial en las extremidades inferiores distales se produce en la mayoría de los individuos y puede dar lugar a lesiones en los pies. Las dificultades cognitivas (como los problemas de funcionamiento ejecutivo) pueden ser leves, pero en algunos casos pueden conducir a la demencia.

Enfermedad por almacenamiento de glucógeno debida a la deficiencia de la enzima de ramificación del glucógeno, forma neuromuscular adulta

La deficiencia de la enzima de ramificación del glucógeno (GBE) (enfermedad de Andersen o amilopectinosis), o enfermedad por almacenamiento de glucógeno tipo 4 (GSD4), es una forma rara y grave de la enfermedad por almacenamiento de glucógeno que representa aproximadamente el 3% de todas las enfermedades por almacenamiento de glucógeno (ver estos términos).


La presentación clínica es muy heterogénea y afecta al hígado o al sistema neuromuscular. En la forma clásica, los niños son normales al nacer, pero desarrollan hepatomegalia, hipotonía y retraso en el desarrollo durante los primeros meses. A continuación, la enfermedad progresa rápidamente hacia la cirrosis con hipertensión portal y ascitis, causando finalmente la muerte en la primera infancia. En algunos casos se ha descrito una forma hepática no progresiva. En la presentación neuromuscular, la edad de inicio varía desde el feto hasta la edad adulta. La forma más grave comienza antes del nacimiento, con disminución o ausencia de movimientos fetales, artrogriposis, pulmones hipoplásicos y muerte perinatal. Los pacientes con formas congénitas presentan hipotonía grave, cardiomiopatía, respiración deprimida y afectación neuronal. Se han descrito formas más leves con un inicio más tardío, marcadas por la debilidad muscular o la cardiomiopatía y la insuficiencia cardíaca. También se han descrito formas neurológicas adultas con disfunción del sistema nervioso central y periférico, como la Enfermedad del Cuerpo Poliglucósico Adulto (APBD; véase este término), que se caracteriza por lesiones generalizadas de las neuronas motoras superiores e inferiores.

Enfermedad por almacenamiento de glucógeno debida a la deficiencia de la enzima de ramificación del glucógeno, forma hepática y miopática combinada en la infancia

La deficiencia de la enzima de ramificación del glucógeno (GBE) (enfermedad de Andersen o amilopectinosis), o enfermedad por almacenamiento de glucógeno tipo 4 (GSD4), es una forma rara y grave de la enfermedad por almacenamiento de glucógeno que representa aproximadamente el 3% de todas las enfermedades por almacenamiento de glucógeno (ver estos términos).


La presentación clínica es muy heterogénea y afecta al hígado o al sistema neuromuscular. En la forma clásica, los niños son normales al nacer, pero desarrollan hepatomegalia, hipotonía y retraso en el desarrollo durante los primeros meses. A continuación, la enfermedad progresa rápidamente hacia la cirrosis con hipertensión portal y ascitis, causando finalmente la muerte en la primera infancia. En algunos casos se ha descrito una forma hepática no progresiva. En la presentación neuromuscular, la edad de inicio varía desde el feto hasta la edad adulta. La forma más grave comienza antes del nacimiento, con disminución o ausencia de movimientos fetales, artrogriposis, pulmones hipoplásicos y muerte perinatal. Los pacientes con formas congénitas presentan hipotonía grave, cardiomiopatía, respiración deprimida y afectación neuronal. Se han descrito formas más leves con un inicio más tardío, marcadas por la debilidad muscular o la cardiomiopatía y la insuficiencia cardíaca. También se han descrito formas adultas neurológicas con disfunción del sistema nervioso central y periférico, como la Enfermedad del Cuerpo Poliglucósico Adulto (APBD; véase este término), que se caracteriza por lesiones generalizadas de las neuronas motoras superiores e inferiores.

Enfermedad por almacenamiento de glucógeno debida a la deficiencia de la enzima de ramificación del glucógeno, forma neuromuscular infantil

La deficiencia de la enzima de ramificación del glucógeno (GBE) (enfermedad de Andersen o amilopectinosis), o enfermedad por almacenamiento de glucógeno tipo 4 (GSD4), es una forma rara y grave de la enfermedad por almacenamiento de glucógeno que representa aproximadamente el 3% de todas las enfermedades por almacenamiento de glucógeno (ver estos términos).


La presentación clínica es muy heterogénea y afecta al hígado o al sistema neuromuscular. En la forma clásica, los niños son normales al nacer, pero desarrollan hepatomegalia, hipotonía y retraso en el desarrollo durante los primeros meses. A continuación, la enfermedad progresa rápidamente hacia la cirrosis con hipertensión portal y ascitis, causando finalmente la muerte en la primera infancia. En algunos casos se ha descrito una forma hepática no progresiva. En la presentación neuromuscular, la edad de inicio varía desde el feto hasta la edad adulta. La forma más grave comienza antes del nacimiento, con disminución o ausencia de movimientos fetales, artrogriposis, pulmones hipoplásicos y muerte perinatal. Los pacientes con formas congénitas presentan hipotonía grave, cardiomiopatía, respiración deprimida y afectación neuronal. Se han descrito formas más leves con un inicio más tardío, marcadas por la debilidad muscular o la cardiomiopatía y la insuficiencia cardíaca. También se han descrito formas adultas neurológicas con disfunción del sistema nervioso central y periférico, como la Enfermedad del Cuerpo Poliglucósico Adulto (APBD; véase este término), que se caracteriza por lesiones generalizadas de las neuronas motoras superiores e inferiores.

Enfermedad por almacenamiento de glucógeno debida a la deficiencia de la enzima de ramificación del glucógeno, forma neuromuscular congénita

La deficiencia de la enzima de ramificación del glucógeno (GBE) (enfermedad de Andersen o amilopectinosis), o enfermedad por almacenamiento de glucógeno tipo 4 (GSD4), es una forma rara y grave de la enfermedad por almacenamiento de glucógeno que representa aproximadamente el 3% de todas las enfermedades por almacenamiento de glucógeno (ver estos términos).


La presentación clínica es muy heterogénea y afecta al hígado o al sistema neuromuscular. En la forma clásica, los niños son normales al nacer, pero desarrollan hepatomegalia, hipotonía y retraso en el desarrollo durante los primeros meses. A continuación, la enfermedad progresa rápidamente hacia la cirrosis con hipertensión portal y ascitis, causando finalmente la muerte en la primera infancia. En algunos casos se ha descrito una forma hepática no progresiva. En la presentación neuromuscular, la edad de inicio varía desde el feto hasta la edad adulta. La forma más grave comienza antes del nacimiento, con disminución o ausencia de movimientos fetales, artrogriposis, pulmones hipoplásicos y muerte perinatal. Los pacientes con formas congénitas presentan hipotonía grave, cardiomiopatía, respiración deprimida y afectación neuronal. Se han descrito formas más leves con un inicio más tardío, marcadas por la debilidad muscular o la cardiomiopatía y la insuficiencia cardíaca. También se han descrito formas adultas neurológicas con disfunción del sistema nervioso central y periférico, como la Enfermedad del Cuerpo Poliglucósico Adulto (APBD; véase este término), que se caracteriza por lesiones generalizadas de las neuronas motoras superiores e inferiores.

Enfermedad por almacenamiento de glucógeno debida a la deficiencia de la enzima de ramificación del glucógeno, forma neuromuscular perinatal mortal

La deficiencia de la enzima de ramificación del glucógeno (GBE) (enfermedad de Andersen o amilopectinosis), o enfermedad por almacenamiento de glucógeno tipo 4 (GSD4), es una forma rara y grave de la enfermedad por almacenamiento de glucógeno que representa aproximadamente el 3% de todas las enfermedades por almacenamiento de glucógeno (ver estos términos).


La presentación clínica es muy heterogénea y afecta al hígado o al sistema neuromuscular. En la forma clásica, los niños son normales al nacer, pero desarrollan hepatomegalia, hipotonía y retraso en el desarrollo durante los primeros meses. A continuación, la enfermedad progresa rápidamente hacia la cirrosis con hipertensión portal y ascitis, causando finalmente la muerte en la primera infancia. En algunos casos se ha descrito una forma hepática no progresiva. En la presentación neuromuscular, la edad de inicio varía desde el feto hasta la edad adulta. La forma más grave comienza antes del nacimiento, con disminución o ausencia de movimientos fetales, artrogriposis, pulmones hipoplásicos y muerte perinatal. Los pacientes con formas congénitas presentan hipotonía grave, cardiomiopatía, respiración deprimida y afectación neuronal. Se han descrito formas más leves con un inicio más tardío, marcadas por la debilidad muscular o la cardiomiopatía y la insuficiencia cardíaca. También se han descrito formas neurológicas adultas con disfunción del sistema nervioso central y periférico, como la Enfermedad del Cuerpo Poliglucósico Adulto (APBD; véase este término), que se caracteriza por lesiones generalizadas de las neuronas motoras superiores e inferiores.

Enfermedad por almacenamiento de glucógeno debida a la deficiencia de la enzima ramificadora del glucógeno, forma hepática no progresiva

La deficiencia de la enzima de ramificación del glucógeno (GBE) (enfermedad de Andersen o amilopectinosis), o enfermedad por almacenamiento de glucógeno tipo 4 (GSD4), es una forma rara y grave de la enfermedad por almacenamiento de glucógeno que representa aproximadamente el 3% de todas las enfermedades por almacenamiento de glucógeno (ver estos términos).


La presentación clínica es muy heterogénea y afecta al hígado o al sistema neuromuscular. En la forma clásica, los niños son normales al nacer, pero desarrollan hepatomegalia, hipotonía y retraso en el desarrollo durante los primeros meses. A continuación, la enfermedad progresa rápidamente hacia la cirrosis con hipertensión portal y ascitis, causando finalmente la muerte en la primera infancia. En algunos casos se ha descrito una forma hepática no progresiva. En la presentación neuromuscular, la edad de inicio varía desde el feto hasta la edad adulta. La forma más grave comienza antes del nacimiento, con disminución o ausencia de movimientos fetales, artrogriposis, pulmones hipoplásicos y muerte perinatal. Los pacientes con formas congénitas presentan hipotonía grave, cardiomiopatía, respiración deprimida y afectación neuronal. Se han descrito formas más leves con un inicio más tardío, marcadas por la debilidad muscular o la cardiomiopatía y la insuficiencia cardíaca. También se han descrito formas adultas neurológicas con disfunción del sistema nervioso central y periférico, como la Enfermedad del Cuerpo Poliglucósico Adulto (APBD; véase este término), que se caracteriza por lesiones generalizadas de las neuronas motoras superiores e inferiores.

Enfermedad por almacenamiento de glucógeno debida a la deficiencia de la enzima de ramificación del glucógeno, forma hepática progresiva

La deficiencia de la enzima de ramificación del glucógeno (GBE) (enfermedad de Andersen o amilopectinosis), o enfermedad por almacenamiento de glucógeno tipo 4 (GSD4), es una forma rara y grave de enfermedad por almacenamiento de glucógeno que representa aproximadamente el 3% de todas las enfermedades por almacenamiento de glucógeno (ver estos términos).


La presentación clínica es muy heterogénea y afecta al hígado o al sistema neuromuscular. En la forma clásica, los niños son normales al nacer, pero desarrollan hepatomegalia, hipotonía y retraso en el desarrollo durante los primeros meses. A continuación, la enfermedad progresa rápidamente hacia la cirrosis con hipertensión portal y ascitis, causando finalmente la muerte en la primera infancia. En algunos casos se ha descrito una forma hepática no progresiva. En la presentación neuromuscular, la edad de inicio varía desde el feto hasta la edad adulta. La forma más grave comienza antes del nacimiento, con disminución o ausencia de movimientos fetales, artrogriposis, pulmones hipoplásicos y muerte perinatal. Los pacientes con formas congénitas presentan hipotonía grave, cardiomiopatía, respiración deprimida y afectación neuronal. Se han descrito formas más leves con un inicio más tardío, marcadas por la debilidad muscular o la cardiomiopatía y la insuficiencia cardíaca. También se han descrito formas adultas neurológicas con disfunción del sistema nervioso central y periférico, como la Enfermedad del Cuerpo Poliglucósico Adulto (APBD; véase este término), que se caracteriza por lesiones generalizadas de las neuronas motoras superiores e inferiores.


NM_000158.3(GBE1):c.1571G>A ; c.2052+1G>A ; NM_000158.3(GBE1):c.1543C>T ; NM_000158.4:c.986A>C ; NM_000158.3(GBE1):c.771T>A ; c.466_470del ; NM_000158.3(GBE1):c.1604A>G ; NM_000158.3(GBE1):c.1774G>T ; NM_000158.3(GBE1):c.1570C>T ; NM_000158.3(GBE1):c.1571G>A ; c.2052+1G>A ; NM_000158.3(GBE1):c.1543C>T ; NM_000158.4:c.986A>C ; NM_000158.3(GBE1):c.771T>A ; c.466_470del ; NM_000158.3(GBE1):c.1604A>G ; NM_000158.3(GBE1):c.1774G>T ; NM_000158.3(GBE1):c.1570C>T



Deficiencia de glutaril-CoA deshidrogenasa

La deficiencia de glutaril-CoA deshidrogenasa (GDD) es un trastorno neurometabólico autosómico recesivo que se caracteriza clínicamente por crisis encefalopáticas que dan lugar a lesiones estriadas y a un grave trastorno del movimiento disquinético distónico.


Los neonatos son principalmente asintomáticos, aunque el 75% presentan macrocefalia y posiblemente muestren hipotonía e irritabilidad. Si no se diagnostica, la crisis encefalopática aguda inicial se produce entre los 3 y los 36 meses, normalmente precipitada por una enfermedad febril intercurrente, una vacunación o una intervención quirúrgica, y se caracteriza por hipotonía, pérdida de habilidades motoras y convulsiones que dan lugar a una lesión estriatal bilateral con distonía secundaria grave y, ocasionalmente, hemorragia subdural y retiniana. La GDD puede presentarse excepcionalmente con hipoglucemia o acidosis. Con la edad (>6 años) y con un tratamiento adecuado, el riesgo de crisis encefalopáticas disminuye. En algunos pacientes, la hipotonía y la distonía se desarrollan gradualmente sin crisis encefalopáticas, lo que se conoce como TGD de inicio tardío o insidioso.


NM_000159.3(GCDH):c.1204C>T ; NM_000159.3(GCDH):c.572T>C ; NM_000159.3(GCDH):c.1060G>A ; NM_000159.3(GCDH):c.883T>C ; NM_000159.3(GCDH):c.1198G>A ; NM_000159.3(GCDH):c.1093G>A ; c.74C>A ; NM_000159.3(GCDH):c.764C>T ; NM_000159.3(GCDH):c.680G>C ; NM_000159.3(GCDH):c.271+1G>A ; NM_000159.4(GCDH):c.914C>T ; NM_000159.3(GCDH):c.1262C>T ; NM_000159.3(GCDH):c.1247C>T ; c.1002_1003del ; NM_000159.3(GCDH):c.542A>G ; NM_000159.3(GCDH):c.769C>T ; c.1199dup ; NM_000159.3(GCDH):c.743C>T ; NM_000159.3(GCDH):c.383G>A ; NM_000159.3(GCDH):c.636-1G>A ; NM_000159.3(GCDH):c.1244-2A>C ; NM_000159.3(GCDH):c.751C>T ; NM_000159.3(GCDH):c.1204C>T ; NM_000159.3(GCDH):c.572T>C ; NM_000159.3(GCDH):c.1060G>A ; NM_000159.3(GCDH):c.883T>C ; NM_000159.3(GCDH):c.1198G>A ; NM_000159.3(GCDH):c.1093G>A ; c.74C>A ; NM_000159.3(GCDH):c.764C>T ; NM_000159.3(GCDH):c.680G>C ; NM_000159.3(GCDH):c.271+1G>A ; NM_000159.4(GCDH):c.914C>T ; NM_000159.3(GCDH):c.1262C>T ; NM_000159.3(GCDH):c.1247C>T ; c.1002_1003del ; NM_000159.3(GCDH):c.542A>G ; NM_000159.3(GCDH):c.769C>T ; c.1199dup ; NM_000159.3(GCDH):c.743C>T ; NM_000159.3(GCDH):c.383G>A ; NM_000159.3(GCDH):c.636-1G>A ; NM_000159.3(GCDH):c.1244-2A>C ; NM_000159.3(GCDH):c.751C>T



Hepatoencefalopatía por defecto combinado de la fosforilación oxidativa tipo 1

La hepatoencefalopatía por deficiencia combinada de la fosforilación oxidativa tipo 1 es un trastorno mitocondrial hereditario poco frecuente debido a un defecto en la síntesis de proteínas mitocondriales que se caracteriza por un retraso del crecimiento intrauterino, descompensación metabólica con vómitos recurrentes, acidosis láctica grave y persistente, encefalopatía, convulsiones, retraso en el crecimiento, retraso global grave en el desarrollo, falta de contacto visual, hipotonía muscular grave o hipotonía axial con hipertonía de las extremidades, hepatomegalia y/o disfunción hepática y/o insuficiencia hepática, lo que lleva a un desenlace fatal en los casos graves. Las anomalías de neuroimagen pueden incluir adelgazamiento del cuerpo calloso, leucodistrofia, retraso en la mielinización y afectación de los ganglios basales.


La hepatoencefalopatía por deficiencia combinada de la fosforilación oxidativa tipo 1 es un trastorno mitocondrial hereditario poco frecuente debido a un defecto en la síntesis de proteínas mitocondriales que se caracteriza por un retraso del crecimiento intrauterino, descompensación metabólica con vómitos recurrentes, acidosis láctica grave y persistente, encefalopatía, convulsiones, retraso en el crecimiento, retraso global grave en el desarrollo, falta de contacto visual, hipotonía muscular grave o hipotonía axial con hipertonía de las extremidades, hepatomegalia y/o disfunción hepática y/o insuficiencia hepática, lo que lleva a un desenlace fatal en los casos graves. Las anomalías de neuroimagen pueden incluir adelgazamiento del cuerpo calloso, leucodistrofia, retraso en la mielinización y afectación de los ganglios basales.


c.1589_1590del ; c.1354_1357del ; NM_024996.5(GFM1):c.521A>G ; NM_024996.5(GFM1):c.748C>T ; NM_024996.5(GFM1):c.139C>T ; c.1589_1590del ; c.1354_1357del ; NM_024996.5(GFM1):c.521A>G ; NM_024996.5(GFM1):c.748C>T ; NM_024996.5(GFM1):c.139C>T



Sordera neurosensorial autosómica dominante de tipo DFNA

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Sordera neurosensorial autosómica recesiva de tipo DFNB

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Queratodermia hereditaria mutilante

La queratodermia hereditaria mutilante es un trastorno hereditario, difuso y mutilante de la queratodermia palmoplantar que se caracteriza por una queratosis palmoplantar severa con patrón de panal de abeja y pseudoainhumación de los dedos que lleva a la autoamputación, asociada a una pérdida auditiva neurosensorial congénita de leve a moderada. Otras características son la queratosis estrellada en las superficies extensoras de los dedos, los pies, los codos y las rodillas. También pueden asociarse la alopecia, la onicogrifosis, la distrofia ungueal o el hipocratismo, la paraplejia espástica y la miopatía.



Síndrome de KID

Un raro trastorno ectodérmico congénito caracterizado por queratitis vascularizante, lesiones cutáneas hiperqueratósicas y pérdida de audición


.Los pacientes suelen presentar al nacer un eritema generalizado y escamas ictiosiformes. Las manifestaciones cutáneas son progresivas y la eritroqueratodermia se caracteriza por placas eritematosas y queratósicas bien delimitadas con aspecto verrugoso, localizadas predominantemente en la cara, el cuero cabelludo, las orejas, los codos y las rodillas. Otras alteraciones cutáneas son los surcos profundos alrededor de la boca, la hiperqueratosis palmoplantar (PPHK) con queratodermia en forma de grano de cuero, la HK folicular en el tronco y la HK en forma de pico (ictiosis de tipo histriónico) en algunos casos. Las lesiones cutáneas son propensas a la infección y se han descrito raros casos mortales de infecciones recurrentes graves con septicemia. También son frecuentes la distrofia de las uñas, la alopecia y la ausencia o escasez de cejas y pestañas. Los pacientes con Kid/HID tienen una mayor susceptibilidad a los carcinomas de células escamosas y de lengua. La pérdida de audición es congénita, normalmente neurosensorial, y suele ser profunda. Los hallazgos oculares pueden estar ausentes en algunos pacientes, pero cuando están presentes suelen aparecer durante la infancia o la adolescencia con fotofobia, queratitis puntiforme y vascularización corneal progresiva que conduce a la pérdida de visión. La pérdida combinada de visión y audición puede provocar un grave retraso en el desarrollo. En algunos casos se han descrito defectos cerebelosos y neuromusculares.

Síndrome de las almohadillas de los nudillos - leuconiquia - sordera sensorineural - hiperqueratosis palmoplantar

Una rara enfermedad genética sindrómica de la sordera, caracterizada por nudillos simétricos o asimétricos (típicamente localizados en las articulaciones distales e interfalángicas), leuconiquia, queratodermia palmoplantar difusa y sordera neurosensorial congénita de leve a moderada.


Una rara enfermedad genética sindrómica de la sordera, caracterizada por nudillos simétricos o asimétricos (típicamente localizados en las articulaciones distales e interfalángicas), leuconiquia, queratodermia palmoplantar difusa y sordera neurosensorial congénita de leve a moderada.

Queratodermia palmoplantar-síndrome de sordera

El síndrome de queratodermia palmoplantar es un trastorno de queratinización caracterizado por queratodermia palmoplantar focal o difusa. Se observa una distribución en forma de parches con acentuación en los pies, los hipotenares y los arcos de los pies. La enfermedad se manifiesta en la infancia y se asocia a una pérdida de audición neurosensorial que muestra una edad de aparición variable. Debido a las similitudes genéticas y clínicas, se ha propuesto que el síndrome de queratodermia-sordera palmoplantar, el síndrome de almohadillas de nudillos-leuconiquia-sordera neurosensorial-hiperqueratosis palmoplantar y la queratodermia hereditaria mutilans pueden representar variantes de un amplio trastorno de sordera sindrómica con fenotipo heterogéneo. La enfermedad se transmite de forma autosómica dominante con penetrancia incompleta.



Nevo ecrino poroqueratósico de los conductos ostiales y dérmicos





NM_004004.5(GJB2):c.132G>A ; NM_004004.5(GJB2):c.416G>A ; NM_000151.4:c.229T>C ; c.516G>A ; NM_004004.5(GJB2):c.238C>T ; NM_004004.5(GJB2):c.269T>C ; NM_004004.5(GJB2):c.269dupT ; NM_004004.6:c.35delG ; c.402del ; c.310_323del ; NM_004004.5(GJB2):c.250G>C ; c.270dup ; NM_004004.6(GJB2):c.427C>T ; NM_004004.5(GJB2):c.313_326delAAGTTCATCAAGGG ; NM_004004.5(GJB2):c.334_335delAA ; NM_004004.5(GJB2):c.551G>C ; NM_004004.5(GJB2):c.235delC ; NM_004004.5(GJB2):c.365A>T ; NM_004004.5(GJB2):c.139G>T ; NM_004004.5(GJB2):c.299_300delAT ; NM_004004.5(GJB2):c.169C>T ; NM_004004.5(GJB2):c.550C>T ; NM_004004.5(GJB2):c.230G>A ; NM_004004.6(GJB2):c.299A>T ; NM_004004.5(GJB2):c.239A>C ; NM_004004.5(GJB2):c.617A>G ; NM_004004.5(GJB2):c.231G>A ; NM_004004.5(GJB2):c.358_360delGAG ; NM_004004.5(GJB2):c.250G>T ; NM_004004.6(GJB2):c.465T>A ; NM_004004.5(GJB2):c.176_191del16 ; NM_004004.6(GJB2):c.439G>A ; NM_004004.5(GJB2):c.132G>A ; NM_004004.5(GJB2):c.416G>A ; NM_000151.4:c.229T>C ; c.516G>A ; NM_004004.5(GJB2):c.238C>T ; NM_004004.5(GJB2):c.269T>C ; NM_004004.5(GJB2):c.269dupT ; NM_004004.6:c.35delG ; c.402del ; c.310_323del ; NM_004004.5(GJB2):c.250G>C ; c.270dup ; NM_004004.6(GJB2):c.427C>T ; NM_004004.5(GJB2):c.313_326delAAGTTCATCAAGGG ; NM_004004.5(GJB2):c.334_335delAA ; NM_004004.5(GJB2):c.551G>C ; NM_004004.5(GJB2):c.235delC ; NM_004004.5(GJB2):c.365A>T ; NM_004004.5(GJB2):c.139G>T ; NM_004004.5(GJB2):c.299_300delAT ; NM_004004.5(GJB2):c.169C>T ; NM_004004.5(GJB2):c.550C>T ; NM_004004.5(GJB2):c.230G>A ; NM_004004.6(GJB2):c.299A>T ; NM_004004.5(GJB2):c.239A>C ; NM_004004.5(GJB2):c.617A>G ; NM_004004.5(GJB2):c.231G>A ; NM_004004.5(GJB2):c.358_360delGAG ; NM_004004.5(GJB2):c.250G>T ; NM_004004.6(GJB2):c.465T>A ; NM_004004.5(GJB2):c.176_191del16 ; NM_004004.6(GJB2):c.439G>A



Sordera neurosensorial autosómica dominante de tipo DFNA

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.


La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Sordera neurosensorial autosómica recesiva de tipo DFNB

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.


La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Eritroqueratodermia variable

La eritroqueratodermia variable progresiva (EQVP) es un tipo de eritroqueratodermia caracterizada por la asociación de hiperqueratosis y eritema en lesiones circunscritas persistentes, aunque en ocasiones pueden ser variables. Probablemente, la eritroqueratodermia simétrica progresiva (EQSP) y la eritroqueratodermia variable (EQV) no representan dos enfermedades diferenciadas, sino dos patrones clínicos de una misma enfermedad, conocida ahora como EQVP.


La enfermedad suele manifestarse durante los primeros meses de vida o durante ekl periodo de lactancia. Se ha descrito la presencia de eritema a nacimiento. Los individuos afectos presentan máculas s eritematosas, bien delimitadas y placas hiperqueratósicas en distribución simétrica. Suelen localizarse en las superficies de extensión de las extremidades superiores e inferiores, zona glútea y cara. Las placas tienden a progresar durante la infancia, para estabilizarse posteriormente. Existe una considerable superposición clínica entre EQSP y EQV, siendo el principal rasgo distintivo entre ambas, la presencia de eritema migratorio en los casos de EQV. El carácter migratorio de las lesiones pueden cambiar a lo largo del tiempo, en las distintas etapas de la vida. Habitualmente no suelen afectarse las palmas de las manos ni las plantas de los pies, aunque algunos pacientes pueden presentar una queratodermia palmoplantar. Algunos pacientes refieren un discreto prurito.. De forma excepcional se ha descrito una mejoría de las lesiones.


La eritroqueratodermia variable progresiva (EQVP) es un tipo de eritroqueratodermia caracterizada por la asociación de hiperqueratosis y eritema en lesiones circunscritas persistentes, aunque en ocasiones pueden ser variables. Probablemente, la eritroqueratodermia simétrica progresiva (EQSP) y la eritroqueratodermia variable (EQV) no representan dos enfermedades diferenciadas, sino dos patrones clínicos de una misma enfermedad, conocida ahora como EQVP.


La enfermedad suele manifestarse durante los primeros meses de vida o durante ekl periodo de lactancia. Se ha descrito la presencia de eritema a nacimiento. Los individuos afectos presentan máculas s eritematosas, bien delimitadas y placas hiperqueratósicas en distribución simétrica. Suelen localizarse en las superficies de extensión de las extremidades superiores e inferiores, zona glútea y cara. Las placas tienden a progresar durante la infancia, para estabilizarse posteriormente. Existe una considerable superposición clínica entre EQSP y EQV, siendo el principal rasgo distintivo entre ambas, la presencia de eritema migratorio en los casos de EQV. El carácter migratorio de las lesiones pueden cambiar a lo largo del tiempo, en las distintas etapas de la vida. Habitualmente no suelen afectarse las palmas de las manos ni las plantas de los pies, aunque algunos pacientes pueden presentar una queratodermia palmoplantar. Algunos pacientes refieren un discreto prurito.. De forma excepcional se ha descrito una mejoría de las lesiones.

Neuropatía con discapacidad auditiva

Este síndrome se caracteriza por la asociación de un deterioro auditivo neurosensorial y neuropatía periférica. Se ha descrito en miembros de 4 generaciones de una familia española. El deterioro auditivo es leve y a veces asimétrico. La neuropatía es desmielinizante con afectación predominantemente sensitiva pero su gravedad está en un rango variable que va de los individuos asintomáticos hasta los pacientes con úlceras cutáneas y osteomielitis que requieren la amputación. El síndrome se transmite de manera autosómica dominante y causa mutaciones en el gen GJB3 (1p34).



Este síndrome se caracteriza por la asociación de un deterioro auditivo neurosensorial y neuropatía periférica. Se ha descrito en miembros de 4 generaciones de una familia española. El deterioro auditivo es leve y a veces asimétrico. La neuropatía es desmielinizante con afectación predominantemente sensitiva pero su gravedad está en un rango variable que va de los individuos asintomáticos hasta los pacientes con úlceras cutáneas y osteomielitis que requieren la amputación. El síndrome se transmite de manera autosómica dominante y causa mutaciones en el gen GJB3 (1p34).


La discapacidad auditiva era leve y a menudo asimétrica. La neuropatía era desmielinizante con afectación predominantemente sensorial, pero la gravedad era variable, desde individuos asintomáticos hasta pacientes con úlceras cutáneas y osteomielitis que requerían amputación.




Sordera neurosensorial autosómica dominante de tipo DFNA

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Sordera neurosensorial autosómica recesiva de tipo DFNB

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Displasia ectodérmica hidrótica

El síndrome de Clouston (o displasia ectodérmica hidrótica) se caracteriza por la tríada clínica de distrofia ungueal, alopecia e hiperqueratosis palmoplantar.


Las anomalías de las uñas son la característica más consistente y se manifiestan con frecuencia al nacer o en la primera infancia. Las uñas están engrosadas, crecen lentamente, son frágiles, a menudo hiperconvexas y están descoloridas con estrías. Otras características que se han descrito son la microniquia, la onicolisis y las infecciones paroniquiales recurrentes que provocan la pérdida de las uñas. La afectación del cabello se manifiesta al nacer o más tarde durante la infancia o la niñez, y va de la alopecia total a la parcial, a menudo progresiva. El cabello residual del cuero cabelludo es de crecimiento lento, escaso, fino y quebradizo. Las cejas y las pestañas también suelen ser escasas y el vello axilar, púbico y corporal puede verse afectado. La hiperqueratosis palmoplantar no es un hallazgo constante. Cuando está presente, suele comenzar en la infancia y tiende a empeorar con la edad; algunos pacientes también desarrollan hiperqueratosis e hiperpigmentación sobre las articulaciones y las prominencias óseas. Los dientes no suelen estar afectados y la sudoración es normal.

Síndrome de KID

Un raro trastorno ectodérmico congénito caracterizado por queratitis vascularizante, lesiones cutáneas hiperqueratósicas y pérdida de audición


.Los pacientes suelen presentar al nacer un eritema generalizado y escamas ictiosiformes. Las manifestaciones cutáneas son progresivas y la eritroqueratodermia se caracteriza por placas eritematosas y queratósicas bien delimitadas con aspecto verrugoso, localizadas predominantemente en la cara, el cuero cabelludo, las orejas, los codos y las rodillas. Otras alteraciones cutáneas son los surcos profundos alrededor de la boca, la hiperqueratosis palmoplantar (PPHK) con queratodermia en forma de grano de cuero, la HK folicular en el tronco y la HK en forma de pico (ictiosis de tipo histriónico) en algunos casos. Las lesiones cutáneas son propensas a la infección y se han descrito raros casos mortales de infecciones recurrentes graves con septicemia. También son frecuentes la distrofia de las uñas, la alopecia y la ausencia o escasez de cejas y pestañas. Los pacientes con Kid/HID tienen una mayor susceptibilidad a los carcinomas de células escamosas y de lengua. La pérdida de audición es congénita, normalmente neurosensorial, y suele ser profunda. Los hallazgos oculares pueden estar ausentes en algunos pacientes, pero cuando están presentes suelen aparecer durante la infancia o la adolescencia con fotofobia, queratitis puntiforme y vascularización corneal progresiva que conduce a la pérdida de visión. La pérdida combinada de visión y audición puede provocar un grave retraso en el desarrollo. En algunos casos se han descrito defectos cerebelosos y neuromusculares.


c.383_384del ; c.443del ; c.169C>T ; NM_001110219.2(GJB6):c.14C>T ; NM_006783.4(GJB6):c.261dupA ; c.485dup ; c.383_384del ; c.443del ; c.169C>T ; NM_001110219.2(GJB6):c.14C>T ; NM_006783.4(GJB6):c.261dupA ; c.485dup



Gangliosidosis GM1 tipo 1

La gangliosidosis GM1 tipo 1 es la forma infantil grave de la gangliosidosis GM1 (véase este término) con manifestaciones neurológicas y sistémicas variables.


La aparición de este trastorno puede producirse en el útero (hidropesía fetal no inmune) o a los seis meses de edad. Los signos clínicos son variables e incluyen detención/regresión del desarrollo neurológico, hipotonía, visceromegalia, manchas maculares de color rojo cereza, disostosis y rasgos faciales gruesos. Puede producirse una miocardiopatía.

Gangliosidosis GM1 tipo 2

La gangliosidosis GM1 tipo 2 es una forma clínicamente variable de gangliosidosis GM1 de inicio en la infancia o en la niñez (véase este término) que se caracteriza por un desarrollo temprano normal y una regresión psicomotriz entre los siete meses y los tres años de edad.


Los pacientes con la forma infantil de este trastorno desarrollan signos y síntomas de gravedad intermedia que incluyen alteraciones locomotoras, estrabismo, debilidad muscular, convulsiones, letargo e infecciones pulmonares. En comparación con el tipo 1, la visceromegalia y las anomalías esqueléticas son más leves o pueden estar ausentes. Las manchas maculares de color rojo cereza son poco frecuentes. El curso del trastorno se caracteriza por una progresión más lenta. El engrosamiento facial se desarrolla con el tiempo.

Gangliosidosis GM1 tipo 3

La gangliosidosis GM1 tipo 3 es una forma leve, crónica y adulta de la gangliosidosis GM1 (véase este término) caracterizada por un inicio generalmente durante la infancia o la adolescencia y por una disfunción cerebelosa.


Se ha informado de una marcada variabilidad de los signos clínicos y de la edad de aparición. Los pacientes suelen presentar demencia lentamente progresiva, disartria, distonía, baja estatura, anomalías vertebrales leves y ataxia. Los movimientos oculares son normales.

Mucopolisacaridosis tipo 4B

La enfermedad por almacenamiento de ácido siálico libre (SASD libre), es un grupo de enfermedades por almacenamiento lisosómico caracterizadas por un espectro de manifestaciones clínicas que incluyen trastornos neurológicos y del desarrollo con una gravedad que va desde el fenotipo más leve, la enfermedad de Salla (SD), hasta el fenotipo más grave, la enfermedad por almacenamiento de ácido siálico libre infantil (ISSD).


Clínicamente, las dos formas de MPS, IVA y IVB, tienen manifestaciones esqueléticas similares; sin embargo, la MPS IVA tiene un fenotipo más grave. La MPS IVA se diagnostica generalmente durante el segundo año de vida. Las deformidades esqueléticas y articulares progresivas conducen a un deterioro de la marcha y las actividades cotidianas, e incluyen platispondilia, cifosis, escoliosis, pectus carinatum, genu valgum, deformidades de los huesos largos e hiperlaxitud articular (cuello, manos, dedos, caderas, rodillas). Un fallo de crecimiento rápidamente progresivo, con detención en torno a los 3-5 años de edad en los casos graves, da lugar a una baja estatura. Las posibles complicaciones nerviosas son secundarias a las deformaciones esqueléticas. A partir de los 2-5 años, la hipoplasia de la vértebra odontoide combinada con la hiperlaxitud articular conduce a una inestabilidad a nivel de las dos primeras vértebras cervicales, con riesgo de compresión de la médula espinal. El dismorfismo facial incluye frente prominente, mandíbula grande y cuello corto. El deterioro respiratorio, con una fuerte restricción de la capacidad pulmonar, la susceptibilidad a la neumonía y la obstrucción/estrechamiento de la tráquea, suele estar indicado por la apnea del sueño que pone en peligro la vida, el cor pulmonale o las complicaciones anestésicas. Las manifestaciones extraesqueléticas incluyen hepatomegalia, valvulopatías, pérdida de audición, opacidad de la córnea e hipoplasia dental. La inteligencia es normal. Los pacientes suelen tener poca resistencia, fatiga debilitante y dolor. Muchos pacientes pasan a depender de una silla de ruedas en su segunda década.


NM_000404.3(GLB1):c.276G>A ; NM_000404.3(GLB1):c.947A>G ; c.1068+1G>T ; NM_000404.3(GLB1):c.1325G>A ; c.1549G>T ; c.1355dup ; NM_000404.2(GLB1):c.176G>A ; NM_000404.3(GLB1):c.1369C>T ; NM_000404.3(GLB1):c.1174_1175delCT ; NM_000404.3(GLB1):c.901G>A ; NM_000404.3(GLB1):c.1456_1466dupGGTGCATATAT ; NM_000404.3(GLB1):c.1004C>T ; NM_000404.3(GLB1):c.818G>T ; c.591dup ; NM_000404.2(GLB1):c.1646C>T ; NM_000404.3(GLB1):c.1733A>G ; NM_000404.3(GLB1):c.1572dup ; NM_000404.3(GLB1):c.1321G>A ; NM_000404.3(GLB1):c.622C>T ; NM_000404.3(GLB1):c.152T>C ; NM_000404.3(GLB1):c.457+2T>C ; NM_000404.2(GLB1):c.442C>A ; NM_000404.3(GLB1):c.1445G>A ; NM_000404.3(GLB1):c.175C>T ; NM_000404.2(GLB1):c.202C>T ; NM_000404.3(GLB1):c.171C>G ; NM_000404.3(GLB1):c.1051C>T ; NM_000404.2(GLB1):c.442C>T ; NM_000404.3(GLB1):c.1370G>A ; NM_000404.2(GLB1):c.602G>A ; NM_000404.3(GLB1):c.1313G>A ; NM_000404.3(GLB1):c.276G>A ; NM_000404.3(GLB1):c.947A>G ; c.1068+1G>T ; NM_000404.3(GLB1):c.1325G>A ; c.1549G>T ; c.1355dup ; NM_000404.2(GLB1):c.176G>A ; NM_000404.3(GLB1):c.1369C>T ; NM_000404.3(GLB1):c.1174_1175delCT ; NM_000404.3(GLB1):c.901G>A ; NM_000404.3(GLB1):c.1456_1466dupGGTGCATATAT ; NM_000404.3(GLB1):c.1004C>T ; NM_000404.3(GLB1):c.818G>T ; c.591dup ; NM_000404.2(GLB1):c.1646C>T ; NM_000404.3(GLB1):c.1733A>G ; NM_000404.3(GLB1):c.1572dup ; NM_000404.3(GLB1):c.1321G>A ; NM_000404.3(GLB1):c.622C>T ; NM_000404.3(GLB1):c.152T>C ; NM_000404.3(GLB1):c.457+2T>C ; NM_000404.2(GLB1):c.442C>A ; NM_000404.3(GLB1):c.1445G>A ; NM_000404.3(GLB1):c.175C>T ; NM_000404.2(GLB1):c.202C>T ; NM_000404.3(GLB1):c.171C>G ; NM_000404.3(GLB1):c.1051C>T ; NM_000404.2(GLB1):c.442C>T ; NM_000404.3(GLB1):c.1370G>A ; NM_000404.2(GLB1):c.602G>A ; NM_000404.3(GLB1):c.1313G>A



Encefalopatía atípica por glicina

Una forma rara de encefalopatía por glicina que presenta un inicio de la enfermedad o manifestaciones clínicas que difieren de la encefalopatía por glicina neonatal o infantil.


Los síntomas son en su mayoría inespecíficos y no son similares a los síntomas neurológicos graves observados en la GE neonatal e infantil (ver estos términos). Algunos pacientes tienen una enfermedad más leve con un inicio desde la infancia tardía hasta la edad adulta, mientras que otros tienen una enfermedad grave rápidamente progresiva a menudo de inicio tardío. También incluye a los pacientes con hiperglicinemia transitoria, cuyos síntomas en el periodo neonatal se asemejan a los de la forma neonatal. Las manifestaciones incluyen el deterioro cognitivo, los trastornos del comportamiento, la ataxia, la neuropatía periférica y la atrofia óptica.

Encefalopatía glicínica infantil

La encefalopatía infantil por glicina es una forma de leve a grave de la encefalopatía por glicina (GE; véase este término), caracterizada por hipotonía temprana, retraso en el desarrollo y convulsiones.


Los pacientes presentan convulsiones de inicio infantil y un retraso psicomotor variable tras un desarrollo inicialmente normal, y a menudo tienen una historia relativamente larga de hipotonía. En menos de la mitad de los pacientes se producen convulsiones de cualquier tipo y algunos desarrollan coreoatetosis. El retraso del desarrollo afecta sobre todo al lenguaje y a veces se encuentran problemas de comportamiento, como rabietas, irritabilidad, agresividad y rabia. A veces también se encuentra el trastorno por déficit de atención e hiperactividad (TDAH). Los pacientes no presentan letargo o coma en el periodo neonatal, a diferencia de los que padecen GE neonatal. El curso puede ser leve o grave (50% de los pacientes en cada caso).

Encefalopatía neonatal por glicina

La encefalopatía neonatal por glicina es una forma frecuente y generalmente grave de encefalopatía por glicina (GE; véase este término) que se caracteriza por coma, apnea, hipotonía, convulsiones y sacudidas mioclónicas en el periodo neonatal, y un posterior retraso en el desarrollo.


Los pacientes desarrollan manifestaciones de la enfermedad en las primeras horas o días de vida. Los síntomas incluyen letargia progresiva, hipotonía, sacudidas mioclónicas que conducen a la apnea. En ausencia de intubación y ventilación, la apnea puede ser mortal. Con medidas de apoyo, la mayoría de los pacientes recuperan la respiración espontánea y algunos muestran una mejora del estado de alerta con el tiempo. Posteriormente, presentan un profundo déficit intelectual y convulsiones cada vez más intratables durante el primer año de vida, que a menudo requieren múltiples anticonvulsivos. En la gran mayoría de los casos (85%), el curso es grave, pero algunos pacientes tienen un curso más leve y un resultado clínico menos grave. En los casos graves, los pacientes progresan poco en su desarrollo y tienen una interacción limitada con su entorno. También se ha informado de espasticidad temprana, escoliosis y pies zambos. En los casos más leves, el progreso del desarrollo es considerablemente mayor y los pacientes aprenden a caminar y a interactuar, y las convulsiones suelen ser más fáciles de tratar.


NM_000170.2(GLDC):c.2284G>A ; NM_000170.2(GLDC):c.2216G>A ; c.322G>T ; NM_000170.2(GLDC):c.2405C>T ; NM_000170.2(GLDC):c.1166C>T ; NM_000170.2(GLDC):c.1545G>C ; NM_000170.2(GLDC):c.1691G>T ; NM_000170.2(GLDC):c.2284G>A ; NM_000170.2(GLDC):c.2216G>A ; c.322G>T ; NM_000170.2(GLDC):c.2405C>T ; NM_000170.2(GLDC):c.1166C>T ; NM_000170.2(GLDC):c.1545G>C ; NM_000170.2(GLDC):c.1691G>T



Esclerosis lateral amiotrófica

Es una enfermedad neurodegenerativa que se caracteriza por una parálisis muscular progresiva que refleja la degeneración de las neuronas motoras en la corteza motora primaria, los tractos corticoespinales, el tronco cerebral y la médula espinal.


Aproximadamente dos tercios de los pacientes con ELA típica tienen una forma espinal de la enfermedad (inicio en las extremidades) y presentan síntomas relacionados con la debilidad muscular focal y el desgaste, en los que el inicio de los síntomas puede comenzar de forma distal o proximal en las extremidades superiores e inferiores. Gradualmente, puede desarrollarse espasticidad en las extremidades atróficas debilitadas, afectando a la destreza manual y a la marcha. Los pacientes con ELA de inicio bulbar suelen presentar disartria y disfagia para sólidos o líquidos. Los síntomas en las extremidades pueden desarrollarse casi simultáneamente con los síntomas bulbares, y en la gran mayoría de los casos se producen en un plazo de 1 a 2 años. La parálisis es progresiva y conduce a la muerte por insuficiencia respiratoria en un plazo de 2-3 años en los casos de inicio bulbar y de 3-5 años en los casos de ELA de inicio en las extremidades.

Síndrome de artrogriposis-cuerno anterior

Síndrome de artrogriposis poco frecuente, caracterizado por la asociación de artrogriposis múltiple congénita y una forma grave de enfermedad de la neurona motora con pérdida de células del asta anterior en la médula espinal. Los pacientes presentan una secuencia de deformación acústica fetal con múltiples contracturas y anomalías faciales, como orejas de implantación baja, mandíbula hipoplástica y cuello corto, así como hipotonía e insuficiencia respiratoria. Algunos pacientes pueden sobrevivir hasta la infancia y mostrar un retraso en el desarrollo, una marcada disminución de la masa muscular, movimientos distónicos e involuntarios, ataxia y un habla deficiente.


La artrogriposis congénita con enfermedad de las células del cuerno anterior (CAAHD) es un trastorno neuromuscular autosómico recesivo de gravedad muy variable. Los individuos afectados suelen presentar contracturas in utero en los estudios ecográficos prenatales, y se presentan al nacer con contracturas generalizadas que se manifiestan como artrogriposis múltiple congénita (AMC). Los pacientes presentan una hipotonía grave con insuficiencia respiratoria, que a menudo provoca la muerte en la infancia o en la niñez temprana. Algunos pacientes pueden sobrevivir hasta la infancia con cuidados de apoyo, pero pueden ser incapaces de caminar o sentarse de forma independiente debido a una combinación de debilidad muscular y contracturas. La cognición puede ser normal. El trastorno también incluye múltiples anomalías congénitas asociadas a la CMA y a la hipotonía, como paladar alto, facies miopática y debilidad bulbar. Los estudios neuropatológicos demuestran una pérdida grave de células del asta anterior en la médula espinal, así como una axonopatía difusa de la motoneurona.

Síndrome de contracción congénita letal tipo 1

La distrofia corneal-sordera perceptiva (CDPD) o síndrome de Harboyan es un trastorno degenerativo de la córnea que se caracteriza por la asociación de una distrofia endotelial hereditaria congénita (CHED; véase este término) con una pérdida de audición neurosensorial postlingual progresiva.


El síndrome de contractura congénita letal de tipo 1 es un raro síndrome de artrogriposis genética caracterizado por una acinesia fetal total (detectable desde la 13ª semana de gestación) acompañada de hidropesía, micrognatia, hipoplasia pulmonar, pterigia y múltiples contracturas articulares (normalmente contracturas de flexión en los codos y de extensión en las rodillas), que conducen invariablemente a la muerte antes de la 32ª semana de gestación. La falta de motoneuronas del cuerno anterior, la atrofia severa de la médula espinal ventral y la hipoplasia muscular esquelética severa son hallazgos neuropatológicos característicos, sin evidencia de anomalías estructurales de otros órganos.


c.1412_1413del ; c.898-2A>G ; NM_001003722.1(GLE1):c.2051T>C ; c.2069_2072del ; c.1412_1413del ; c.898-2A>G ; NM_001003722.1(GLE1):c.2051T>C ; c.2069_2072del



Miopatía GNE

La miopatía GNE es una rara miopatía distal autosómica recesiva que se caracteriza por una debilidad muscular distal de inicio temprano en la edad adulta, de lenta a moderadamente progresiva, que afecta preferentemente al músculo tibial anterior y que suele preservar el cuádriceps femoral. La biopsia muscular revela la presencia de vacuolas en el borde.


La enfermedad suele comenzar durante la tercera década de la vida (pero el inicio puede oscilar entre los primeros años de la adolescencia y la quinta década). Por lo general, el primer signo es la debilidad distal en las piernas con caída de los pies, seguida (normalmente) de una lenta progresión hacia los músculos proximales (muslo) y los miembros superiores (músculos de la mano). A continuación, se ven afectados los músculos de la cintura escapular, con una relativa ausencia de tríceps. Los músculos flexores del cuello también suelen estar afectados. Un patrón clínico único de esta miopatía es la preservación del cuádriceps a pesar de la importante afectación de otros músculos del muslo. Se han observado patrones inusuales de aparición en la musculatura proximal de los miembros inferiores e incluso en los miembros superiores. Los músculos oculares, faríngeos y cardíacos no suelen verse afectados. Los músculos respiratorios no suelen verse afectados hasta las fases más tardías en los pacientes en silla de ruedas. Ocasionalmente, los individuos afectados pueden presentar debilidad facial.


La sialuria es un trastorno metabólico extremadamente raro descrito en menos de 10 pacientes hasta la fecha y caracterizado por signos y síntomas variables, sobre todo en la infancia, que incluyen un retraso transitorio del crecimiento, ictericia neonatal ligeramente prolongada, hepatomegalia equívoca o leve, anemia microcítica, infecciones frecuentes de las vías respiratorias superiores, gastroenteritis, deshidratación y facies plana y tosca. En la infancia pueden aparecer dificultades de aprendizaje y convulsiones.


La sialuria es un trastorno metabólico extremadamente raro descrito en menos de 10 pacientes hasta la fecha y caracterizado por signos y síntomas variables, sobre todo en la infancia, que incluyen un retraso transitorio del crecimiento, ictericia neonatal ligeramente prolongada, hepatomegalia equívoca o leve, anemia microcítica, infecciones frecuentes de las vías respiratorias superiores, gastroenteritis, deshidratación y facies plana y tosca. En la infancia pueden aparecer dificultades de aprendizaje y convulsiones.


NM_001128227.2(GNE):c.1002T>A ; NM_001128227.2(GNE):c.1820G>A ; NM_005476.5(GNE):c.2086G>A ; NM_005476.7:c.2228T>C ; NM_001128227.2(GNE):c.830G>A ; NM_001128227.2(GNE):c.478C>T ; c.880C>T ; NM_001128227.2(GNE):c.1937C>G ; c.2086G>A ; NM_001128227.2(GNE):c.1002T>A ; NM_001128227.2(GNE):c.1820G>A ; NM_005476.5(GNE):c.2086G>A ; NM_005476.7:c.2228T>C ; NM_001128227.2(GNE):c.830G>A ; NM_001128227.2(GNE):c.478C>T ; c.880C>T ; NM_001128227.2(GNE):c.1937C>G ; c.2086G>A



Mucolipidosis tipo II

La mucolipidosis II (MLII) es un trastorno lisosómico lentamente progresivo que se caracteriza por un retraso del crecimiento, anomalías esqueléticas, dismorfismo facial, rigidez de la piel, retraso del desarrollo y cardiomegalia.


Los bebés se presentan al nacer con hipotonía, retraso en el crecimiento y deformidades esqueléticas que empeoran gradualmente, incluyendo desviación cubital de las manos con ensanchamiento y dedos camptomélicos, cifosis, dislocación de cadera, pies zambos y huesos largos deformados. Al nacer se observa una amplitud de movimiento limitada de las articulaciones de los hombros. Se ha documentado hiperparatiroidismo transitorio neonatal en casos graves de MLII. La cara plana, las órbitas poco profundas con ojos proptósicos, el puente nasal deprimido, la boca prominente y la hipertrofia gingival son evidentes poco después del nacimiento. El engrosamiento de los rasgos faciales es progresivo. La piel está rígida y engrosada, especialmente alrededor de los lóbulos de las orejas. Los hitos motrices tempranos se retrasan y el funcionamiento cognitivo está por debajo de lo normal. El crecimiento postnatal suele detenerse en el segundo año de vida y se desarrollan contracturas en todas las articulaciones. La mayoría de los pacientes no llegan a caminar. La afectación cardíaca suele incluir el engrosamiento y la insuficiencia de las válvulas mitral o aórtica. La voz es ronca y la respiración es ruidosa debido al progresivo estrechamiento de las vías respiratorias, el engrosamiento de la mucosa y la rigidez de todos los tejidos conectivos que, junto con la afectación cardíaca, conduce a la insuficiencia cardiorrespiratoria.

Mucolipidosis tipo III alfa/beta

La mucolipidosis III alfa/beta (MLIII alfa/beta) es un trastorno lisosómico que se caracteriza por una ralentización progresiva del ritmo de crecimiento desde la primera infancia, rigidez y dolor en las articulaciones, engrosamiento gradual de los rasgos faciales, retraso moderado del desarrollo y discapacidad intelectual leve en la mayoría de los pacientes.


Los niños parecen normales al nacer. El inicio es gradual y suele observarse en torno a los 3 años de edad, con una ralentización del ritmo de crecimiento y aparentes contracturas de hombro, cadera y rodilla. Los rasgos faciales dismórficos (mejillas llenas, puente nasal deprimido, boca prominente e hipertrofia gingival inconsistente) son leves, pero se agravan con la edad. La otitis media es frecuente en los jóvenes. Los cambios funcionales en los tejidos conectivos duros y blandos dan lugar a una reducción lentamente progresiva de la amplitud de movimiento en los hombros, las caderas y las rodillas. El endurecimiento gradual de las válvulas cardíacas, a partir de la infancia, conduce finalmente a la insuficiencia cardíaca. La marcha se ralentiza en la infancia, volviéndose cada vez más dolorosa debido a la grave enfermedad de la cadera. El dolor óseo, incluso en reposo, es consecuencia de la osteoporosis y de las lesiones óseas osteolíticas. La deformidad en flexión de los dedos en forma de garra y el síndrome del túnel carpiano son complicaciones frecuentes. La bronquitis/bronconeumonía es frecuente en la infancia y la enfermedad pulmonar restrictiva gradual se convierte en una amenaza para la vida en los pacientes mayores. En la mayoría de los pacientes se ha observado una leve discapacidad intelectual. La muerte suele deberse a un fallo cardiopulmonar refractario al tratamiento.


c.25C>T ; NM_024312.4(GNPTAB):c.3560_3561delAG ; NM_024312.4(GNPTAB):c.3410T>A ; NM_024312.4(GNPTAB):c.648_651delAGAA ; NM_024312.4(GNPTAB):c.1759C>T ; c.2383del ; NM_024312.4(GNPTAB):c.2896delA ; NM_024312.4(GNPTAB):c.616_619delACAG ; NM_024312.4(GNPTAB):c.3326dupA ; NM_024312.4(GNPTAB):c.749dupA ; NM_024312.4(GNPTAB):c.732_733delAA ; c.3663del ; NM_024312.4(GNPTAB):c.1906dupA ; NM_024312.4(GNPTAB):c.99delC ; NM_024312.4(GNPTAB):c.3503_3504delTC ; NM_024312.4(GNPTAB):c.3565C>T ; NM_024312.4(GNPTAB):c.3173C>G ; NM_024312.4(GNPTAB):c.1000C>T ; NM_024312.4(GNPTAB):c.1196C>T ; c.25C>T ; NM_024312.4(GNPTAB):c.3560_3561delAG ; NM_024312.4(GNPTAB):c.3410T>A ; NM_024312.4(GNPTAB):c.648_651delAGAA ; NM_024312.4(GNPTAB):c.1759C>T ; c.2383del ; NM_024312.4(GNPTAB):c.2896delA ; NM_024312.4(GNPTAB):c.616_619delACAG ; NM_024312.4(GNPTAB):c.3326dupA ; NM_024312.4(GNPTAB):c.749dupA ; NM_024312.4(GNPTAB):c.732_733delAA ; c.3663del ; NM_024312.4(GNPTAB):c.1906dupA ; NM_024312.4(GNPTAB):c.99delC ; NM_024312.4(GNPTAB):c.3503_3504delTC ; NM_024312.4(GNPTAB):c.3565C>T ; NM_024312.4(GNPTAB):c.3173C>G ; NM_024312.4(GNPTAB):c.1000C>T ; NM_024312.4(GNPTAB):c.1196C>T



Síndrome de Sanfilippo tipo D





NM_002076.3(GNS):c.1063C>T ; c.413C>G ; NM_002076.3(GNS):c.1169del ; NM_002076.3(GNS):c.1168C>T ; NM_002076.3(GNS):c.1226_1227insG ; NM_002076.3(GNS):c.1063C>T ; c.413C>G ; NM_002076.3(GNS):c.1169del ; NM_002076.3(GNS):c.1168C>T ; NM_002076.3(GNS):c.1226_1227insG



Hiperoxaluria primaria tipo 2

Trastorno del metabolismo del glioxilato caracterizado por un exceso de oxalato que provoca cálculos renales, nefrocalcinosis y, en última instancia, insuficiencia renal y oxalosis sistémica. Existen 3 tipos de HP, los tipos 1-3, todos ellos causados por defectos enzimáticos específicos del hígado.


Las características clínicas son muy variables y generalmente se desarrollan en los primeros años de vida. Los signos iniciales pueden notarse sólo durante los análisis hematológicos de rutina. Los pacientes presentan una anemia hemolítica microcítica e hipocrómica variable, que no requiere transfusiones de sangre o las requiere ocasionalmente durante los episodios infecciosos, la exposición a agentes oxidantes o el embarazo. Es frecuente encontrar esplenomegalia. Las formas no delecionales de alfa-talasemia suelen presentar una anemia más grave, esplenomegalia, hepatomegalia, colelitiasis, retraso en el crecimiento, disminución de la densidad ósea; y requieren transfusiones más tempranas y frecuentes. Los cambios esqueléticos que afectan principalmente a la cara pueden ocurrir raramente en las formas no delecionales. La sobrecarga de hierro se desarrolla de forma secundaria al aumento de la absorción intestinal de hierro, incluso en ausencia de transfusión.


c.435G>A ; c.622C>T ; NM_012203.1(GRHPR):c.295C>T ; NM_012203.1(GRHPR):c.103delG ; c.435G>A ; c.622C>T ; NM_012203.1(GRHPR):c.295C>T ; NM_012203.1(GRHPR):c.103delG



Distrofia coroidea areolar central

La distrofia coroidea areolar central (CACD) es un trastorno macular hereditario, que suele presentarse entre los 30 y los 60 años, y que se caracteriza por una gran zona de atrofia en el centro de la mácula y la pérdida o ausencia de fotorreceptores, epitelio pigmentario de la retina y coriocapilar en esta zona, lo que provoca una disminución progresiva de la agudeza visual.


La distrofia coroidea areolar central (CACD) es un trastorno hereditario de la retina que afecta principalmente a la mácula, dando lugar a menudo a una zona bien definida de atrofia del epitelio pigmentario de la retina (EPR) y de la coriocapilar en el centro de la mácula. La disfunción de los fotorreceptores maculares suele provocar una disminución de la agudeza visual, que generalmente se produce entre los 30 y los 60 años de edad.

Distrofia de bastones cónicos

Se trata de un raro trastorno genético hereditario aislado de la retina que se caracteriza por una degeneración primaria de los conos con una importante afectación secundaria de los bastones, con un aspecto variable del fondo de ojo. La presentación típica incluye disminución de la agudeza visual, escotoma central, fotofobia, alteración de la visión del color, seguida de ceguera nocturna y pérdida del campo visual periférico.


La distrofia de conos y bastones (DRC) se caracteriza por la afectación primaria de los conos o, en ocasiones, por la pérdida concomitante de conos y bastones, lo que explica los síntomas predominantes de la DRC: disminución de la agudeza visual, defectos en la visión de los colores, fotoversión y disminución de la sensibilidad en el campo visual central, seguidos posteriormente de una pérdida progresiva de la visión periférica y ceguera nocturna. El aspecto del fondo de ojo es variable y va desde la normalidad en las primeras fases, con sólo una sutil palidez temporal del nervio óptico, migración y atrofia del pigmento macular o una maculopatía en forma de ojo de buey, hasta la atrofia del epitelio pigmentario de la retina periférica, la migración de la pigmentación intra-retiniana, la atenuación arteriolar y la palidez del disco óptico a medida que la enfermedad progresa. La distrofia de conos y bastones (CRD) debe distinguirse de la distrofia de bastones y bastones (RCD), también conocida como retinitis pigmentaria. A diferencia de la DCR, que suele comenzar con ceguera nocturna y constricción progresiva del campo visual, mientras que la visión central se conserva hasta fases avanzadas, la DCR se caracteriza por una disminución primaria de la visión central que conduce a una ceguera legal más temprana. Sin embargo, en la fase final, las CRD no se diferencian de las RCD en fase final. Las DRC no suelen ser sindrómicas, pero también pueden formar parte de varios síndromes, como el síndrome de Alström, el síndrome de Bardet-Biedl y la ataxia espinocerebelosa de tipo 7.

Amaurosis congénita de Leber

La amaurosis congénita de Leber (ACL) es una distrofia de la retina definida por la ceguera y las respuestas a la estimulación electrofisiológica (electrorretinograma (ERG) de Ganzfeld) por debajo del umbral, asociada a una discapacidad visual grave en el primer año de vida.


La LCA se caracteriza por una agudeza visual gravemente reducida (inferior o igual a 20/400) o ceguera en el primer año de vida. Dependiendo de la causa genética, pueden aparecer respuestas pupilares lentas, movimientos oculares errantes, fotofobia, hipermetropía elevada, nistagmo, estrabismo convergente o queratocono. El signo oculo-digital de Franceschetti, que consiste en pinchar, presionar y frotar el ojo, es patognomónico. La ACV puede estar asociada a mutaciones en genes vinculados a síndromes que presentan un retraso del neurodesarrollo, discapacidad intelectual, comportamiento de tipo apraxia oculomotora (dificultad para mover el ojo) y disfunción renal.


c.456C>A ; NM_000180.3(GUCY2D):c.620delC ; c.2735_2736del ; c.2945del ; NM_000180.3(GUCY2D):c.1694T>C ; c.456C>A ; NM_000180.3(GUCY2D):c.620delC ; c.2735_2736del ; c.2945del ; NM_000180.3(GUCY2D):c.1694T>C



Mucopolisacaridosis tipo 7

Enfermedad genética rara de almacenamiento lisosómico caracterizada por la acumulación de glicosaminoglicanos en el tejido conectivo, que da lugar a una afectación multisistémica progresiva cuya gravedad varía de leve a grave. Los rasgos más consistentes incluyen la afectación musculoesquelética (en particular la disostosis múltiple, la restricción articular, las anomalías del tórax y la baja estatura), el vocabulario limitado, la discapacidad intelectual, la facies tosca con cuello corto, la afectación pulmonar (predominantemente la disminución de la función pulmonar), la opacidad de la córnea y la valvulopatía cardíaca.


Los signos son extremadamente variables: hay formas prenatales con hidropesía fetal no inmune, y formas neonatales graves con dismorfismo, hernias, hepatoesplenomegalia, pies zambos, disostosis, baja estatura y grave hipotonía y afectación neurológica que, en última instancia, conducen a un profundo déficit intelectual en los pacientes que sobreviven. En el otro extremo del espectro, hay casos muy leves que se descubren durante la adolescencia o la edad adulta tras presentarse con cifosis torácica.


NM_000181.3(GUSB):c.1521G>A ; NM_000181.3(GUSB):c.1084G>A ; c.820_821del ; NM_000181.3(GUSB):c.1730G>T ; NM_000181.4(GUSB):c.1429C>T ; NM_000181.3(GUSB):c.1061C>T ; c.1618G>T ; c.499C>T ; NM_000181.3(GUSB):c.1050G>C ; NM_000181.3(GUSB):c.1856C>T ; NM_000181.3(GUSB):c.1338G>A ; NM_000181.3(GUSB):c.1831C>T ; NM_000181.3(GUSB):c.646C>T ; NM_000181.3:c.1219_1220insC ; NM_000181.3(GUSB):c.1144C>T ; NM_000181.3(GUSB):c.1881G>T ; c.1244+1G>A ; c.1065+1G>T ; NM_000181.3(GUSB):c.442C>T ; NM_000181.3(GUSB):c.1337G>A ; NM_000181.3(GUSB):c.1534G>A ; NM_000181.3(GUSB):c.866G>A ; NM_000181.3(GUSB):c.526C>T ; NM_000181.3(GUSB):c.1521G>A ; NM_000181.3(GUSB):c.1084G>A ; c.820_821del ; NM_000181.3(GUSB):c.1730G>T ; NM_000181.4(GUSB):c.1429C>T ; NM_000181.3(GUSB):c.1061C>T ; c.1618G>T ; c.499C>T ; NM_000181.3(GUSB):c.1050G>C ; NM_000181.3(GUSB):c.1856C>T ; NM_000181.3(GUSB):c.1338G>A ; NM_000181.3(GUSB):c.1831C>T ; NM_000181.3(GUSB):c.646C>T ; NM_000181.3:c.1219_1220insC ; NM_000181.3(GUSB):c.1144C>T ; NM_000181.3(GUSB):c.1881G>T ; c.1244+1G>A ; c.1065+1G>T ; NM_000181.3(GUSB):c.442C>T ; NM_000181.3(GUSB):c.1337G>A ; NM_000181.3(GUSB):c.1534G>A ; NM_000181.3(GUSB):c.866G>A ; NM_000181.3(GUSB):c.526C>T



Hígado graso agudo del embarazo

La deficiencia aislada de la 3-hidroxil-CoA deshidrogenasa de cadena larga (LCHAD) es un trastorno autosómico recesivo que se caracteriza por una cardiomiopatía de aparición temprana, hipoglucemia, neuropatía y retinopatía pigmentaria y muerte súbita.


Se trata de una complicación rara y grave que se produce en el tercer trimestre del embarazo o al principio del posparto, con riesgo de mortalidad perinatal y materna, y que se caracteriza por ictericia, aumento de las lesiones hepáticas y evolución hacia la insuficiencia hepática aguda y la encefalopatía.

Deficiencia de 3-hidroxiacil-CoA deshidrogenasa de cadena larga

Trastorno mitocondrial de la oxidación de ácidos grasos de cadena larga que se caracteriza, en la mayoría de los pacientes, por la aparición en la infancia/primera juventud de hipoglucemia hipocetósica, acidosis metabólica, enfermedad hepática, hipotonía y, con frecuencia, afectación cardíaca con arritmias y/o miocardiopatía.


La mayoría de los pacientes muestran un fenotipo grave que se presenta en la infancia, normalmente desde el periodo neonatal hasta los 12 meses de edad. La enfermedad se manifiesta como hipoglucemia hipocetósica, acidosis metabólica, hipotonía, afectación hepática con encefalopatía hepática, cardiomiopatía y arritmias. La presentación clínica suele estar precedida por el ayuno y/o una enfermedad intercurrente y a menudo se presenta con hipoglucemia hipocetósica. La neuropatía periférica crónica y la retinopatía pigmentaria se desarrollan con el tiempo en muchos pacientes supervivientes. Las presentaciones más raras de la HCHADD son la parada cardiaca repentina o la muerte súbita del bebé. El síndrome HELLP (véase este término) suele producirse en mujeres embarazadas que llevan un feto afectado por la LCHADD.

Deficiencia de proteína trifuncional mitocondrial

Se trata de un raro trastorno de la oxidación de los ácidos grasos que se caracteriza por un amplio espectro clínico que va desde manifestaciones neonatales graves, como cardiomiopatía, hipoglucemia, acidosis metabólica, miopatía y neuropatía esqueléticas, enfermedad hepática y muerte, hasta un fenotipo leve con polineuropatía periférica, rabdomiólisis episódica y retinopatía pigmentaria.


La forma grave de aparición neonatal se manifiesta con esteatosis hepática, miocardiopatía, miopatía esquelética y neuropatía, y suele ser mortal. La forma moderadamente grave, que suele aparecer desde el periodo neonatal hasta los 18 meses de edad, se presenta principalmente con hipoglucemia hipocetósica y acidosis metabólica, que a menudo se precipita por un ayuno prolongado y/o una enfermedad intercurrente. Ambas formas pueden manifestarse con neuropatía con o sin cardiomiopatía y pueden ser mortales. La forma leve se fusiona con la forma infantil moderadamente grave y puede presentarse desde los pocos meses de edad hasta la adolescencia como una polineuropatía periférica con rabdomiólisis episódica desencadenada por el ayuno prolongado, la enfermedad, el ejercicio o la exposición al calor o al frío. Hay insuficiencia respiratoria asociada a los episodios de rabdomiólisis. También puede desarrollarse una retinopatía pigmentaria con el tiempo. Muy ocasionalmente, se describen adultos que presentan por primera vez una enfermedad no reconocida previamente.


NC_000002.12:g.26194616del ; NM_000182.4(HADHA):c.1620+2_1620+6del5 ; c.499del ; NM_000182.4(HADHA):c.845T>A ; NM_000182.4(HADHA):c.1793_1794delAT ; c.1422dup ; NM_000182.4(HADHA):c.2146+1G>A ; NM_000182.4(HADHA):c.1918C>T ; NM_000182.4(HADHA):c.1678C>T ; NM_000182.4(HADHA):c.1132C>T ; NM_000182.4(HADHA):c.919-2A>G ; c.2132dupC ; NM_000182.4(HADHA):c.274_278delTCATC ; NM_000182.4(HADHA):c.1528G>C ; NC_000002.12:g.26194616del ; NM_000182.4(HADHA):c.1620+2_1620+6del5 ; c.499del ; NM_000182.4(HADHA):c.845T>A ; NM_000182.4(HADHA):c.1793_1794delAT ; c.1422dup ; NM_000182.4(HADHA):c.2146+1G>A ; NM_000182.4(HADHA):c.1918C>T ; NM_000182.4(HADHA):c.1678C>T ; NM_000182.4(HADHA):c.1132C>T ; NM_000182.4(HADHA):c.919-2A>G ; c.2132dupC ; NM_000182.4(HADHA):c.274_278delTCATC ; NM_000182.4(HADHA):c.1528G>C



Deficiencia de proteína trifuncional mitocondrial

Se trata de un raro trastorno de la oxidación de los ácidos grasos que se caracteriza por un amplio espectro clínico que va desde manifestaciones neonatales graves, como cardiomiopatía, hipoglucemia, acidosis metabólica, miopatía y neuropatía esqueléticas, enfermedad hepática y muerte, hasta un fenotipo leve con polineuropatía periférica, rabdomiólisis episódica y retinopatía pigmentaria.


La forma grave de aparición neonatal se manifiesta con esteatosis hepática, miocardiopatía, miopatía esquelética y neuropatía, y suele ser mortal. La forma moderadamente grave, que suele aparecer desde el periodo neonatal hasta los 18 meses de edad, se presenta principalmente con hipoglucemia hipocetósica y acidosis metabólica, que a menudo se precipita por un ayuno prolongado y/o una enfermedad intercurrente. Ambas formas pueden manifestarse con neuropatía con o sin cardiomiopatía y pueden ser mortales. La forma leve se fusiona con la forma infantil moderadamente grave y puede presentarse desde los pocos meses de edad hasta la adolescencia como una polineuropatía periférica con rabdomiólisis episódica desencadenada por el ayuno prolongado, la enfermedad, el ejercicio o la exposición al calor o al frío. Hay insuficiencia respiratoria asociada a los episodios de rabdomiólisis. También puede desarrollarse una retinopatía pigmentaria con el tiempo. Muy ocasionalmente, se describen adultos que presentan por primera vez una enfermedad no reconocida previamente.


NM_000183.2(HADHB):c.788A>G ; NM_000183.2(HADHB):c.1364T>G ; NM_000183.2(HADHB):c.1331G>A ; NM_000183.2(HADHB):c.788A>G ; NM_000183.2(HADHB):c.1364T>G ; NM_000183.2(HADHB):c.1331G>A



Síndrome de alfa-talasemia-discapacidad intelectual ligado al cromosoma 16

Un raro defecto de desarrollo durante la embriogénesis, un síndrome de deleción genética contigua, es una forma de alfa-talasemia caracterizada por microcitosis, hipocromía, nivel normal de hemoglobina (Hb) o anemia leve, asociada a anomalías del desarrollo.


La ATR-16 es una enfermedad congénita. Los pacientes presentan un rasgo de alfa-talasemia o una enfermedad leve de la hemoglobina H (enfermedad HbH) asociada a una discapacidad intelectual de leve a profunda (en la mayoría de los casos) y, en algunos casos, a rasgos dismórficos leves e inespecíficos (hipertelorismo leve, fisuras palpebrales inclinadas hacia abajo, puente nasal ancho o prominente, orejas pequeñas, cuello corto), microcefalia y baja estatura. Se han señalado anomalías genitales (hipospadias y criptorquidia) en los varones. El pie zambo es frecuente.


--MED ; --SEA ; --THAI ; - α3.7 ; - α4.2 ; - α20.5 ; --FIL



Hidrops fetal de Hb Bart

Forma rara y grave de alfa-talasemia que casi siempre es letal. Se caracteriza por la aparición en el feto de edema generalizado, derrames pleurales y pericárdicos y anemia hipocrómica grave.


Los fetos afectados sufren una anemia grave en el útero, lo que provoca una hipoxia tisular severa, insuficiencia cardíaca y una serie de anomalías del desarrollo asociadas a la hidropesía fetal (marcada hepatoesplenomegalia, anomalías urogenitales y de las extremidades). En los supervivientes, el periodo neonatal suele ser tormentoso, y el retraso del crecimiento y el neurodesarrollo son los principales resultados adversos a largo plazo. Las complicaciones maternas durante el embarazo incluyen preeclampsia, polihidramnios u oligohidramnios, hemorragia anteparto y parto prematuro. Aunque las transfusiones intrauterinas y los cuidados intensivos perinatales han conseguido aumentar la supervivencia del feto hasta el periodo perinatal, se suele recomendar la interrupción terapéutica temprana de los embarazos de riesgo debido a la gravedad del síndrome y al riesgo de complicaciones maternas potencialmente graves durante el embarazo.




Enfermedad de la hemoglobina H

La enfermedad de la hemoglobina H (HbH) es una forma de moderada a grave de alfa-talasemia (véase este término) caracterizada por una anemia hemolítica microcítica e hipocrómica pronunciada.


Las características clínicas son muy variables y generalmente se desarrollan en los primeros años de vida. Los signos iniciales pueden notarse sólo durante los análisis hematológicos de rutina. Los pacientes presentan una anemia hemolítica microcítica hipocrómica variable, que no requiere transfusiones de sangre o las requiere ocasionalmente durante los episodios infecciosos, la exposición a agentes oxidantes o el embarazo. Es frecuente encontrar esplenomegalia. Las formas no delecionales de alfa-talasemia suelen presentar una anemia más grave, esplenomegalia, hepatomegalia, colelitiasis, retraso en el crecimiento, disminución de la densidad ósea; y requieren transfusiones más tempranas y frecuentes. Los cambios esqueléticos que afectan principalmente a la cara pueden ocurrir raramente en las formas no delecionales. La sobrecarga de hierro se desarrolla de forma secundaria al aumento de la absorción intestinal de hierro, incluso en ausencia de transfusión.




Enfermedad de la hemoglobina M

Una rara hemoglobinopatía caracterizada por la presencia de variantes de la hemoglobina con anomalías estructurales en la porción de globina de la molécula que conducen a la auto-oxidación del hierro hemo, dando lugar a la metahemoglobinemia. Los pacientes presentan cianosis para la que no es necesario ningún tratamiento. El modo de herencia es autosómico dominante.


La inmunodeficiencia combinada grave se refiere a un grupo genética y clínicamente heterogéneo de trastornos con una función inmunitaria celular y humoral defectuosa. Los pacientes con IDCG presentan en la infancia infecciones recurrentes y persistentes por organismos oportunistas, como Candida albicans, Pneumocystis carinii y citomegalovirus, entre muchos otros. Los análisis de laboratorio muestran una linfopenia profunda con disminución o ausencia de inmunoglobulinas. La característica común de todos los tipos de IDCG es la ausencia de inmunidad celular mediada por células T debido a un defecto en el desarrollo de las mismas. Sin tratamiento, los pacientes suelen morir en el primer año de vida. La prevalencia global de todos los tipos de IDCG es de aproximadamente 1 de cada 75.000 nacimientos.




Síndrome de alfa-talasemia-discapacidad intelectual ligado al cromosoma 16

Un raro defecto de desarrollo durante la embriogénesis, un síndrome de deleción genética contigua, es una forma de alfa-talasemia caracterizada por microcitosis, hipocromía, nivel normal de hemoglobina (Hb) o anemia leve, asociada a anomalías del desarrollo.


La ATR-16 es una enfermedad congénita. Los pacientes presentan un rasgo de alfa-talasemia o una enfermedad leve de la hemoglobina H (enfermedad HbH) asociada a una discapacidad intelectual de leve a profunda (en la mayoría de los casos) y, en algunos casos, a rasgos dismórficos leves e inespecíficos (hipertelorismo leve, fisuras palpebrales inclinadas hacia abajo, puente nasal ancho o prominente, orejas pequeñas, cuello corto), microcefalia y baja estatura. Se han señalado anomalías genitales (hipospadias y criptorquidia) en los varones. El pie zambo es frecuente.




Hidrops fetal de Hb Bart

Forma rara y grave de alfa-talasemia que casi siempre es letal. Se caracteriza por la aparición en el feto de edema generalizado, derrames pleurales y pericárdicos y anemia hipocrómica grave.


Los fetos afectados sufren una anemia grave en el útero, lo que provoca una hipoxia tisular severa, insuficiencia cardíaca y una serie de anomalías del desarrollo asociadas a la hidropesía fetal (marcada hepatoesplenomegalia, anomalías urogenitales y de las extremidades). En los supervivientes, el periodo neonatal suele ser tormentoso, y el retraso del crecimiento y el neurodesarrollo son los principales resultados adversos a largo plazo. Las complicaciones maternas durante el embarazo incluyen preeclampsia, polihidramnios u oligohidramnios, hemorragia anteparto y parto prematuro. Aunque las transfusiones intrauterinas y los cuidados intensivos perinatales han conseguido aumentar la supervivencia del feto hasta el periodo perinatal, se suele recomendar la interrupción terapéutica temprana de los embarazos de riesgo debido a la gravedad del síndrome y al riesgo de complicaciones maternas potencialmente graves durante el embarazo.




Enfermedad de la hemoglobina H

La enfermedad de la hemoglobina H (HbH) es una forma de moderada a grave de alfa-talasemia (véase este término) caracterizada por una anemia hemolítica microcítica e hipocrómica pronunciada.


Las características clínicas son muy variables y generalmente se desarrollan en los primeros años de vida. Los signos iniciales pueden notarse sólo durante los análisis hematológicos de rutina. Los pacientes presentan una anemia hemolítica microcítica hipocrómica variable, que no requiere transfusiones de sangre o las requiere ocasionalmente durante los episodios infecciosos, la exposición a agentes oxidantes o el embarazo. Es frecuente encontrar esplenomegalia. Las formas no delecionales de alfa-talasemia suelen presentar una anemia más grave, esplenomegalia, hepatomegalia, colelitiasis, retraso en el crecimiento, disminución de la densidad ósea; y requieren transfusiones más tempranas y frecuentes. Los cambios esqueléticos que afectan principalmente a la cara pueden ocurrir raramente en las formas no delecionales. La sobrecarga de hierro se desarrolla de forma secundaria al aumento de la absorción intestinal de hierro, incluso en ausencia de transfusión.




Enfermedad de la hemoglobina M

Una rara hemoglobinopatía caracterizada por la presencia de variantes de la hemoglobina con anomalías estructurales en la porción de globina de la molécula que conducen a la auto-oxidación del hierro hemo, dando lugar a la metahemoglobinemia. Los pacientes presentan cianosis para la que no es necesario ningún tratamiento. El modo de herencia es autosómico dominante.


La inmunodeficiencia combinada grave se refiere a un grupo genética y clínicamente heterogéneo de trastornos con una función inmunitaria celular y humoral defectuosa. Los pacientes con IDCG presentan en la infancia infecciones recurrentes y persistentes por organismos oportunistas, como Candida albicans, Pneumocystis carinii y citomegalovirus, entre muchos otros. Los análisis de laboratorio muestran una linfopenia profunda con disminución o ausencia de inmunoglobulinas. La característica común de todos los tipos de IDCG es la ausencia de inmunidad celular mediada por células T debido a un defecto en el desarrollo de las mismas. Sin tratamiento, los pacientes suelen morir en el primer año de vida. La prevalencia global de todos los tipos de IDCG es de aproximadamente 1 de cada 75.000 nacimientos.




Beta-talasemia intermedia

La beta-talasemia (BT) intermedia es una forma de BT (véase este término) caracterizada por una anemia de leve a moderada que no requiere transfusiones o sólo las requiere ocasionalmente.


La BT intermedia abarca un amplio espectro clínico, y los casos más graves se presentan entre los 2 y los 6 años de edad con anemia, aumento del tamaño del bazo y a veces del hígado, así como retraso en el crecimiento y el desarrollo. En otros casos, los pacientes son completamente asintomáticos hasta la vida adulta y sólo presentan una anemia leve. La hipertrofia de la médula eritroide, con la posibilidad de eritropoyesis extramedular, es frecuente y conduce a deformidades características del hueso y la cara, osteoporosis con fracturas patológicas de los huesos largos y formación de masas eritropoyéticas que afectan principalmente al bazo, el hígado, los ganglios linfáticos, el tórax y la columna vertebral. Con menor frecuencia, la hipertrofia de la médula eritroide puede causar problemas neurológicos (compresión de la médula espinal con paraplejia). Los pacientes también pueden desarrollar úlceras en las piernas y cálculos biliares. Se ha informado de una mayor predisposición a la trombosis frente a la BT mayor, especialmente después de la esplenectomía. Aunque los pacientes corren el riesgo de sufrir una sobrecarga de hierro, el hipogonadismo, el hipotiroidismo y la diabetes no son frecuentes. La afectación cardíaca también puede producirse como resultado de un estado de alto rendimiento e hipertensión pulmonar, mientras que la función sistólica del ventrículo izquierdo suele estar preservada.

Beta-talasemia mayor

La beta-talasemia (BT) mayor es una forma grave de inicio temprano de la BT (véase este término) que se caracteriza por una anemia grave que requiere transfusiones regulares de glóbulos rojos.


El inicio se produce durante la infancia con anemia grave, retraso en el desarrollo y palidez progresiva. Pueden aparecer problemas de alimentación, diarrea, irritabilidad, brotes recurrentes de fiebre y aumento progresivo del abdomen causado por esplenomegalia y hepatomegalia. Los pacientes no tratados o mal transfundidos presentan retraso del crecimiento, palidez, ictericia, mala musculatura, genu valgum, úlceras en las piernas, formación de masas debido a la hematopoyesis extramedular y cambios en el esqueleto, incluyendo deformidades en los huesos largos de las piernas y cambios craneofaciales típicos, como protuberancia del cráneo, eminencia malar prominente, depresión del puente de la nariz, tendencia a una inclinación mongólica del ojo e hipertrofia del maxilar, que tiende a exponer los dientes superiores. En los pacientes transfundidos regularmente, el crecimiento y el desarrollo tienden a ser normales, pero pueden surgir complicaciones relacionadas con la sobrecarga de hierro, como el retraso del crecimiento y el fracaso o el retraso de la maduración sexual. Las complicaciones de la sobrecarga de hierro de aparición más tardía incluyen miocardiopatía dilatada, arritmias, fibrosis hepática y cirrosis, diabetes mellitus e insuficiencia de las glándulas paratiroides, tiroides, hipófisis y, con menor frecuencia, suprarrenales. Otras complicaciones son el hiperesplenismo, la trombosis venosa y la osteoporosis.

Beta-talasemia delta

La beta-talasemia delta es una forma de beta-talasemia (véase este término) caracterizada por la disminución o ausencia de la síntesis de las cadenas delta y beta de la globina con un aumento compensatorio de la expresión de la síntesis de la cadena gamma fetal.


La forma heterocigótica de la enfermedad es clínicamente asintomática con microcitosis leve y sin elevación de la HbA2, mientras que los pocos pacientes homocigóticos tienen una presentación clínica leve. Cuando se hereda con beta-talasemia clásica heterocigota, los pacientes suelen tener el fenotipo de talasemia intermedia, pero en algunos casos se ha descrito el fenotipo de talasemia mayor.

Beta-talasemia dominante

La beta-talasemia dominante es una forma de beta-talasemia (véase este término) que provoca una anemia de moderada a grave.


Los pacientes presentan anemia de moderada a grave, ictericia y esplenomegalia.

Enfermedad de la hemoglobina C

La enfermedad de la hemoglobina C (HbC) es una hemoglobinopatía caracterizada por la producción de una variante anormal de la hemoglobina conocida como hemoglobina C, sin manifestaciones clínicas o con manifestaciones clínicas leves (anemia hemolítica).



Síndrome de hemoglobina C-beta-talasemia

La hemoglobina C - beta-talasemia (HbC - BT) es una forma de beta-talasemia (véase este término) que provoca una anemia hemolítica moderada.


Los pacientes suelen ser asintomáticos y se diagnostican durante las pruebas rutinarias. Cuando están presentes, las manifestaciones clínicas son anemia moderada y esplenomegalia.

Enfermedad de la hemoglobina D

La enfermedad de la hemoglobina D (HbD) es una hemoglobinopatía caracterizada por la producción de una variante anormal de la hemoglobina conocida como hemoglobina D, con manifestaciones clínicas nulas o leves (esplenomegalia, anemia muy leve).



Enfermedad de la hemoglobina E

La enfermedad de la hemoglobina E (HbE) es una hemoglobinopatía caracterizada por la producción de una variante anormal de la hemoglobina conocida como hemoglobina E, con una presentación generalmente benigna y asintomática.



Síndrome de hemoglobina E-beta-talasemia

La hemoglobina E - beta-talasemia (HbE - BT) es una forma de beta-talasemia (ver este término) que da lugar a una presentación clínica de leve a grave que va desde una condición indistinguible de la beta-talasemia mayor hasta una forma leve de beta-talasemia intermedia (ver estos términos).


La HbE - BT leve (alrededor del 15% de los casos) se caracteriza por niveles normales de Hb (9-12 g/dl) y los pacientes no suelen desarrollar síntomas clínicamente significativos. No es necesario ningún tratamiento. Las formas moderadamente graves (la mayoría de los casos) se caracterizan por una disminución de los niveles de Hb (6-8 g/dl) y las manifestaciones clínicas son similares a las de la beta-talasemia intermedia. No se requieren transfusiones a menos que las infecciones precipiten una mayor anemia. Puede producirse una sobrecarga de hierro. Las formas graves se caracterizan por niveles de Hb muy bajos (4-5 g/dl) y los pacientes presentan manifestaciones similares a las de la beta-talasemia mayor y son tratados como pacientes con talasemia mayor.

Síndrome de hemoglobina Lepore-beta-talasemia

Una rara beta-talasemia asociada a otra anomalía de la hemoglobina caracterizada por la presencia de la variante de la hemoglobina Lepore en asociación con la beta-talasemia. La presentación clínica es muy variable, dependiendo del tipo de beta-talasemia, y va desde una anemia microcítica hipocrómica grave y una dependencia total de las transfusiones hasta una anemia moderada y compensada sin necesidad de transfusiones de sangre regulares.


La metahemoglobinemia es una condición clínica en la que más del 1% de la hemoglobina se oxida a metahemoglobina, un tipo de hemoglobina que contiene la forma férrica (Fe3+) del hierro. Los pacientes con hemoglobina M son cianóticos pero, por lo demás, asintomáticos. Si la mutación se produce en la subunidad alfa de la hemoglobina, la cianosis es evidente al nacer, mientras que si la cadena beta está afectada, la cianosis aparece más tarde o se intensifica cuando aumenta la producción de la subunidad beta. Si un recién nacido es portador de una hemoglobina M fetal (subunidad gamma), la cianosis desaparece cuando se produce el cambio completo de gamma a beta.

Enfermedad de la hemoglobina M

Una rara hemoglobinopatía caracterizada por la presencia de variantes de la hemoglobina con anomalías estructurales en la porción de globina de la molécula que conducen a la auto-oxidación del hierro hemo, dando lugar a la metahemoglobinemia. Los pacientes presentan cianosis para la que no es necesario ningún tratamiento. El modo de herencia es autosómico dominante.


La inmunodeficiencia combinada grave se refiere a un grupo genética y clínicamente heterogéneo de trastornos con una función inmunitaria celular y humoral defectuosa. Los pacientes con IDCG presentan en la infancia infecciones recurrentes y persistentes por organismos oportunistas, como Candida albicans, Pneumocystis carinii y citomegalovirus, entre muchos otros. Los análisis de laboratorio muestran una linfopenia profunda con disminución o ausencia de inmunoglobulinas. La característica común de todos los tipos de IDCG es la ausencia de inmunidad celular mediada por células T debido a un defecto en el desarrollo de las mismas. Sin tratamiento, los pacientes suelen morir en el primer año de vida. La prevalencia global de todos los tipos de IDCG es de aproximadamente 1 de cada 75.000 nacimientos.

Persistencia hereditaria de la hemoglobina fetal - Síndrome de beta-talasemia

La persistencia hereditaria de hemoglobina fetal (HPFH) asociada a la beta-talasemia (véase este término) se caracteriza por niveles elevados de hemoglobina (Hb) F y un número elevado de células que contienen Hb fetal.


La asociación de la HPFH con la beta-talasemia mitiga las manifestaciones clínicas que varían desde un estado normal hasta la beta-talasemia intermedia (véase este término).

Síndrome de la enfermedad de células falciformes con persistencia hereditaria de la hemoglobina fetal

Es una hemoglobinopatía genética rara que se caracteriza por un fenotipo clínico generalmente leve, niveles elevados de hemoglobina fetal y microcitosis e hipocromía leves. En algunos casos, se han notificado manifestaciones agudas de la enfermedad de células falciformes, concretamente el síndrome torácico agudo y la crisis de dolor agudo. El genotipo se caracteriza por la combinación de un alelo HbS y HbF; los síntomas dependen del grado de expresividad HbF:HbS, siendo asintomáticos los pacientes con más del 35% de expresión de HbF pancélica. Los pacientes sintomáticos tienen una expresión heterocelular de HbF.


Una hemoglobinopatía genética poco frecuente que se caracteriza por un fenotipo clínico generalmente leve, niveles elevados de hemoglobina fetal y microcitosis e hipocromía leves. En algunos casos, se han notificado manifestaciones agudas de la enfermedad de células falciformes, a saber, síndrome torácico agudo y crisis de dolor agudo. El genotipo se caracteriza por la combinación de un alelo HbS y HbF; los síntomas dependen del grado de expresividad de HbF:HbS, siendo asintomáticos los pacientes con más de un 35% de expresión de HbF pancelular. Los pacientes sintomáticos tienen una expresión heterocelular de HbF.

Anemia falciforme

Forma grave de la enfermedad de células falciformes (ECF) caracterizada por la homocigosis para el gen de la hemoglobina falciforme (HbS) y que se manifiesta de forma aguda con anemia grave, susceptibilidad a infecciones bacterianas graves y accidentes vasooclusivos isquémicos. Se trata de una enfermedad de los glóbulos rojos de origen genético que se manifiesta con una enfermedad hemolítica y una pérdida de deformabilidad de los glóbulos rojos que conduce a otros eventos oclusivos.


La enfermedad no se manifiesta durante la vida fetal o hasta los tres primeros meses de vida debido a la presencia de altos niveles de hemoglobina fetal. Las manifestaciones clínicas evolucionan con la edad y son muy variables entre los individuos y en diferentes momentos. Además de la anemia y las infecciones bacterianas, los VOA causan isquemia focal hiperálgica (y a veces infarto) cuando se producen en el abdomen, el tórax o el esqueleto. Con el paso del tiempo, los AOV pueden comprometer la integridad de los tejidos u órganos.

Síndrome de la enfermedad de células falciformes-beta-talasemia

Una rara hemoglobinopatía genética que afecta a los glóbulos rojos tanto en la producción de hemoglobina anormal, como en la disminución de la síntesis de las cadenas de beta globina. Las manifestaciones clínicas dependen de la cantidad de producción de cadenas de beta globina residuales, y son similares a las de la anemia falciforme, incluyendo anemia, oclusión vascular y sus complicaciones, episodios agudos de dolor, síndrome torácico agudo, hipertensión pulmonar, sepsis, lesión cerebral isquémica, crisis de secuestro esplénico y esplenomegalia.


Una rara hemoglobinopatía genética que afecta a los glóbulos rojos tanto en la producción de hemoglobina anormal, como en la disminución de la síntesis de las cadenas de beta globina. Las manifestaciones clínicas dependen de la cantidad de producción residual de cadenas de beta globina, y son similares a las de la anemia falciforme, incluyendo anemia, oclusión vascular y sus complicaciones, episodios agudos de dolor, síndrome torácico agudo, hipertensión pulmonar, sepsis, lesión cerebral isquémica, crisis de secuestro esplénico y esplenomegalia.

Síndrome de la enfermedad de células falciformes-hemoglobina C

Una rara hemoglobinopatía genética caracterizada por anemia, reticulocitosis y anomalías eritrocitarias que incluyen células en diana, células irreversiblemente falciformes y células con cristales. La evolución clínica es similar a la de la enfermedad de células falciformes, pero menos grave y con menos complicaciones. Los signos y síntomas pueden incluir episodios agudos de dolor, infarto esplénico y crisis de secuestro esplénico, síndrome torácico agudo, glomeruloesclerosis segmentaria focal, lesión cerebral isquémica, retinopatía periférica y osteonecrosis.




NM_000518.5(HBB):c.217dup (p.Ser73Lysfs) ; NC_000011.10:g.5226765_5226768del ; NM_000518.5(HBB):c.92+5G>A ; NM_000518.5(HBB):c.85dup (p.Leu29Profs) ; NM_000518.5(HBB):c.82G>T (p.Ala28Ser) ; NM_000518.4(HBB):c.364G>A (p.Glu122Lys) ; NM_000518.5(HBB):c.315+1G>A ; NM_000518.4(HBB):c.135delC (p.Phe46Leufs) ; NM_000518.5(HBB):c.118C>T (p.Gln40Ter) ; NM_000518.4(HBB):c.112delT (p.Trp38Glyfs) ; NM_000518.5(HBB):c.93-21G>A ; NM_000518.5(HBB):c.92+6T>C ; NM_000518.5(HBB):c.92+5G>C ; NM_000518.5(HBB):c.92+1G>A ; NM_000518.5(HBB):c.79G>A (p.Glu27Lys) ; NM_000518.5(HBB):c.59A>G (p.Asn20Ser) ; NM_000518.5(HBB):c.52A>T (p.Lys18Ter) ; NM_000518.4(HBB):c.27dupG (p.Ser10Valfs*14) ; NM_000518.5(HBB):c.20A>T (p.Glu7Val) ; NM_000518.4(HBB):c.19G>A (p.Glu7Lys)



Enfermedad de Tay-Sachs, variante B, forma adulta

Un raro trastorno caracterizado por la acumulación de gangliósidos G2 debido a la deficiencia de hexosaminidasa A.


Se han descrito tres variantes según la edad de aparición. La forma infantil (tipo 1) comienza entre los 3 y los 6 meses de edad. El signo más temprano es una respuesta de sobresalto incesante al ruido. El retraso psicomotor aparece después de los 8 meses con hipotonía, amaurosis y megalencefalia. Puede encontrarse una mancha macular de color rojo cereza, pero no es específica. La debilidad muscular progresa y conduce a la parálisis. El trastorno degenera en un estado de descerebración y es mortal durante la infancia. La actividad enzimática de la hexosaminidasa A es extremadamente baja o está totalmente ausente en los leucocitos y en los cultivos de fibroblastos obtenidos por biopsia de piel. En la forma juvenil (tipo 2), la aparición se produce entre los 2 y los 6 años, con ataxia locomotora, trastornos de la conducta y pérdida progresiva de las capacidades intelectuales, lo que lleva a un estado de descerebración y a la muerte alrededor de los 15 años. La disminución de la actividad de la hexosaminidasa A es menos pronunciada que en la forma infantil. La forma adulta o crónica (tipo 3) puede comenzar alrededor de los 10 años, pero a menudo el trastorno no se diagnostica hasta la edad adulta. Existen dos formas clínicas diferentes. La primera es similar a la enfermedad de Friedreich atípica, con ataxia espinocerebelosa pero sin signos cardíacos u óseos, como escoliosis o pies planos. La segunda es la de la amiotrofia espinal juvenil que se asemeja al síndrome de Kugelberg-Welander. Las capacidades mentales y el comportamiento pueden verse afectados o no. Se encuentra la deficiencia de hexosaminidasa A.

Enfermedad de Tay-Sachs, variante B, forma infantil

Un trastorno raro caracterizado por la acumulación de gangliósidos G2 debido a la deficiencia de hexosaminidasa A.


Se han descrito tres variantes según la edad de inicio. La forma infantil (tipo 1) comienza entre los 3 y los 6 meses de edad. El signo más temprano es una respuesta de sobresalto incesante al ruido. El retraso psicomotor aparece después de los 8 meses con hipotonía, amaurosis y megalencefalia. Puede encontrarse una mancha macular de color rojo cereza, pero no es específica. La debilidad muscular progresa y conduce a la parálisis. El trastorno degenera en un estado de descerebración y es mortal durante la infancia. La actividad enzimática de la hexosaminidasa A es extremadamente baja o está totalmente ausente en los leucocitos y en los cultivos de fibroblastos obtenidos por biopsia de piel. En la forma juvenil (tipo 2), la aparición se produce entre los 2 y los 6 años, con ataxia locomotora, trastornos de la conducta y pérdida progresiva de las capacidades intelectuales, lo que lleva a un estado de descerebración y a la muerte alrededor de los 15 años. La disminución de la actividad de la hexosaminidasa A es menos pronunciada que en la forma infantil. La forma adulta o crónica (tipo 3) puede comenzar alrededor de los 10 años, pero a menudo el trastorno no se diagnostica hasta la edad adulta. Existen dos formas clínicas diferentes. La primera es similar a la enfermedad de Friedreich atípica, con ataxia espinocerebelosa pero sin signos cardíacos u óseos, como escoliosis o pies planos. La segunda es la de la amiotrofia espinal juvenil que se asemeja al síndrome de Kugelberg-Welander. Las capacidades mentales y el comportamiento pueden verse afectados o no. Se encuentra la deficiencia de hexosaminidasa A.

Enfermedad de Tay-Sachs, variante B, forma juvenil

Un trastorno raro caracterizado por la acumulación de gangliósidos G2 debido a la deficiencia de hexosaminidasa A.


Se han descrito tres variantes según la edad de aparición. La forma infantil (tipo 1) comienza entre los 3 y los 6 meses de edad. El signo más temprano es una respuesta de sobresalto incesante al ruido. El retraso psicomotor aparece después de los 8 meses con hipotonía, amaurosis y megalencefalia. Puede encontrarse una mancha macular de color rojo cereza, pero no es específica. La debilidad muscular progresa y conduce a la parálisis. El trastorno degenera en un estado de descerebración y es mortal durante la infancia. La actividad enzimática de la hexosaminidasa A es extremadamente baja o está totalmente ausente en los leucocitos y en los cultivos de fibroblastos obtenidos por biopsia de piel. En la forma juvenil (tipo 2), la aparición se produce entre los 2 y los 6 años, con ataxia locomotora, trastornos de la conducta y pérdida progresiva de las capacidades intelectuales, lo que lleva a un estado de descerebración y a la muerte alrededor de los 15 años. La disminución de la actividad de la hexosaminidasa A es menos pronunciada que en la forma infantil. La forma adulta o crónica (tipo 3) puede comenzar alrededor de los 10 años, pero a menudo el trastorno no se diagnostica hasta la edad adulta. Existen dos formas clínicas diferentes. La primera es similar a la enfermedad de Friedreich atípica, con ataxia espinocerebelosa pero sin signos cardíacos u óseos, como escoliosis o pies planos. La segunda es la de la amiotrofia espinal juvenil que se asemeja al síndrome de Kugelberg-Welander. Las capacidades mentales y el comportamiento pueden verse afectados o no. Se encuentra la deficiencia de hexosaminidasa A.

Enfermedad de Tay-Sachs, variante B1

Un raro trastorno caracterizado por la acumulación de gangliósidos G2 debido a la deficiencia de hexosaminidasa A.


Las manifestaciones clínicas de esta enfermedad son muy variables. La EG tipo 1 (90% de los casos) es la forma crónica y no neurológica asociada a organomegalia (bazo, hígado), anomalías óseas (dolor, osteonecrosis, fracturas patológicas) y citopenia. El tipo 2, la forma neurológica aguda, se caracteriza por una aparición precoz, una disfunción del tronco cerebral que progresa rápidamente, asociada a una organomegalia y que conduce a la muerte antes de los 2 años. El tipo 3, la forma neurológica subaguda, afecta a niños o adolescentes y se caracteriza por una encefalopatía progresiva (apraxia oculomotora, epilepsia y ataxia) con las manifestaciones sistémicas observadas en el tipo 1. La forma fetal se manifiesta con una disminución o ausencia de movimientos fetales o anasarca. La enfermedad tipo Gaucher se presenta con una calcificación progresiva de la aorta y de las válvulas aórtica y/o mitral como característica principal.


NM_000520.5(HEXA):c.805+1G>A ; NM_000520.6:c.1274_1277dupTATC ; NM_000520.5(HEXA):c.78G>A ; c.1278_1281dup ; NM_000520.5(HEXA):c.629C>T ; NM_000520.5(HEXA):c.1214_1215delAAinsG ; NM_000520.5(HEXA):c.538T>C ; NM_000520.5(HEXA):c.459+5G>A ; NM_000520.4:c.1499delT ; NM_000520.5(HEXA):c.1528C>T ; c.77G>A ; NM_000520.5(HEXA):c.508C>T ; NM_000520.5(HEXA):c.533G>A ; NM_000520.5(HEXA):c.532C>T ; NM_000520.5(HEXA):c.632T>C ; NM_000520.5(HEXA):c.1495C>T ; NM_183050.4:c.509G>A ; NM_000520.5(HEXA):c.772G>C ; NM_000083.3:c.1444G>A ; c.759_774dup ; NM_000520.5(HEXA):c.1176G>A ; NM_000520.5(HEXA):c.672+1G>A ; NM_001318825.1(HEXA):c.1544G>A ; c.254-1G>C ; NM_000520.5(HEXA):c.1510C>T ; NM_000520.5(HEXA):c.533G>T ; NM_000520.5(HEXA):c.1177C>T ; NM_000520.5(HEXA):c.805+1G>C ; NM_000520.5(HEXA):c.1A>G ; NM_000520.5(HEXA):c.1260G>C ; NM_000520.6:c.915_917delCTT ; c.1537C>T ; NM_000520.5(HEXA):c.380T>G ; NM_000520.5(HEXA):c.749G>A ; NM_000520.5(HEXA):c.987G>A ; NM_000520.5(HEXA):c.1A>T ; NM_000520.6:c.805G>A ; NM_000520.5(HEXA):c.986+3A>G ; NM_000520.5(HEXA):c.1510del ; NM_000520.5(HEXA):c.173G>A ; NM_000520.6:c.540C>G ; NM_000520.5(HEXA):c.2T>C ; NM_000520.5(HEXA):c.1422G>C ; NM_000520.5(HEXA):c.116T>G ; NM_000520.5(HEXA):c.805+1G>A ; NM_000520.6:c.1274_1277dupTATC ; NM_000520.5(HEXA):c.78G>A ; c.1278_1281dup ; NM_000520.5(HEXA):c.629C>T ; NM_000520.5(HEXA):c.1214_1215delAAinsG ; NM_000520.5(HEXA):c.538T>C ; NM_000520.5(HEXA):c.459+5G>A ; NM_000520.4:c.1499delT ; NM_000520.5(HEXA):c.1528C>T ; c.77G>A ; NM_000520.5(HEXA):c.508C>T ; NM_000520.5(HEXA):c.533G>A ; NM_000520.5(HEXA):c.532C>T ; NM_000520.5(HEXA):c.632T>C ; NM_000520.5(HEXA):c.1495C>T ; NM_183050.4:c.509G>A ; NM_000520.5(HEXA):c.772G>C ; NM_000083.3:c.1444G>A ; c.759_774dup ; NM_000520.5(HEXA):c.1176G>A ; NM_000520.5(HEXA):c.672+1G>A ; NM_001318825.1(HEXA):c.1544G>A ; c.254-1G>C ; NM_000520.5(HEXA):c.1510C>T ; NM_000520.5(HEXA):c.533G>T ; NM_000520.5(HEXA):c.1177C>T ; NM_000520.5(HEXA):c.805+1G>C ; NM_000520.5(HEXA):c.1A>G ; NM_000520.5(HEXA):c.1260G>C ; NM_000520.6:c.915_917delCTT ; c.1537C>T ; NM_000520.5(HEXA):c.380T>G ; NM_000520.5(HEXA):c.749G>A ; NM_000520.5(HEXA):c.987G>A ; NM_000520.5(HEXA):c.1A>T ; NM_000520.6:c.805G>A ; NM_000520.5(HEXA):c.986+3A>G ; NM_000520.5(HEXA):c.1510del ; NM_000520.5(HEXA):c.173G>A ; NM_000520.6:c.540C>G ; NM_000520.5(HEXA):c.2T>C ; NM_000520.5(HEXA):c.1422G>C ; NM_000520.5(HEXA):c.116T>G



Enfermedad de Sandhoff, forma adulta

La enfermedad de Sandhoff es un trastorno por almacenamiento lisosómico de la familia de la gangliosidosis GM2 y se caracteriza por la degeneración del sistema nervioso central.


El cuadro clínico es idéntico al de la enfermedad de Tay-Sachs, con reacciones de sobresalto, ceguera temprana, deterioro motor y mental progresivo, macrocefalia y manchas de color rojo cereza en la mácula. Los pacientes pueden tener cara de muñeca, hepatoesplenomegalia e infecciones recurrentes de las vías respiratorias. Se encuentran niveles elevados de oligosacáridos en la orina. Los niños se desarrollan con normalidad durante los primeros 3-6 meses de vida, tras los cuales la enfermedad aparece y evoluciona rápidamente. En los casos de aparición más tardía, o en los casos adultos, los signos pueden ser los de la ataxia espinocerebelosa o la distonía. Las capacidades intelectuales pueden verse afectadas o no.

Enfermedad de Sandhoff, forma infantil

La enfermedad de Sandhoff es un trastorno por almacenamiento lisosómico de la familia de la gangliosidosis GM2 y se caracteriza por la degeneración del sistema nervioso central.


El cuadro clínico es idéntico al de la enfermedad de Tay-Sachs, con reacciones de sobresalto, ceguera temprana, deterioro motor y mental progresivo, macrocefalia y manchas de color rojo cereza en la mácula. Los pacientes pueden tener cara de muñeca, hepatoesplenomegalia e infecciones recurrentes de las vías respiratorias. Se encuentran niveles elevados de oligosacáridos en la orina. Los niños se desarrollan con normalidad durante los primeros 3-6 meses de vida, tras los cuales la enfermedad aparece y evoluciona rápidamente. En los casos de aparición más tardía, o en los casos adultos, los signos pueden ser los de la ataxia espinocerebelosa o la distonía. Las capacidades intelectuales pueden verse afectadas o no.

Enfermedad de Sandhoff, forma juvenil

La enfermedad de Sandhoff es un trastorno por almacenamiento lisosómico de la familia de la gangliosidosis GM2 y se caracteriza por la degeneración del sistema nervioso central.


El cuadro clínico es idéntico al de la enfermedad de Tay-Sachs, con reacciones de sobresalto, ceguera temprana, deterioro motor y mental progresivo, macrocefalia y manchas de color rojo cereza en la mácula. Los pacientes pueden tener cara de muñeca, hepatoesplenomegalia e infecciones recurrentes de las vías respiratorias. Se encuentran niveles elevados de oligosacáridos en la orina. Los niños se desarrollan con normalidad durante los primeros 3-6 meses de vida, tras los cuales la enfermedad aparece y evoluciona rápidamente. En los casos de aparición más tardía, o en los casos adultos, los signos pueden ser los de la ataxia espinocerebelosa o la distonía. Las capacidades intelectuales pueden verse afectadas o no.


c.1539_1540del ; NM_000521.3(HEXB):c.1375G>T ; NM_000521.3(HEXB):c.850C>T ; NM_000521.3(HEXB):c.171delG ; NM_000521.3(HEXB):c.508C>T ; NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG ; NM_000521.4(HEXB):c.841C>T ; NM_000521.3:c.202_203insGG ; c.1345del ; NM_000521.3(HEXB):c.797A>G ; c.1310_1311del ; c.1380G>A ; NM_000521.3(HEXB):c.1517_1529dupCAAGTGCTGTTGG ; NM_000521.3(HEXB):c.298delC ; NM_000521.3(HEXB):c.1238_1242delCAAAG ; NM_000521.3(HEXB):c.1250C>T ; NM_000521.3(HEXB):c.115delG ; c.1539_1540del ; NM_000521.3(HEXB):c.1375G>T ; NM_000521.3(HEXB):c.850C>T ; NM_000521.3(HEXB):c.171delG ; NM_000521.3(HEXB):c.508C>T ; NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG ; NM_000521.4(HEXB):c.841C>T ; NM_000521.3:c.202_203insGG ; c.1345del ; NM_000521.3(HEXB):c.797A>G ; c.1310_1311del ; c.1380G>A ; NM_000521.3(HEXB):c.1517_1529dupCAAGTGCTGTTGG ; NM_000521.3(HEXB):c.298delC ; NM_000521.3(HEXB):c.1238_1242delCAAAG ; NM_000521.3(HEXB):c.1250C>T ; NM_000521.3(HEXB):c.115delG



Porfiria cutánea tardía familiar

La miopatía miotubular ligada al X-síndrome de genitales anormales es una rara anomalía cromosómica, deleción parcial del brazo largo del cromosoma X, caracterizada por una combinación de manifestaciones clínicas de miopatía miotubular ligada al X y un trastorno del desarrollo sexual 46,XY. Los pacientes presentan una forma grave de miopatía congénita y genitales masculinos anormales.


La enfermedad se manifiesta en la edad adulta. La PCT es adquirida (75% de los casos) o familiar (25% de los casos). En general, las manifestaciones de la enfermedad aparecen antes en los casos familiares. Algunos factores de riesgo pueden precipitar los síntomas: el consumo excesivo de alcohol, la hepatitis C, los estrógenos y las mutaciones de los genes que controlan el metabolismo del hierro, que conducen a una sobrecarga de hierro (hemocromatosis). Los principales síntomas clínicos son, en primer lugar, una piel extremadamente frágil y, posteriormente, lesiones cutáneas bullosas en la superficie de la piel expuesta al sol (manos, cara). La cicatrización es lenta y suele ir seguida de hiper e hipopigmentación. La presencia de lesiones cutáneas de edad variable es muy característica de la enfermedad. Con la edad, las manifestaciones de la enfermedad pueden ir acompañadas de hipertricosis (principalmente facial) y signos esclerodérmicos. También pueden desarrollarse lesiones hepáticas (siderosis, esteatosis, necrosis y trastornos inflamatorios crónicos).

NO RARO EN EUROPA: Hemocromatosis tipo 1



La hemocromatosis hereditaria es un trastorno autosómico recesivo del metabolismo del hierro en el que el organismo acumula un exceso de hierro. El exceso de hierro se deposita en diversos órganos, lo que provoca su fallo y da lugar a enfermedades graves como cirrosis, hepatomas, diabetes, cardiomiopatía, artritis e hipogonadismo hipogonadotrópico. Los efectos graves de la enfermedad no suelen aparecer hasta después de décadas de carga progresiva de hierro. La eliminación del exceso de hierro mediante flebotomía terapéutica disminuye la morbilidad y la mortalidad si se instaura en una fase temprana de la enfermedad. La hemocromatosis clásica (HFE) suele estar causada por la mutación de un gen denominado HFE en el cromosoma 6p21.3. 

Porfiria cutánea tardía esporádica

La porfiria cutánea tarda (PCT) es la forma más común de porfiria hepática crónica (véase este término). Se caracteriza por una fotodermatitis bullosa.


La enfermedad se manifiesta en la edad adulta. La PCT es adquirida (75% de los casos) o familiar (25% de los casos). Por lo general, las manifestaciones de la enfermedad aparecen antes en los casos familiares. Algunos factores de riesgo pueden precipitar los síntomas: el consumo excesivo de alcohol, la hepatitis C, los estrógenos y las mutaciones de los genes que controlan el metabolismo del hierro, que conducen a una sobrecarga de hierro (hemocromatosis). Los principales síntomas clínicos son, en primer lugar, una piel extremadamente frágil y, posteriormente, lesiones cutáneas bullosas en la superficie de la piel expuesta al sol (manos, cara). La cicatrización es lenta y suele ir seguida de hiper e hipopigmentación. La presencia de lesiones cutáneas de edad variable es muy característica de la enfermedad. Con la edad, las manifestaciones de la enfermedad pueden ir acompañadas de hipertricosis (principalmente facial) y signos esclerodérmicos. También pueden desarrollarse lesiones hepáticas (siderosis, esteatosis, necrosis y trastornos inflamatorios crónicos).

Forma sintomática de la hemocromatosis tipo 1

Distrofia muscular progresiva que se caracteriza por la coexistencia de debilidad en la cintura de las extremidades y contracturas articulares difusas sin cardiomiopatía. Los pacientes presentan una debilidad de las extremidades inferiores que progresa hasta afectar también a las extremidades superiores y a los músculos axiales y que acaba provocando una pérdida permanente de la deambulación, contracturas articulares generalizadas en las extremidades y, a veces, en la columna vertebral, y una afectación respiratoria variable. Los cambios morfológicos en las biopsias musculares incluyen vacuolas en el borde, aumento de los núcleos internos, cuerpos citoplasmáticos y un patrón distrófico.


La hemocromatosis hereditaria es un trastorno autosómico recesivo del metabolismo del hierro en el que el organismo acumula un exceso de hierro. El exceso de hierro se deposita en una variedad de órganos que conducen a su fracaso y dan lugar a enfermedades graves como cirrosis, hepatomas, diabetes, cardiomiopatía, artritis e hipogonadismo hipogonadotrópico. Los efectos graves de la enfermedad no suelen aparecer hasta después de décadas de carga progresiva de hierro. La eliminación del exceso de hierro mediante flebotomía terapéutica disminuye la morbilidad y la mortalidad si se instaura en una fase temprana de la enfermedad. La hemocromatosis clásica (HFE) suele estar causada por una mutación en un gen denominado HFE en el cromosoma 6p21.3.


NM_000410.3(HFE):c.277G>C ; c.252G>A ; NM_000410.3(HFE):c.989G>T ; NM_000410.3(HFE):c.314T>C ; NM_000410.3(HFE):c.277G>C ; c.252G>A ; NM_000410.3(HFE):c.989G>T ; NM_000410.3(HFE):c.314T>C




Trastorno raro del metabolismo de la fenilalanina y la tirosina caracterizado por la acumulación de ácido homogentísico (HGA) y su producto oxidado, el ácido benzoquinona acético (BQA), en varios tejidos (por ejemplo cartílago, tejido conectivo) y fluidos corporales (orina, sudor), provocando el oscurecimiento de la orina cuando se expone al aire, así como la coloración gris-azulada de la esclerótica y el hélix de la oreja (ocronosis), y una enfermedad articular incapacitante que afecta a las articulaciones axiales y periféricas (artropatía ocronótica).


Muchos individuos afectados son asintomáticos y no son conscientes de su condición hasta la edad adulta; sin embargo, la aciduria homogéntica puede reconocerse en la infancia por los pañales de color oscuro. Después de la tercera década, comienza a observarse una pigmentación inusual de la esclerótica y de la piel que recubre el cartílago, así como síntomas músculo-esqueléticos como dolor de espalda y rigidez. La afectación de las grandes articulaciones periféricas suele producirse varios años después de los cambios en la columna vertebral, y a menudo conduce a una enfermedad articular terminal. La artropatía periférica ocronótica suele ser de naturaleza degenerativa. A partir de la cuarta década, la movilidad articular disminuye. Puede haber anquilosis. También son posibles las fracturas de las vértebras y de los huesos largos. Otras características pueden ser las complicaciones genitourinarias (por ejemplo, cálculos renales, vesicales o prostáticos) y cardíacas (valvulitis mitral, arritmias), así como la insuficiencia respiratoria debida a la afectación musculoesquelética.


NM_000187.3(HGD):c.1102A>G ; c.469+2T>C ; NM_000187.3(HGD):c.674G>A ; NM_000187.3(HGD):c.175delA ; NM_000187.3(HGD):c.688C>T ; NM_000187.3(HGD):c.140C>T ; NM_000187.3(HGD):c.1111dupC ; NM_000187.3(HGD):c.342+1G>A ; c.1189-2A>G ; c.172A>T ; NM_000187.3(HGD):c.16-1G>A ; NM_000187.3(HGD):c.808G>A ; NM_000187.3(HGD):c.899T>G ; NM_000187.3(HGD):c.481G>A ; NM_000187.3(HGD):c.1102A>G ; c.469+2T>C ; NM_000187.3(HGD):c.674G>A ; NM_000187.3(HGD):c.175delA ; NM_000187.3(HGD):c.688C>T ; NM_000187.3(HGD):c.140C>T ; NM_000187.3(HGD):c.1111dupC ; NM_000187.3(HGD):c.342+1G>A ; c.1189-2A>G ; c.172A>T ; NM_000187.3(HGD):c.16-1G>A ; NM_000187.3(HGD):c.808G>A ; NM_000187.3(HGD):c.899T>G ; NM_000187.3(HGD):c.481G>A



Retinitis pigmentaria

La retinosis pigmentaria (RP) es una distrofia hereditaria de la retina que conduce a la pérdida progresiva de los fotorreceptores y del epitelio pigmentario de la retina y que provoca la ceguera generalmente después de varias décadas.


La retinosis pigmentaria es lentamente progresiva pero implacable. Sin embargo, existe una amplia variabilidad en la edad de inicio, la tasa de progresión y las manifestaciones clínicas secundarias. Los individuos afectados suelen desarrollar primero ceguera nocturna (nictalopía) debido a la pérdida de la función de los bastones, a menudo en la adolescencia o antes. A continuación, desarrollan un deterioro del campo visual periférico y, con el tiempo, la pérdida de la visión central, normalmente en etapas tardías, a menudo en torno a la mediana edad. La pérdida de agudeza visual central puede producirse a cualquier edad como resultado de un edema macular cistoide o de la pérdida de fotorreceptores. Las cataratas subcapsulares posteriores son frecuentes y su gravedad depende de la edad. También puede encontrarse una reducción de la visión de los colores. El examen del fondo de ojo revela depósitos de pigmento de espícula ósea, vasos retinianos atenuados, atrofia de la retina y palidez del nervio óptico. La gravedad está parcialmente correlacionada con el patrón de herencia: los casos ligados al cromosoma X son los más graves, los casos autosómicos recesivos y de ocurrencia única tienen una gravedad intermedia, y los autosómicos dominantes son los más favorables.

Síndrome de Sanfilippo tipo C

El síndrome de Sanfilippo comprende varias formas de enfermedades de almacenamiento lisosómico debidas a una degradación deficiente del heparán sulfato. La enzima deficiente en el síndrome de Sanfilippo C, o MPS IIIC, es una acetiltransferasa que cataliza la conversión de residuos de alfa-glucosaminida en N-acetilglucosaminida en presencia de acetil-CoA.


El síndrome de Sanfilippo, o mucopolisacaridosis III, es una enfermedad de almacenamiento lisosómico autosómica recesiva debida a una degradación deficiente del heparán sulfato. El trastorno se caracteriza por una grave degeneración del sistema nervioso central, pero sólo una leve enfermedad somática. El inicio de los rasgos clínicos suele producirse entre los 2 y los 6 años; la degeneración neurológica grave se produce en la mayoría de los pacientes entre los 6 y los 10 años de edad, y la muerte se produce normalmente durante la segunda o tercera década de vida. Se ha informado de que el tipo A es el más grave, con un inicio más temprano y una rápida progresión de los síntomas y una menor supervivencia.


NM_152419.2(HGSNAT):c.848C>T ; NM_152419.2(HGSNAT):c.607C>T ; c.1378-1G>A ; NM_152419.2(HGSNAT):c.1250+1G>A ; NM_152419.2(HGSNAT):c.1030C>T ; NM_152419.2(HGSNAT):c.1553C>T ; c.1503del ; NM_152419.2(HGSNAT):c.1464+1G>A ; NM_152419.2(HGSNAT):c.1622C>T ; NM_152419.2(HGSNAT):c.493+1G>A ; NM_152419.2(HGSNAT):c.848C>T ; NM_152419.2(HGSNAT):c.607C>T ; c.1378-1G>A ; NM_152419.2(HGSNAT):c.1250+1G>A ; NM_152419.2(HGSNAT):c.1030C>T ; NM_152419.2(HGSNAT):c.1553C>T ; c.1503del ; NM_152419.2(HGSNAT):c.1464+1G>A ; NM_152419.2(HGSNAT):c.1622C>T ; NM_152419.2(HGSNAT):c.493+1G>A



Aciduria 3-hidroxi-3-metilglutárica

Una rara aciduria orgánica, debida a la deficiencia de la 3-hidroxi-3-metilglutaril-CoA liasa, caracterizada por episodios de descompensación metabólica con hipoglucemia hipocetósica desencadenada por períodos de ayuno o infecciones.


La presentación clínica es heterogénea, desde un inicio neonatal grave con un desenlace potencialmente mortal hasta la presentación en la edad adulta. La mayoría de los pacientes se vuelven sintomáticos en el primer año de vida (50% en el periodo neonatal) con episodios de descompensación metabólica desencadenados por periodos de ayuno o infecciones, que cuando no se tratan pueden provocar secuelas neurológicas. Los recién nacidos o los lactantes presentan acidosis e hipoglucemia, acompañadas de vómitos, deshidratación, hipotonía y letargo. La descompensación aguda se desencadena por infecciones, vacunas y cambios en la dieta. Los hallazgos de laboratorio típicos incluyen hipoglucemia, acidosis, aumento de la brecha aniónica, hiperamonemia y transaminasas elevadas. Las complicaciones neurológicas a largo plazo son frecuentes. La mitad de los pacientes tienen un desarrollo cognitivo normal, mientras que el resto muestra déficits psicomotores. Son frecuentes los retrasos en el desarrollo del habla y la motricidad. La resonancia magnética cerebral revela con frecuencia una anomalía difusa en la intensidad de la señal de la sustancia blanca cerebral, los tálamos y los ganglios basales. Otras manifestaciones pueden ser macrocefalia, cardiomiopatía dilatada, arritmias, hepatomegalia y pancreatitis aguda. Los niños suelen estar sanos entre los episodios; las crisis agudas posteriores pueden ir precedidas de anorexia, letargo, cambios de comportamiento, irritabilidad y debilidad muscular. La hipoglucemia hipocetósica es característica.


c.230del ; NM_000191.3:c.122G>A ; NM_000191.2(HMGCL):c.206_207delCT ; NM_000191.2(HMGCL):c.835G>A ; NM_000191.2(HMGCL):c.698A>G ; NM_000191.2(HMGCL):c.505_506delTC ; c.230del ; NM_000191.3:c.122G>A ; NM_000191.2(HMGCL):c.206_207delCT ; NM_000191.2(HMGCL):c.835G>A ; NM_000191.2(HMGCL):c.698A>G ; NM_000191.2(HMGCL):c.505_506delTC




La hawkinsinuria es un error congénito del metabolismo de la tirosina que se caracteriza por un retraso en el desarrollo, una acidosis metabólica persistente, un cabello fino y escaso y la excreción en la orina de un metabolito inusual de aminoácidos cíclicos, la hawkinsina ((ácido 2-l-cisteína-S-il, 4-dihidroxiciclohex-5-en-1-il).


Los síntomas se manifiestan en los bebés alimentados con fórmula o leche de vaca o después del destete de la leche materna.

Tirosinemia tipo 3

La tirosinemia tipo 3 es un error congénito del metabolismo de la tirosina que se caracteriza por una hipertirosinemia leve y un aumento de la excreción urinaria de 4-hidroxifenilpiruvato, 4-hidroxifenilactato y 4-hidroxifenilacetato.


El cuadro clínico es muy variable y va desde los pacientes asintomáticos identificados a través de los estudios del programa de cribado neonatal hasta los pacientes con manifestaciones neurológicas que incluyen déficit intelectual y ataxia.


NM_001171993.1(HPD):c.483C>G ; c.987del ; NM_001171993.1(HPD):c.657T>G ; NM_001171993.1(HPD):c.483C>G ; c.987del ; NM_001171993.1(HPD):c.657T>G



Síndrome de Hermansky-Pudlak con fibrosis pulmonar

El síndrome de Hermansky-Pudlak con fibrosis pulmonar como complicación incluye dos tipos (HPS-1 y HPS-4) del síndrome de Hermansky-Pudlak (HPS; véase este término), un trastorno multisistémico caracterizado por albinismo oculocutáneo, diátesis hemorrágica y, en algunos casos, fibrosis pulmonar o colitis granulomatosa.


Las formas HPS-1 y HPS-4 presentan rasgos de HPS que incluyen albinismo oculocutáneo, agudeza visual reducida, nistagmo horizontal, fácil aparición de hematomas en los tejidos blandos, epistaxis y hemorragias prolongadas después de una extracción dental, cirugía o parto. Las mujeres pueden presentar una hemorragia menstrual importante desde el punto de vista médico. Las complicaciones del SPH pueden incluir colitis granulomatosa y fibrosis pulmonar. La fibrosis pulmonar es la complicación más grave del HPS-1 y el HPS-4 y suele presentarse en la cuarta o quinta década.


NM_000195.4(HPS1):c.1472_1487dup16 ; NM_000195.4(HPS1):c.398+5G>A ; NM_000195.3(HPS1):c.1996G>T ; NM_000195.4(HPS1):c.397G>T ; NM_000195.4(HPS1):c.972delC ; NM_000195.4(HPS1):c.1472_1487dup16 ; NM_000195.4(HPS1):c.398+5G>A ; NM_000195.3(HPS1):c.1996G>T ; NM_000195.4(HPS1):c.397G>T ; NM_000195.4(HPS1):c.972delC



Deficiencia enzimática bifuncional

Trastorno raro de la beta-oxidación peroxisomal caracterizado por la deficiencia de la proteína D-bifuncional peroxisomal, siendo el tipo 1 causado por la deficiencia de las actividades deshidrogenasa e hidratasa de la enzima, y los tipos 2 y 3 por la deficiencia de la hidatasa o deshidrogenasa solamente, mientras que el tipo 4 se debe a mutaciones heterocigotas compuestas que afectan a ambas unidades y representa un fenotipo clínicamente más leve. Los tipos 1-3 suelen ser mortales en la infancia. Los pacientes presentan un inicio temprano de hipotonía generalizada, convulsiones, retraso grave del desarrollo global, dismorfismo craneofacial (fontanela grande, frente alta, hipertelorismo, pliegues epicánticos) y elevación de los ácidos grasos de cadena muy larga en plasma. Las características variables incluyen hepatomegalia, polimicrogiria y anomalías de la sustancia blanca cerebral, entre otras.


La deficiencia de la proteína D-bifuncional es un trastorno de la beta-oxidación de los ácidos grasos peroxisomales. Las manifestaciones clínicas de esta deficiencia son similares a las de los trastornos del ensamblaje peroxisomal, incluyendo la adrenoleucodistrofia ligada al cromosoma X, el síndrome cerebrohepatorrenal de Zellweger y la adrenoleucodistrofia neonatal.

Síndrome de Perrault

El síndrome de Perrault (PS) se caracteriza por la asociación de disgenesia ovárica en las mujeres con una discapacidad auditiva neurosensorial. En informes más recientes sobre el SP, algunos autores han descrito anomalías neurológicas, especialmente ataxia cerebelosa progresiva y déficit intelectual.


La edad media de diagnóstico es de 22 años tras la presentación con retraso de la pubertad en las mujeres con sordera neurosensorial. Se han observado defectos de audición en todos los casos notificados excepto en uno (edad media de diagnóstico de 8 años). La pérdida de audición es siempre neurosensorial y bilateral, pero la gravedad es variable (de leve a profunda), incluso en pacientes afectados de la misma familia. Se ha informado de disgenesia ovárica en todos los casos femeninos, pero no se detectan defectos gonadales en los varones. La amenorrea suele ser primaria, pero también se ha descrito una amenorrea secundaria. En la mitad de los casos documentados se ha notificado un retraso en el crecimiento (estatura inferior al tercer percentil). Se desconoce la frecuencia exacta de las anomalías neurológicas, pero se han notificado nueve mujeres y dos varones (de 16 a 37 años) que carecen de anomalías neurológicas. Los signos neurológicos son progresivos y generalmente aparecen más tarde en la vida, sin embargo, se han observado retrasos en la marcha o caídas frecuentes tempranas en pacientes jóvenes con PS. Los signos neurológicos más comunes son ataxia, dispraxia, limitación de los movimientos extraoculares y polineuropatía. También se han descrito algunos casos con escoliosis.


NM_000414.3(HSD17B4):c.317G>C ; c.1047+1G>T ; NM_000414.3(HSD17B4):c.1369A>T ; NM_000414.3(HSD17B4):c.650A>G ; NM_000414.3(HSD17B4):c.46G>A ; NM_000414.3(HSD17B4):c.317G>C ; c.1047+1G>T ; NM_000414.3(HSD17B4):c.1369A>T ; NM_000414.3(HSD17B4):c.650A>G ; NM_000414.3(HSD17B4):c.46G>A




El hidroletismo (HLS) es un síndrome de malformación fetal grave caracterizado por rasgos dismórficos craneofaciales, anomalías del sistema nervioso central, cardíacas, del tracto respiratorio y de las extremidades.


La micrognatia y la retrognatia, el labio leporino/paladar hendido, la nariz mal formada, las orejas giradas hacia atrás y los ojos hundidos son los principales rasgos dismórficos craneofaciales que se observan en el HLS. Existe un defecto en la línea media del hueso occipital dorsal al foramen magnum, que da lugar a un defecto en forma de ojo de cerradura. Las anomalías cerebrales incluyen hidrocefalia y agenesia de las estructuras de la línea media, como el cuerpo calloso, el vermis cerebeloso y el septum pellucidum, lo que da lugar a un espacio abierto lleno de líquido entre los ventrículos laterales. El HLS también se caracteriza por la polidactilia postaxial y preaxial, respectivamente en las manos y los pies, estos últimos con forma de bastón. Aproximadamente la mitad de los pacientes presentan un gran defecto cardíaco septal. También se encuentra una lobulación anormal de los pulmones, estenosis de las vías respiratorias (laringe, tráquea o bronquios) y genitales anormales (incluyendo útero dúplex en las mujeres y testículos ectópicos en los hombres).

Síndrome de Joubert

Una rara ataxia cerebelosa congénita autosómica recesiva que se caracteriza por una malformación congénita del tronco cerebral y una agenesia o hipoplasia del vermis cerebeloso que da lugar a un patrón respiratorio anormal, nistagmo, hipotonía, ataxia y retraso en la consecución de los hitos motores.


El inicio de la enfermedad es prenatal, aunque la presentación clínica es típicamente en el periodo neonatal con un patrón respiratorio irregular (taquipnea y/o apnea episódica), y nistagmo. Durante la infancia, puede aparecer hipotonía. Más adelante puede aparecer ataxia cerebelosa (marcha tambaleante y desequilibrio). Es frecuente el retraso en la adquisición de los hitos motores. Las capacidades cognitivas son variables, desde un déficit intelectual grave hasta una inteligencia normal. El examen neurooftalmológico puede mostrar apraxia oculomotora. En algunos casos, se producen convulsiones. Un examen minucioso de la cara suele mostrar un aspecto característico: cabeza grande, frente prominente, cejas altas y redondeadas, pliegues epicánticos, ptosis (ocasionalmente), nariz respingona con orificios nasales prominentes, boca abierta (que tiende a tener una forma ovalada al principio, un aspecto "romboide" después y, finalmente, puede parecer triangular con ángulos hacia abajo), protrusión de la lengua y movimientos rítmicos de la misma, y ocasionalmente orejas de implantación baja e inclinadas. Otros rasgos que a veces presenta el síndrome de Joubert son la distrofia de la retina, la hepatopatía, la nefronopatía y la polidactilia.


c.669G>A ; NM_145014.2(HYLS1):c.632A>G ; c.724C>T ; c.669G>A ; NM_145014.2(HYLS1):c.632A>G ; c.724C>T



Mucopolisacaridosis tipo 2, forma atenuada

La mucopolisacaridosis tipo 2, forma atenuada (MPS2att), la forma menos grave de la MPS2 (véase este término), da lugar a una acumulación masiva de glucosaminoglicanos y a una amplia variedad de síntomas que incluyen facies distintiva, baja estatura, hallazgos cardiorrespiratorios y esqueléticos. Se diferencia de la mucopolisacaridosis tipo 2, forma grave (ver este término) por la ausencia de deterioro cognitivo.


La MPS2att es clínicamente heterogénea y su tasa de progresión es muy variable. Los pacientes parecen sanos al nacer, con síntomas iniciales sutiles que aparecen entre los 18 meses y los 4 años de edad o incluso más tarde, en particular la hernia umbilical o inguinal. Una facies distintiva (engrosamiento de los labios y las fosas nasales, lengua agrandada y protuberante), se forma lentamente y puede observarse por primera vez a los 2-4 años de edad (a menudo no es evidente hasta más tarde). La inflamación del tracto respiratorio superior puede ser responsable de infecciones frecuentes, en particular otitis media; ronquidos excesivos y apnea del sueño; una voz ronca característica y pérdida progresiva de la audición. Durante la primera infancia, el crecimiento se retrasa y los pacientes tienen una estatura baja con disostosis múltiple y articulaciones rígidas que pueden hacer que el movimiento sea doloroso; también puede producirse una displasia de cadera. Las articulaciones de las falanges están universalmente contraídas, lo que da lugar a manos en forma de garra; es frecuente el síndrome del túnel carpiano. También puede producirse una paresia espástica debido a la compresión de la médula espinal en la región craneocervical. La presión ejercida sobre el nervio óptico puede conducir a la pérdida de visión y en algunos casos se ha informado de degeneración de la retina. Los pacientes de la MPS2att, en general, no presentan alteraciones cognitivas.

Mucopolisacaridosis tipo 2, forma grave

Enfermedad rara por almacenamiento de lípidos lisosomales que se caracteriza por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal o colestasis prolongada e inexplicable, esplenomegalia aislada e inexplicable, y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


La MPS2S se presenta con el espectro de síntomas observados en todos los casos de MSP2 (véase este término), a menudo con una presentación más temprana. Los pacientes con MPS2S presentan una disminución de la tasa de crecimiento a principios o mediados de la infancia, junto con dificultades respiratorias y un engrosamiento de los labios y las fosas nasales, así como una lengua agrandada y protuberante (facies distintiva), que puede hacerse evidente entre los 2 y los 4 años de edad. Los hitos psicomotores se retrasan y a menudo se produce una regresión. Entre los 2 y los 6 años, los pacientes empiezan a mostrar un comportamiento agresivo e hiperactivo, y a menudo carecen de sentido del peligro mientras siguen un curso de deterioro cognitivo progresivo. La visión puede verse afectada, y en la mayoría de los casos se produce una pérdida progresiva de la audición. Son frecuentes el engrosamiento del miocardio y la disfunción de las válvulas cardíacas. Aproximadamente el 60-80% de los pacientes con MPS2 tienen la forma grave de la enfermedad con implicaciones neurológicas.


NM_000202.7(IDS):c.1505G>C ; c.278del ; NM_000202.7(IDS):c.317_318insTCAA ; NM_000202.6:c.388_389insG ; NM_000202.7(IDS):c.1122C>T ; NM_000202.7(IDS):c.597del ; NM_000202.7(IDS):c.208dupC ; NM_000202.7(IDS):c.1148delC ; NM_000202.7(IDS):c.514C>T ; NM_000202.7(IDS):c.690_691insT ; c.240+1G>A ; NM_000202.7(IDS):c.404A>G ; c.596_599del ; NM_000202.7(IDS):c.1508T>A ; NM_000202.7(IDS):c.998C>T ; NM_000202.7(IDS):c.587T>C ; NM_000202.7(IDS):c.1505G>C ; c.278del ; NM_000202.7(IDS):c.317_318insTCAA ; NM_000202.6:c.388_389insG ; NM_000202.7(IDS):c.1122C>T ; NM_000202.7(IDS):c.597del ; NM_000202.7(IDS):c.208dupC ; NM_000202.7(IDS):c.1148delC ; NM_000202.7(IDS):c.514C>T ; NM_000202.7(IDS):c.690_691insT ; c.240+1G>A ; NM_000202.7(IDS):c.404A>G ; c.596_599del ; NM_000202.7(IDS):c.1508T>A ; NM_000202.7(IDS):c.998C>T ; NM_000202.7(IDS):c.587T>C



Disautonomía familiar

Es una neuropatía hereditaria sensitiva y autonómica poco frecuente caracterizada por una disminución de la percepción dolorosa y de la temperatura, ausencia de reflejos tendinosos profundos, ataxia propioceptiva, alteración del barorreflejo aferente y neuropatía óptica progresiva.


La enfermedad está presente en el nacimiento y es progresiva. Los síntomas iniciales (desde el nacimiento hasta los 3 años) incluyen problemas de deglución, neumonía por aspiración, hipotonía, inestabilidad de la temperatura corporal y retraso del desarrollo. La ausencia de papilas linguales fungiformes y de lágrimas con el llanto emocional son dos rasgos característicos, pero no se reconocen fácilmente (la lengua parece poco visible y la ausencia de lágrimas por llanto es normal hasta aproximadamente los siete meses de edad). Los pacientes no presentan dismorfia patente al nacimiento, pero con el tiempo desarrollan una expresión facial característica. La percepción del dolor y la temperatura están disminuidas, pero no ausentes. La propiocepción y la sensibilidad vibratoria están notablemente reducidas. Los reflejos tendinosos profundos están ausentes. Las dificultades de alimentación debido a la dismotilidad gastrointestinal (incoordinación orofaríngea, peristalsis esofágica anómala, vaciamiento gástrico errático, reflujo gastroesofágico) se presentan precozmente y pueden persistir durante toda la vida. Los episodios prolongados de vómitos e hipertensión, denominados "crisis autonómicas", pueden ser recurrentes. El 40% de los pacientes manifiesta un patrón cíclico de crisis que puede ocurrir diariamente, semanalmente o mensualmente, con cambios de personalidad que van desde irritabilidad y retraimiento hasta excitación generalizada. La enfermedad pulmonar crónica (secundaria a aspiraciones repetidas), la enfermedad pulmonar restrictiva (impuesta por la escoliosis) y la disfunción quimiorreceptora (que disminuye la respuesta a la hipoxemia) son frecuentes. La hipotensión ortostática sin taquicardia compensatoria está presente siempre, así como la hipertensión episódica en respuesta al estrés emocional o al dolor visceral. La insuficiencia renal crónica es común. La neuropatía óptica progresiva y la queratopatía neurotrófica provocan una pérdida visual grave. Existe una amplia variabilidad fenotípica, particularmente en las habilidades cognitivas. Son comunes una cifoescoliosis marcada y talla baja.


NM_003640.5:c.2087G>C ; c.2328del ; NM_003640.5:c.2204+6T>C ; c.3332del ; c.1460+2T>C ; NM_003640.5:c.2087G>C ; c.2328del ; NM_003640.5:c.2204+6T>C ; c.3332del ; c.1460+2T>C



Síndrome de Omenn

El síndrome de Omenn (OS) es una enfermedad inflamatoria caracterizada por eritrodermia, descamación, alopecia, diarrea crónica, retraso en el desarrollo, linfadenopatía y hepatoesplenomegalia, asociada a una inmunodeficiencia combinada grave (SCID; véase este término).


El OS se presenta durante el primer año de vida con características de SCID, incluyendo diarrea crónica, neumonitis y retraso en el crecimiento. Además, los pacientes presentan síntomas inflamatorios que incluyen linfadenopatía, hepatoesplenomegalia y eritrodermia generalizada, que a menudo puede causar alopecia y pérdida de cejas y pestañas; la pérdida de proteínas puede provocar edema generalizado y alteraciones metabólicas. Los signos y síntomas del OS pueden evolucionar con el tiempo y pueden no aparecer simultáneamente. Algunos pacientes presentan algunos de estos síntomas, pero no todos, y pueden describirse como síndrome de Omenn atípico. El OS también puede estar asociado a trastornos sindrómicos, como la hipoplasia cartilaginosa (CHH), la deficiencia de adenosina deaminasa (ADA), la monosomía 22q11, el coloboma ocular, el síndrome CHARGE y la deficiencia de ligasa 4 (consulte estos términos).

Inmunodeficiencia combinada grave T-B+ por deficiencia de la cadena gamma

La IDCG-X1 se manifiesta durante los primeros meses de vida con infecciones víricas, bacterianas o fúngicas graves y, a menudo, potencialmente mortales (por ejemplo, neumonitis por Pneumocystis jiroveci, infección por BCG diseminada si se ha vacunado previamente), y retraso en el desarrollo. La diarrea crónica es un hallazgo frecuente. Algunos pacientes pueden presentar erupciones cutáneas y anomalías de la función hepática. La enfermedad de injerto contra huésped asociada a la transfusión materno-fetal también se asocia a la enfermedad. Los hallazgos inmunológicos son linfopenia con ausencia de células T y NK, hipogammaglobulinemia y recuento normal o aumentado de células B.


La IDCG-X1 se manifiesta durante los primeros meses de vida con infecciones víricas, bacterianas o fúngicas graves y, a menudo, potencialmente mortales (por ejemplo, neumonitis por Pneumocystis jiroveci, infección por BCG diseminada si se ha vacunado previamente), y retraso en el desarrollo. La diarrea crónica es un hallazgo frecuente. Algunos pacientes pueden presentar erupciones cutáneas y anomalías de la función hepática. La enfermedad de injerto contra huésped asociada a la transfusión materno-fetal también se asocia a la enfermedad. Los hallazgos inmunológicos son linfopenia con ausencia de células T y NK, hipogammaglobulinemia y recuento normal o aumentado de células B.


NM_000206.2(IL2RG):c.341G>A ; NM_000206.2(IL2RG):c.355A>T ; NM_000206.2(IL2RG):c.452T>C ; NM_000206.2(IL2RG):c.854G>A ; NM_000206.2(IL2RG):c.664C>T ; NM_000206.2(IL2RG):c.454+1G>A ; NM_000206.2(IL2RG):c.343T>C ; NM_000206.2(IL2RG):c.186T>A ; NM_000206.2(IL2RG):c.341G>A ; NM_000206.2(IL2RG):c.355A>T ; NM_000206.2(IL2RG):c.452T>C ; NM_000206.2(IL2RG):c.854G>A ; NM_000206.2(IL2RG):c.664C>T ; NM_000206.2(IL2RG):c.454+1G>A ; NM_000206.2(IL2RG):c.343T>C ; NM_000206.2(IL2RG):c.186T>A



Acidemia isovalérica

Una aciduria orgánica rara, autosómica recesiva, que se caracteriza por una presentación clínica variable que va desde un inicio neonatal agudo de descompensación metabólica hasta la aparición posterior de manifestaciones crónicas e inespecíficas que incluyen retraso en el crecimiento y/o en el desarrollo. Todos los pacientes son propensos a una descompensación metabólica aguda e intermitente. Durante los episodios metabólicos, los análisis de orina demuestran que los derivados del ácido isovalérico son elevados.


Los pacientes se presentan a lo largo de un espectro. La presentación neonatal aguda se caracteriza por un inicio en las dos primeras semanas de vida con vómitos, convulsiones y letargo, que progresa hasta el coma. La acidosis metabólica con un aumento de la brecha aniónica es evidente en la evaluación de laboratorio. Puede haber hiperamonemia. La aparición posterior es relativamente inespecífica, con retraso en el crecimiento y/o en el desarrollo. Los pacientes que han sobrevivido a una presentación aguda temprana son posteriormente indistinguibles de aquellos con el fenotipo crónico. Todos los pacientes son propensos a episodios agudos intermitentes de descompensación con enfermedades menores. La acidosis metabólica de inicio en la infancia suele producirse por un ayuno prolongado, un aumento de la ingesta de alimentos ricos en proteínas o infecciones, y puede ser mortal si no se trata inmediatamente. El olor característico del ácido isovalérico puede estar presente, y se asemeja al sudor de los pies/del cuerpo. Aunque en algunos pacientes se producen retrasos graves en el desarrollo y secuelas neurológicas, es probable que estén relacionados con presentaciones bioquímicas graves.


NM_002225.3(IVD):c.157C>T ; NM_002225.3(IVD):c.134T>C ; c.1057+5_1057+8del ; c.388_389insGT ; NM_002225.4(IVD):c.149G>C ; NM_002225.4(IVD):c.1199A>G ; NM_002225.3(IVD):c.559+1G>A ; c.503G>A ; c.904_905del ; NM_002225.3(IVD):c.507delG ; NM_002225.4(IVD):c.149G>A ; c.243+1G>A ; NM_002225.4(IVD):c.784+1G>A ; NM_002225.4(IVD):c.1183C>T ; NM_002225.3(IVD):c.367G>A ; c.1055_1057+4del ; NM_002225.4(IVD):c.1174C>T ; NM_002225.3(IVD):c.1141T>C ; NM_002225.3(IVD):c.390delT ; NM_002225.3(IVD):c.605G>T ; c.344_347dup ; NM_002225.3(IVD):c.406_407delTG ; NM_002225.3(IVD):c.465+2T>C ; NM_002225.3(IVD):c.941C>T ; NM_002225.3(IVD):c.1188delT ; NM_002225.3(IVD):c.157C>T ; NM_002225.3(IVD):c.134T>C ; c.1057+5_1057+8del ; c.388_389insGT ; NM_002225.4(IVD):c.149G>C ; NM_002225.4(IVD):c.1199A>G ; NM_002225.3(IVD):c.559+1G>A ; c.503G>A ; c.904_905del ; NM_002225.3(IVD):c.507delG ; NM_002225.4(IVD):c.149G>A ; c.243+1G>A ; NM_002225.4(IVD):c.784+1G>A ; NM_002225.4(IVD):c.1183C>T ; NM_002225.3(IVD):c.367G>A ; c.1055_1057+4del ; NM_002225.4(IVD):c.1174C>T ; NM_002225.3(IVD):c.1141T>C ; NM_002225.3(IVD):c.390delT ; NM_002225.3(IVD):c.605G>T ; c.344_347dup ; NM_002225.3(IVD):c.406_407delTG ; NM_002225.3(IVD):c.465+2T>C ; NM_002225.3(IVD):c.941C>T ; NM_002225.3(IVD):c.1188delT



Distrofia muscular congénita relacionada con la subunidad alfa 2 de la laminina

La distrofia muscular congénita de tipo 1A (MCD1A) pertenece a un grupo de trastornos neuromusculares con inicio en el nacimiento o en la infancia caracterizados por hipotonía, debilidad muscular y desgaste muscular.


La enfermedad se presenta al nacer o en los primeros meses de vida con hipotonía y debilidad muscular en las extremidades y el tronco. También pueden aparecer trastornos respiratorios y de alimentación. El desarrollo motor está retrasado y limitado (sólo es posible sentarse o ponerse de pie con ayuda). Los bebés presentan una rigidez temprana de la columna vertebral, escoliosis e insuficiencia respiratoria. Hay afectación facial con una cara alargada típica de las miopías y pueden aparecer posteriormente trastornos oftalmológicos oculares. Los ataques epilépticos son posibles, aunque se producen en menos de un tercio de los pacientes. El desarrollo intelectual es normal.


c.1612C>T ; c.9221del ; NM_000426.3(LAMA2):c.6955C>T ; NM_000426.3(LAMA2):c.3718C>T ; NM_000426.3(LAMA2):c.2962C>T ; c.8748del ; c.2323-2A>T ; NM_000426.3(LAMA2):c.3623_3645del23 ; NM_000426.3(LAMA2):c.4645C>T ; c.8705del ; NM_000426.3(LAMA2):c.7279_7280delCT ; c.5227G>T ; c.6617del ; NM_000426.3(LAMA2):c.112+1G>A ; c.2098_2099del ; c.1050del ; NM_000426.3(LAMA2):c.184G>T ; c.8314del ; NM_000426.3(LAMA2):c.5050G>T ; NM_000426.3(LAMA2):c.3976C>T ; NM_000426.3(LAMA2):c.2750-1G>C ; NM_000426.3(LAMA2):c.9101_9104dupAACA ; NM_000426.3(LAMA2):c.2451-2A>G ; NM_000426.3(LAMA2):c.3630delT ; NM_000426.3(LAMA2):c.825delC ; NM_000426.3(LAMA2):c.2901C>A ; NM_000426.3(LAMA2):c.6038delT ; NM_000426.3(LAMA2):c.6011delA ; c.6429+1G>A ; NM_000426.3(LAMA2):c.7810C>T ; c.6334A>T ; NM_000426.3(LAMA2):c.7732C>T ; NM_000426.3(LAMA2):c.3237C>A ; NM_000426.3(LAMA2):c.3215delG ; NM_000426.3(LAMA2):c.7147C>T ; NM_000426.3(LAMA2):c.7536delC ; c.1612C>T ; c.9221del ; NM_000426.3(LAMA2):c.6955C>T ; NM_000426.3(LAMA2):c.3718C>T ; NM_000426.3(LAMA2):c.2962C>T ; c.8748del ; c.2323-2A>T ; NM_000426.3(LAMA2):c.3623_3645del23 ; NM_000426.3(LAMA2):c.4645C>T ; c.8705del ; NM_000426.3(LAMA2):c.7279_7280delCT ; c.5227G>T ; c.6617del ; NM_000426.3(LAMA2):c.112+1G>A ; c.2098_2099del ; c.1050del ; NM_000426.3(LAMA2):c.184G>T ; c.8314del ; NM_000426.3(LAMA2):c.5050G>T ; NM_000426.3(LAMA2):c.3976C>T ; NM_000426.3(LAMA2):c.2750-1G>C ; NM_000426.3(LAMA2):c.9101_9104dupAACA ; NM_000426.3(LAMA2):c.2451-2A>G ; NM_000426.3(LAMA2):c.3630delT ; NM_000426.3(LAMA2):c.825delC ; NM_000426.3(LAMA2):c.2901C>A ; NM_000426.3(LAMA2):c.6038delT ; NM_000426.3(LAMA2):c.6011delA ; c.6429+1G>A ; NM_000426.3(LAMA2):c.7810C>T ; c.6334A>T ; NM_000426.3(LAMA2):c.7732C>T ; NM_000426.3(LAMA2):c.3237C>A ; NM_000426.3(LAMA2):c.3215delG ; NM_000426.3(LAMA2):c.7147C>T ; NM_000426.3(LAMA2):c.7536delC



Epidermólisis bullosa generalizada intermedia

La epidermólisis bullosa juntural generalizada no tipo Herlitz es una forma de epidermólisis bullosa juntural no tipo Herlitz (JEB-nH, ver este término) que se caracteriza por la formación de ampollas generalizadas en la piel, cicatrices atróficas, distrofia ungueal o ausencia de uñas, e hipoplasia del esmalte, con afectación extracutánea.


La enfermedad se manifiesta clínicamente al nacer. La formación de ampollas en la piel es generalizada y la curación puede producirse con cicatrices atróficas, a veces acompañadas de hipopigmentación o hiperpigmentación o, con menor frecuencia, con la formación de un tejido de granulación exuberante. La distrofia o pérdida de uñas es una característica constante, pudiendo desarrollarse queratodermia focal con el tiempo. Es frecuente la pérdida progresiva y permanente del cabello, que afecta al cuero cabelludo, las pestañas y las cejas; el vello púbico y axilar es escaso o no se desarrolla completamente. Las lesiones de la mucosa afectan principalmente a la cavidad oral y nasal, aunque existe una considerable variabilidad individual. La afectación ocular se ha descrito en algunos pacientes y comprende erosiones y cicatrices en la córnea y, raramente, ectropión. Los dientes muestran regularmente hipoplasia del esmalte, lo que provoca caries graves. La anemia crónica de etiología multifactorial, aunque de gravedad variable, es frecuente y puede estar asociada a un retraso del crecimiento.


La epidermólisis bullosa juntural generalizada no tipo Herlitz es una forma de epidermólisis bullosa juntural no tipo Herlitz (JEB-nH, ver este término) que se caracteriza por la formación de ampollas generalizadas en la piel, cicatrices atróficas, distrofia ungueal o ausencia de uñas, e hipoplasia del esmalte, con afectación extracutánea.


La enfermedad se manifiesta clínicamente al nacer. La formación de ampollas en la piel es generalizada y la curación puede producirse con cicatrices atróficas, a veces acompañadas de hipopigmentación o hiperpigmentación o, con menor frecuencia, con la formación de un tejido de granulación exuberante. La distrofia o pérdida de uñas es una característica constante, pudiendo desarrollarse queratodermia focal con el tiempo. Es frecuente la pérdida progresiva y permanente del cabello, que afecta al cuero cabelludo, las pestañas y las cejas; el vello púbico y axilar es escaso o no se desarrolla completamente. Las lesiones de la mucosa afectan principalmente a la cavidad oral y nasal, aunque existe una considerable variabilidad individual. La afectación ocular se ha descrito en algunos pacientes y comprende erosiones y cicatrices en la córnea y, raramente, ectropión. Los dientes muestran regularmente hipoplasia del esmalte, lo que provoca caries graves. La anemia crónica de etiología multifactorial, aunque de gravedad variable, es frecuente y puede estar asociada a un retraso del crecimiento.

Síndrome laringo-ónicocutáneo

El síndrome de LOC es un subtipo de epidermólisis bullosa juntural (JEB, véase este término) caracterizado por una alteración del llanto en el periodo neonatal y por una producción aberrante de tejido de granulación que afecta en particular al tracto de las vías respiratorias superiores, a la conjuntiva y a las zonas periungueales/subungueales.


La enfermedad está presente en el nacimiento. Los hallazgos cutáneos característicos son ampollas transitorias que dejan erosiones de curación lenta con formación de tejido de granulación exuberante, localizadas principalmente en la cabeza y el cuello, las manos, los pies, los codos y las rodillas. Siempre se observan manifestaciones extracutáneas: la afectación laríngea progresiva conduce con frecuencia a una obstrucción respiratoria mortal en la infancia, y las lesiones conjuntivales crónicas provocan la formación de simblefaron, así como la oclusión palpebral total y la ceguera. La hipoplasia del esmalte también está siempre presente y las distrofias de las uñas son frecuentes.

Epidermólisis bullosa juntural generalizada severa

La epidermólisis bullosa juntural, tipo Herlitz, es un subtipo grave de epidermólisis bullosa juntural (JEB, véase este término) caracterizado por ampollas y erosiones extensas, localizadas en la piel y las membranas mucosas.


La afección está presente al nacer. El tejido de granulación exuberante es una manifestación característica, que suele surgir entre los primeros meses y uno o dos años de vida, y puede afectar a la piel (alrededor de los pliegues ungueales, en una distribución similar a una máscara en la cara y en lugares de fricción, como los hombros y las nalgas) y a las vías respiratorias superiores. La afectación de las mucosas puede afectar a todo el tracto gastrointestinal (GI), el tracto genitourinario y el tracto respiratorio hasta los bronquiolos. Sin embargo, las lesiones mucosas más significativas y frecuentes son las de la parte superior del tracto gastrointestinal y respiratorio. Las numerosas erosiones y ulceraciones de la mucosa oral dificultan gravemente la alimentación, y la afectación de la mucosa laringotraqueal, que se manifiesta con ronquera, disnea y estridor, puede conducir a una insuficiencia respiratoria aguda que requiera traqueotomía. Otras características constantes son las anomalías ungueales con paroniquia, diversos grados de onicodistrofia y desprendimiento de uñas. Las anomalías dentales, cuando la supervivencia permite su observación, incluyen regularmente hipoplasia marcada o ausencia completa de esmalte. Las lesiones oculares frecuentes comprenden ampollas, erosiones y cicatrices en la córnea y formación de ectropiones. El retraso en el crecimiento es un hallazgo casi constante en la JEB-H, y la anemia multifactorial también es frecuente.


La epidermólisis bullosa juntural, tipo Herlitz, es un subtipo grave de epidermólisis bullosa juntural (JEB, véase este término) caracterizado por ampollas y erosiones extensas, localizadas en la piel y las membranas mucosas.


La afección está presente al nacer. El tejido de granulación exuberante es una manifestación característica, que suele surgir entre los primeros meses y uno o dos años de vida, y puede afectar a la piel (alrededor de los pliegues ungueales, en una distribución similar a una máscara en la cara y en lugares de fricción, como los hombros y las nalgas) y a las vías respiratorias superiores. La afectación de las mucosas puede afectar a todo el tracto gastrointestinal (GI), el tracto genitourinario y el tracto respiratorio hasta los bronquiolos. Sin embargo, las lesiones mucosas más significativas y frecuentes son las de la parte superior del tracto gastrointestinal y respiratorio. Las numerosas erosiones y ulceraciones de la mucosa oral dificultan gravemente la alimentación, y la afectación de la mucosa laringotraqueal, que se manifiesta con ronquera, disnea y estridor, puede conducir a una insuficiencia respiratoria aguda que requiera traqueotomía. Otras características constantes son las anomalías ungueales con paroniquia, diversos grados de onicodistrofia y desprendimiento de uñas. Las anomalías dentales, cuando la supervivencia permite su observación, incluyen regularmente hipoplasia marcada o ausencia completa de esmalte. Las lesiones oculares frecuentes comprenden ampollas, erosiones y cicatrices en la córnea y formación de ectropiones. El retraso en el crecimiento es un hallazgo casi constante en la JEB-H, y la anemia multifactorial también es frecuente.

Amelogénesis imperfecta hipoplásica

Trastorno odontológico o periodontal genético poco frecuente que representa un grupo de condiciones de desarrollo que afectan a la estructura y al aspecto clínico del esmalte de todos o casi todos los dientes de forma más o menos igual, y que puede estar asociado a cambios morfológicos o bioquímicos en otras partes del cuerpo.


El esmalte puede ser hipoplásico, hipomineralizado o ambos, y los dientes afectados pueden estar descoloridos, ser sensibles o tener tendencia a la desintegración. La amelogénesis imperfecta (AI) existe de forma aislada o asociada a otras anomalías como parte de un síndrome.


Trastorno odontológico o periodontal genético poco frecuente que representa un grupo de condiciones de desarrollo que afectan a la estructura y al aspecto clínico del esmalte de todos o casi todos los dientes de forma más o menos igual, y que puede estar asociado a cambios morfológicos o bioquímicos en otras partes del cuerpo.


El esmalte puede ser hipoplásico, hipomineralizado o ambos, y los dientes afectados pueden estar descoloridos, ser sensibles o tener tendencia a la desintegración. La amelogénesis imperfecta (AI) existe de forma aislada o asociada a otras anomalías como parte de un síndrome.


c.4878dup ; c.4335dup ; NM_198129.2(LAMA3):c.6943A>T ; c.1182del ; c.335del ; NM_000227.4(LAMA3):c.2662C>T ; NM_000227.4(LAMA3):c.1981C>T ; NM_198129.2(LAMA3):c.8962C>T ; NM_000227.4(LAMA3):c.3350+2T>G ; c.4878dup ; c.4335dup ; NM_198129.2(LAMA3):c.6943A>T ; c.1182del ; c.335del ; NM_000227.4(LAMA3):c.2662C>T ; NM_000227.4(LAMA3):c.1981C>T ; NM_198129.2(LAMA3):c.8962C>T ; NM_000227.4(LAMA3):c.3350+2T>G



Epidermólisis bullosa generalizada intermedia

La epidermólisis bullosa juntural generalizada no tipo Herlitz es una forma de epidermólisis bullosa juntural no tipo Herlitz (JEB-nH, ver este término) que se caracteriza por la formación de ampollas generalizadas en la piel, cicatrices atróficas, distrofia ungueal o ausencia de uñas, e hipoplasia del esmalte, con afectación extracutánea.


La enfermedad se manifiesta clínicamente al nacer. La formación de ampollas en la piel es generalizada y la curación puede producirse con cicatrices atróficas, a veces acompañadas de hipopigmentación o hiperpigmentación o, con menor frecuencia, con la formación de un tejido de granulación exuberante. La distrofia o pérdida de uñas es una característica constante, pudiendo desarrollarse queratodermia focal con el tiempo. Es frecuente la pérdida progresiva y permanente del cabello, que afecta al cuero cabelludo, las pestañas y las cejas; el vello púbico y axilar es escaso o no se desarrolla completamente. Las lesiones de la mucosa afectan principalmente a la cavidad oral y nasal, aunque existe una considerable variabilidad individual. La afectación ocular se ha descrito en algunos pacientes y comprende erosiones y cicatrices en la córnea y, raramente, ectropión. Los dientes muestran regularmente hipoplasia del esmalte, lo que provoca caries graves. La anemia crónica de etiología multifactorial, aunque de gravedad variable, es frecuente y puede estar asociada a un retraso del crecimiento.

Epidermólisis bullosa juntural generalizada severa

La epidermólisis bullosa juntural, tipo Herlitz, es un subtipo grave de epidermólisis bullosa juntural (JEB, véase este término) caracterizado por ampollas y erosiones extensas, localizadas en la piel y las membranas mucosas.


La afección está presente al nacer. El tejido de granulación exuberante es una manifestación característica, que suele surgir entre los primeros meses y uno o dos años de vida, y puede afectar a la piel (alrededor de los pliegues ungueales, en una distribución similar a una máscara en la cara y en lugares de fricción, como los hombros y las nalgas) y a las vías respiratorias superiores. La afectación de las mucosas puede afectar a todo el tracto gastrointestinal (GI), el tracto genitourinario y el tracto respiratorio hasta los bronquiolos. Sin embargo, las lesiones mucosas más significativas y frecuentes son las de la parte superior del tracto gastrointestinal y respiratorio. Las numerosas erosiones y ulceraciones de la mucosa oral dificultan gravemente la alimentación, y la afectación de la mucosa laringotraqueal, que se manifiesta con ronquera, disnea y estridor, puede conducir a una insuficiencia respiratoria aguda que requiera traqueotomía. Otras características constantes son las anomalías ungueales con paroniquia, diversos grados de onicodistrofia y desprendimiento de uñas. Las anomalías dentales, cuando la supervivencia permite su observación, incluyen regularmente hipoplasia marcada o ausencia completa de esmalte. Las lesiones oculares frecuentes comprenden ampollas, erosiones y cicatrices en la córnea y formación de ectropiones. El retraso en el crecimiento es un hallazgo casi constante en la JEB-H, y la anemia multifactorial también es frecuente.


NM_000228.2(LAMB3):c.2806C>T ; NM_000228.2(LAMB3):c.124C>T ; c.1357del ; c.628+1del ; c.3228+1G>A ; NM_000228.2(LAMB3):c.1830G>A ; c.3228+1G>T ; NM_000228.2(LAMB3):c.727C>T ; NM_000228.2(LAMB3):c.904del ; NM_000228.2(LAMB3):c.496C>T ; NM_000228.2(LAMB3):c.1903C>T ; c.1438_1442del ; NM_000228.2(LAMB3):c.1587_1588delAG ; NM_000228.2(LAMB3):c.565-2A>G ; NM_000228.2(LAMB3):c.628G>A ; NM_000228.2(LAMB3):c.2806C>T ; NM_000228.2(LAMB3):c.124C>T ; c.1357del ; c.628+1del ; c.3228+1G>A ; NM_000228.2(LAMB3):c.1830G>A ; c.3228+1G>T ; NM_000228.2(LAMB3):c.727C>T ; NM_000228.2(LAMB3):c.904del ; NM_000228.2(LAMB3):c.496C>T ; NM_000228.2(LAMB3):c.1903C>T ; c.1438_1442del ; NM_000228.2(LAMB3):c.1587_1588delAG ; NM_000228.2(LAMB3):c.565-2A>G ; NM_000228.2(LAMB3):c.628G>A



Epidermólisis bullosa generalizada intermedia

La epidermólisis bullosa juntural generalizada no tipo Herlitz es una forma de epidermólisis bullosa juntural no tipo Herlitz (JEB-nH, ver este término) que se caracteriza por la formación de ampollas generalizadas en la piel, cicatrices atróficas, distrofia ungueal o ausencia de uñas, e hipoplasia del esmalte, con afectación extracutánea.


La enfermedad se manifiesta clínicamente al nacer. La formación de ampollas en la piel es generalizada y la curación puede producirse con cicatrices atróficas, a veces acompañadas de hipopigmentación o hiperpigmentación o, con menor frecuencia, con la formación de un tejido de granulación exuberante. La distrofia o pérdida de uñas es una característica constante, pudiendo desarrollarse queratodermia focal con el tiempo. Es frecuente la pérdida progresiva y permanente del cabello, que afecta al cuero cabelludo, las pestañas y las cejas; el vello púbico y axilar es escaso o no se desarrolla completamente. Las lesiones de la mucosa afectan principalmente a la cavidad oral y nasal, aunque existe una considerable variabilidad individual. La afectación ocular se ha descrito en algunos pacientes y comprende erosiones y cicatrices en la córnea y, raramente, ectropión. Los dientes muestran regularmente hipoplasia del esmalte, lo que provoca caries graves. La anemia crónica de etiología multifactorial, aunque de gravedad variable, es frecuente y puede estar asociada a un retraso del crecimiento.

Epidermólisis bullosa juntural inversa

La epidermólisis bullosa juntural inversa es un subtipo grave poco frecuente de la epidermólisis bullosa juntural (JEB, véase este término) que se caracteriza por la aparición de ampollas y erosiones limitadas a las zonas intertriginosas de la piel, el esófago y la vagina.



Epidermólisis bullosa juntural generalizada severa

La epidermólisis bullosa juntural, tipo Herlitz, es un subtipo grave de epidermólisis bullosa juntural (JEB, véase este término) caracterizado por ampollas y erosiones extensas, localizadas en la piel y las membranas mucosas.


La afección está presente al nacer. El tejido de granulación exuberante es una manifestación característica, que suele surgir entre los primeros meses y uno o dos años de vida, y puede afectar a la piel (alrededor de los pliegues ungueales, en una distribución similar a una máscara en la cara y en lugares de fricción, como los hombros y las nalgas) y a las vías respiratorias superiores. La afectación de las mucosas puede afectar a todo el tracto gastrointestinal (GI), el tracto genitourinario y el tracto respiratorio hasta los bronquiolos. Sin embargo, las lesiones mucosas más significativas y frecuentes son las de la parte superior del tracto gastrointestinal y respiratorio. Las numerosas erosiones y ulceraciones de la mucosa oral dificultan gravemente la alimentación, y la afectación de la mucosa laringotraqueal, que se manifiesta con ronquera, disnea y estridor, puede conducir a una insuficiencia respiratoria aguda que requiera traqueotomía. Otras características constantes son las anomalías ungueales con paroniquia, diversos grados de onicodistrofia y desprendimiento de uñas. Las anomalías dentales, cuando la supervivencia permite su observación, incluyen regularmente hipoplasia marcada o ausencia completa de esmalte. Las lesiones oculares frecuentes comprenden ampollas, erosiones y cicatrices en la córnea y formación de ectropiones. El retraso en el crecimiento es un hallazgo casi constante en la JEB-H, y la anemia multifactorial también es frecuente.


NM_005562.2:c.3120_3121insA ; NM_005562.2(LAMC2):c.1659C>A ; NM_005562.2(LAMC2):c.2137_2143delCAGAACC ; c.3069+1G>A ; c.3512dup ; NM_005562.2(LAMC2):c.1782_1783delGC ; NM_005562.2(LAMC2):c.405-1G>A ; c.343C>T ; NM_005562.2(LAMC2):c.283C>T ; NM_005562.2:c.3120_3121insA ; NM_005562.2(LAMC2):c.1659C>A ; NM_005562.2(LAMC2):c.2137_2143delCAGAACC ; c.3069+1G>A ; c.3512dup ; NM_005562.2(LAMC2):c.1782_1783delGC ; NM_005562.2(LAMC2):c.405-1G>A ; c.343C>T ; NM_005562.2(LAMC2):c.283C>T



Síndrome de St�ve-Wiedemann

El síndrome de St�ve-Wiedemann (SWS) es una rara displasia esquelética primaria autosómica recesiva, caracterizada por baja estatura, arqueamiento de los huesos largos, camptodactilia, episodios de hipertermia, episodios de dificultad respiratoria/apnea y dificultades de alimentación que suelen conducir a una mortalidad temprana.


El SWS se caracteriza por la baja estatura, el arqueo de las extremidades que afecta más a las inferiores que a las superiores, la camptodactilia, la dificultad respiratoria/los episodios de apnea y los episodios de hipertermia asociados con frecuencia a las dificultades de alimentación/deglución. Otros hallazgos clínicos son cara de máscara, boca fruncida, cara media hipoplásica, osteopenia, contracturas congénitas e hipotonía muscular. La enfermedad es mortal en la mayoría de los casos como resultado de la dificultad respiratoria o la hipertermia. Sin embargo, se ha informado de la supervivencia más allá de un año en pocos casos, y los pacientes desarrollan graves deformidades de la columna vertebral, junto con osteoporosis estriada y fracturas espontáneas, arqueamiento de las extremidades inferiores (con articulaciones prominentes) y disautonomía (incluyendo inestabilidad de la temperatura, ausencia de reflejos corneales y rotulianos, y lengua lisa). El desarrollo motor suele estar retrasado, pero no se ha señalado ningún déficit intelectual.


NM_002310.5(LIFR):c.2013dup ; NM_002310.5(LIFR):c.171_174delTAAC ; c.2503G>T ; c.1018_1022del ; NM_002310.5(LIFR):c.653dup ; NM_002310.5(LIFR):c.1789C>T ; NM_002310.5(LIFR):c.2013dup ; NM_002310.5(LIFR):c.171_174delTAAC ; c.2503G>T ; c.1018_1022del ; NM_002310.5(LIFR):c.653dup ; NM_002310.5(LIFR):c.1789C>T



Sordera neurosensorial autosómica recesiva de tipo DFNB

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.


NM_144612.6:c.4714C>T ; c.512-1G>A ; c.1191_1192del ; c.457_461dup ; c.591C>A ; NM_144612.6(LOXHD1):c.2008C>T ; NM_144612.6:c.4714C>T ; c.512-1G>A ; c.1191_1192del ; c.457_461dup ; c.591C>A ; NM_144612.6(LOXHD1):c.2008C>T



Acidosis láctica congénita, tipo Saguenay-Lac-Saint-Jean

La acidosis láctica congénita tipo Saguenay-Lac-St. Jean (SLSJ), una forma franco-canadiense del síndrome de Leigh (véase este término), es una enfermedad mitocondrial caracterizada por acidosis metabólica crónica, hipotonía, dismorfismo facial y retraso en el desarrollo.


El dismorfismo facial se caracteriza por una frente prominente, un puente nasal ancho, hipertelorismo, una fontanela anterior ancha, hipoplasia mediofacial, una línea media ancha, sinofisitis y una forma arqueada característica de las cejas, junto con un hirsutismo leve. Existen 3 formas de la enfermedad que corresponden a diversos grados de gravedad: una forma neonatal, una forma clásica y una forma denominada "superviviente". La forma neonatal se caracteriza por estados acidóticos fulminantes. La forma clásica puede presentarse desde el nacimiento con una acidosis láctica grave, o manifestarse entre los 14 y los 24 meses por una marcha atáxica. Esta forma se asocia a episodios de acidosis láctica que pueden ser desencadenados por el esfuerzo físico, el estrés emocional, una infección o una comida pesada, y/o crisis metabólicas. Los pacientes conocidos como "supervivientes", es decir, los que han sobrevivido a varios episodios, atraviesan un umbral crítico y muestran síntomas menos graves, como hipotonía, astenia, retraso en el desarrollo (adquisición del lenguaje y marcha) y, en los pacientes de más edad, ataxia troncal, y una marcha característica de base ancha.


c.3830_3839delinsAG ; NM_133259.3(LRPPRC):c.1061C>T ; c.3830_3839delinsAG ; NM_133259.3(LRPPRC):c.1061C>T



Alfa-manosidosis, forma adulta

Una rara enfermedad por almacenamiento lisosómico caracterizada por una displasia espondilo-epifisaria de leve a grave, que se manifiesta con una estatura baja desproporcionada (cuello y tronco cortos), laxitud articular, pectus carinatum, genum valgum, marcha anormal, estrechamiento traqueal, anomalías de la columna vertebral (cifosis y escoliosis), insuficiencia respiratoria y cardiopatía valvular.


Los niños afectados suelen parecer normales al nacer, pero su estado empeora progresivamente. Sin embargo, algunos niños nacen con tobillo equino o desarrollan hidrocefalia en el primer año de vida. Las principales características son la inmunodeficiencia (manifestada por infecciones recurrentes, especialmente en la primera década de vida), las anomalías esqueléticas (disostosis múltiple de leve a moderada, escoliosis y deformación del esternón), la discapacidad auditiva (pérdida de audición neurosensorial de moderada a grave), el deterioro gradual de las funciones mentales y del habla y, a menudo, períodos de psicosis. Las alteraciones de la función motora asociadas incluyen debilidad muscular, anomalías articulares y ataxia. El dismorfismo facial se caracteriza por una cabeza grande con frente prominente, cejas redondeadas, puente nasal aplanado, macroglosia, dientes muy separados y prognatismo. Es frecuente el estrabismo leve. La variabilidad clínica es significativa, representando un continuo en la gravedad.

Alfa-manosidosis, forma infantil

Trastorno hereditario por almacenamiento lisosómico que se caracteriza por inmunodeficiencia, anomalías faciales y esqueléticas, discapacidad auditiva y déficit intelectual.


Los niños afectados suelen parecer normales al nacer, pero su estado empeora progresivamente. Sin embargo, algunos niños nacen con tobillo equino o desarrollan hidrocefalia en el primer año de vida. Las principales características son la inmunodeficiencia (manifestada por infecciones recurrentes, especialmente en la primera década de vida), las anomalías esqueléticas (disostosis múltiple de leve a moderada, escoliosis y deformación del esternón), las deficiencias auditivas (pérdida de audición neurosensorial de moderada a grave), el deterioro gradual de las funciones mentales y del habla y, a menudo, períodos de psicosis. Las alteraciones de la función motora asociadas incluyen debilidad muscular, anomalías articulares y ataxia. El dismorfismo facial se caracteriza por una cabeza grande con frente prominente, cejas redondeadas, puente nasal aplanado, macroglosia, dientes muy separados y prognatismo. Es frecuente el estrabismo leve. La variabilidad clínica es significativa, representando un continuo en la gravedad.


c.2116C>T ; NM_000528.3(MAN2B1):c.1830+1G>C ; NM_000528.3(MAN2B1):c.2398G>A ; c.2010del ; c.1777C>T ; c.2683_2684delinsG ; NM_000528.3(MAN2B1):c.2278C>T ; NM_000528.3(MAN2B1):c.2426T>C ; NM_000528.3(MAN2B1):c.1929G>A ; c.2365C>T ; NM_000528.3(MAN2B1):c.2436+2T>C ; NM_000528.3(MAN2B1):c.384G>A ; NM_000528.3(MAN2B1):c.1915C>T ; c.2116C>T ; NM_000528.3(MAN2B1):c.1830+1G>C ; NM_000528.3(MAN2B1):c.2398G>A ; c.2010del ; c.1777C>T ; c.2683_2684delinsG ; NM_000528.3(MAN2B1):c.2278C>T ; NM_000528.3(MAN2B1):c.2426T>C ; NM_000528.3(MAN2B1):c.1929G>A ; c.2365C>T ; NM_000528.3(MAN2B1):c.2436+2T>C ; NM_000528.3(MAN2B1):c.384G>A ; NM_000528.3(MAN2B1):c.1915C>T



Desmielinización cerebral por deficiencia de metionina adenosiltransferasa

La desmielinización cerebral por déficit de metionina adenosiltransferasa es un trastorno metabólico muy poco frecuente que da lugar a una hipermetioninemia hepática aislada que es generalmente benigna debida a la inactivación parcial de la actividad de la enzima. Con muy baja frecuencia se han encontrado pacientes con un olor extraño o con trastornos neurológicos como una desmielinización cerebral.




NM_000429.2:c.827_828insG ; c.1043_1044del ; NM_000429.2(MAT1A):c.1006G>A ; NM_000429.2:c.538_539insTG ; NM_000429.2(MAT1A):c.914T>C ; NM_000429.2(MAT1A):c.791G>A ; NM_000429.2(MAT1A):c.966T>G ; NM_000429.2(MAT1A):c.790C>T ; NM_000429.2(MAT1A):c.1070C>T ; NM_000429.2:c.827_828insG ; c.1043_1044del ; NM_000429.2(MAT1A):c.1006G>A ; NM_000429.2:c.538_539insTG ; NM_000429.2(MAT1A):c.914T>C ; NM_000429.2(MAT1A):c.791G>A ; NM_000429.2(MAT1A):c.966T>G ; NM_000429.2(MAT1A):c.790C>T ; NM_000429.2(MAT1A):c.1070C>T



Deficiencia de 3-metilcrotonil-CoA carboxilasa

Un raro trastorno hereditario del metabolismo de la leucina que se caracteriza por un cuadro clínico muy variable que va desde una crisis metabólica en la infancia hasta adultos asintomáticos.


Los pacientes con deficiencia de 3-metilcrotonil-CoA carboxilasa (3-MCCD) tienen un fenotipo clínico variable, siendo la gran mayoría de los pacientes asintomáticos y un pequeño subgrupo que presenta síntomas de aciduria orgánica, generalmente en asociación con factores ambientales desencadenantes. Muchos de los recién nacidos diagnosticados en la actualidad a través de las pruebas ampliadas de cribado neonatal permanecen asintomáticos, lo que indica que la enfermedad tiene una penetración clínica muy baja. La mayoría de los pacientes sintomáticos tienen un crecimiento y un desarrollo normales hasta que presentan una crisis metabólica aguda, normalmente tras una infección menor, el ayuno o la introducción de una dieta rica en proteínas, entre los 2 y los 33 meses de edad. Los síntomas incluyen vómitos, coma y apnea. En raras ocasiones, se han notificado anomalías neurológicas (es decir, ictus metabólico, hemiparesia y encefalopatía), debilidad, hipotonía muscular y retraso del desarrollo. Entre los episodios de crisis metabólica los pacientes suelen ser asintomáticos. Algunos pacientes con 3-MCCD pueden no desarrollar síntomas hasta la edad adulta, manifestándose con debilidad y fatiga, mientras que otros pueden no mostrar nunca síntomas.


NM_020166.4(MCCC1):c.1526delG ; NM_020166.4(MCCC1):c.1310T>C ; NM_020166.4(MCCC1):c.1074del ; c.310C>T ; NC_000003.12:g.183071292del ; NM_020166.4(MCCC1):c.1905delA ; NM_020166.4(MCCC1):c.640-2A>G ; NM_020166.4(MCCC1):c.640-1G>A ; NM_020166.4(MCCC1):c.1380T>G ; NM_020166.4(MCCC1):c.343C>T ; NM_020166.4(MCCC1):c.1277T>C ; NM_020166.4(MCCC1):c.2079del ; NM_020166.4(MCCC1):c.1114C>T ; NM_020166.4(MCCC1):c.1155A>C ; NM_020166.4(MCCC1):c.1930G>T ; NM_020166.4(MCCC1):c.1526delG ; NM_020166.4(MCCC1):c.1310T>C ; NM_020166.4(MCCC1):c.1074del ; c.310C>T ; NC_000003.12:g.183071292del ; NM_020166.4(MCCC1):c.1905delA ; NM_020166.4(MCCC1):c.640-2A>G ; NM_020166.4(MCCC1):c.640-1G>A ; NM_020166.4(MCCC1):c.1380T>G ; NM_020166.4(MCCC1):c.343C>T ; NM_020166.4(MCCC1):c.1277T>C ; NM_020166.4(MCCC1):c.2079del ; NM_020166.4(MCCC1):c.1114C>T ; NM_020166.4(MCCC1):c.1155A>C ; NM_020166.4(MCCC1):c.1930G>T



Deficiencia de 3-metilcrotonil-CoA carboxilasa

Un raro trastorno hereditario del metabolismo de la leucina que se caracteriza por un cuadro clínico muy variable que va desde una crisis metabólica en la infancia hasta adultos asintomáticos.


Los pacientes con deficiencia de 3-metilcrotonil-CoA carboxilasa (3-MCCD) tienen un fenotipo clínico variable, siendo la gran mayoría de los pacientes asintomáticos y un pequeño subgrupo que presenta síntomas de aciduria orgánica, generalmente en asociación con factores ambientales desencadenantes. Muchos de los recién nacidos diagnosticados en la actualidad a través de las pruebas ampliadas de cribado neonatal permanecen asintomáticos, lo que indica que la enfermedad tiene una penetración clínica muy baja. La mayoría de los pacientes sintomáticos tienen un crecimiento y un desarrollo normales hasta que presentan una crisis metabólica aguda, normalmente tras una infección menor, el ayuno o la introducción de una dieta rica en proteínas, entre los 2 y los 33 meses de edad. Los síntomas incluyen vómitos, coma y apnea. En raras ocasiones, se han notificado anomalías neurológicas (es decir, ictus metabólico, hemiparesia y encefalopatía), debilidad, hipotonía muscular y retraso del desarrollo. Entre los episodios de crisis metabólica los pacientes suelen ser asintomáticos. Algunos pacientes con 3-MCCD pueden no desarrollar síntomas hasta la edad adulta, manifestándose con debilidad y fatiga, mientras que otros pueden no mostrar nunca síntomas.


NM_022132.4(MCCC2):c.994C>T ; c.641del ; NM_022132.4(MCCC2):c.1065A>T ; NM_022132.4(MCCC2):c.735dup ; NM_022132.4(MCCC2):c.929C>G ; NM_022132.4(MCCC2):c.838G>T ; NM_022132.4(MCCC2):c.380C>G ; c.1072+1G>A ; NM_022132.4(MCCC2):c.295G>C ; NM_022132.4(MCCC2):c.464G>A ; c.1580G>A ; c.1577dup ; NM_022132.4(MCCC2):c.517dupT ; NM_022132.4(MCCC2):c.994C>T ; c.641del ; NM_022132.4(MCCC2):c.1065A>T ; NM_022132.4(MCCC2):c.735dup ; NM_022132.4(MCCC2):c.929C>G ; NM_022132.4(MCCC2):c.838G>T ; NM_022132.4(MCCC2):c.380C>G ; c.1072+1G>A ; NM_022132.4(MCCC2):c.295G>C ; NM_022132.4(MCCC2):c.464G>A ; c.1580G>A ; c.1577dup ; NM_022132.4(MCCC2):c.517dupT



Mucolipidosis tipo IV

La mucolipidosis tipo IV (ML IV) es una enfermedad de almacenamiento lisosómico caracterizada clínicamente por un retraso psicomotor y anomalías visuales que incluyen opacidad de la córnea, degeneración de la retina o estrabismo.


En los pacientes con ML IV, los fosfolípidos, los gangliósidos y los mucopolisacáridos se acumulan en inclusiones lisosomales, algunas de las cuales se asemejan a los cuerpos citoplasmáticos membranosos que se encuentran en las gangliosidosis. La enfermedad parece estar causada por anomalías en la endocitosis de los componentes de la membrana hacia los lisosomas. El gen causante, MCOLN1, se localiza en la región 19p13.3-p13.2 y codifica la mucolipina-1 (MLN1), una proteína de membrana de la familia de los canales del potencial receptor transitorio (TRP). Se han descrito unas 20 mutaciones en la literatura, dos de las cuales representan el 95% de los alelos identificados en la población asquenazí.


NM_020533.3:c.964C>T ; NM_000159.4:c.1207C>T ; NM_020533.2(MCOLN1):c.304C>T ; NM_020533.2(MCOLN1):c.1084G>T ; NM_020533.3:c.964C>T ; NM_000159.4:c.1207C>T ; NM_020533.2(MCOLN1):c.304C>T ; NM_020533.2(MCOLN1):c.1084G>T



Síndrome de Rett atípico

Es un trastorno neurológico genético poco frecuente que se caracteriza por la presencia de dos o más de los criterios principales del síndrome de Rett clásico (pérdida de las habilidades adquiridas con las manos, pérdida del lenguaje hablado adquirido, anomalías de la marcha, movimientos estereotipados de las manos), un periodo de regresión seguido de recuperación o estabilización, y cinco de los once criterios de apoyo (dificultades respiratorias, bruxismo, alteración del patrón de sueño, tono muscular anormal, alteraciones vasomotoras periféricas, escoliosis/cifosis, retraso en el crecimiento, manos y pies pequeños y fríos, risas o gritos inapropiados, disminución de la sensación de dolor y comunicación ocular intensa). Al igual que el síndrome de Rett clásico, afecta casi exclusivamente a las niñas, mientras que el curso de la enfermedad puede ser más leve o más grave.


Las formas atípicas pueden presentar un cuadro clínico más leve o más grave que el observado en el RTT típico. Se han definido varias subvariantes del RTT atípico. i) El tipo de convulsiones de inicio temprano (variante Hanefeld) se caracteriza por convulsiones en los primeros meses de vida con el posterior desarrollo de rasgos de RTT. ii) La variante congénita (variante Rolando) es la forma más grave de RTT atípico, con inicio de rasgos de RTT clásicos durante los tres primeros meses de vida. iii) La "forme fruste" es una variante más leve con inicio en la primera infancia y un curso incompleto y prolongado. iv) La forma de regresión en la última infancia se caracteriza por un perímetro cefálico normal y por una regresión más gradual y de inicio más tardío (en la última infancia) de las habilidades lingüísticas y motoras. v) La variante de habla preservada (variante PSD o Zappella) se caracteriza por la recuperación de algunas habilidades verbales y manuales.




El autismo, el trastorno generalizado del desarrollo (TGD) prototípico, suele manifestarse a los 3 años de edad. Se caracteriza por una tríada de comunicación verbal limitada o ausente, una falta de interacción social recíproca o de capacidad de respuesta, y patrones de intereses y comportamiento restringidos, estereotipados y ritualizados. El "trastorno del espectro autista", a veces denominado TEA, es un fenotipo más amplio que engloba los trastornos menos graves del síndrome de Asperger y el trastorno generalizado del desarrollo no especificado (TGD-NOS). El "fenotipo amplio del autismo" incluye a los individuos con algunos síntomas de autismo, pero que no cumplen todos los criterios para el autismo u otros trastornos. El retraso mental coexiste en aproximadamente dos tercios de los individuos con TEA, excepto en el caso del síndrome de Asperger, en el que el retraso mental está visiblemente ausente. Los estudios genéticos sobre el autismo suelen incluir a miembros de la familia con estos diagnósticos menos estrictos. 

Síndrome de Rett

Trastorno grave y poco frecuente del neurodesarrollo ligado al cromosoma X, caracterizado por una rápida regresión del desarrollo en la infancia, pérdida parcial o completa de los movimientos intencionados de las manos, pérdida del habla, anomalías en la marcha y movimientos estereotipados de las manos, comúnmente asociados a una desaceleración del crecimiento de la cabeza, discapacidad intelectual grave, convulsiones y anomalías respiratorias. El trastorno tiene un curso clínico progresivo y puede asociar diversas comorbilidades, como enfermedades gastrointestinales, escoliosis y trastornos del comportamiento.


El síndrome de Rett clásico o típico (RTT) afecta principalmente a las niñas y se caracteriza por un desarrollo psicomotor aparentemente normal durante los primeros 6-18 meses de vida, seguido de un estancamiento del desarrollo con una rápida regresión de las capacidades lingüísticas y motoras, y un posterior estancamiento a largo plazo de las habilidades. Los movimientos repetitivos y estereotipados de las manos sustituyen al uso intencionado de las mismas. Otros hallazgos incluyen rasgos autistas, ataques de pánico, bruxismo, apnea y/o hiperpnea episódica, ataxia y apraxia de la marcha, temblores, convulsiones (60-80%) y microcefalia adquirida. Existe una amplia variabilidad en la tasa de progresión de la enfermedad y en su gravedad. Se han descrito varios varones con un fenotipo comparable al de las mujeres con RTT clásico.

Encefalopatía neonatal grave con microcefalia

La encefalopatía grave de inicio neonatal con microcefalia es una enfermedad monogénica rara con epilepsia caracterizada por encefalopatía de inicio neonatal, microcefalia, retraso grave del desarrollo o ausencia del mismo, anomalías respiratorias (incluyendo hipoventilación central y/o insuficiencia respiratoria), convulsiones intratables, tono muscular anormal y movimientos involuntarios. La muerte temprana es habitual.


El gen MECP2 está mutado en el síndrome de Rett (RTT), un grave trastorno del neurodesarrollo que casi siempre se da en las mujeres. Aunque al principio se pensó que las mutaciones de MECP2 que causaban el síndrome de Rett eran letales en los varones, informes posteriores identificaron una encefalopatía neonatal grave en los hermanos varones supervivientes de pacientes con síndrome de Rett.

Lupus eritematoso sistémico

El lupus eritematoso sistémico (LES) es una enfermedad autoinmune compleja caracterizada por la producción de autoanticuerpos contra moléculas nucleares, citoplasmáticas y de superficie celular que trascienden los límites específicos de los órganos. El depósito tisular de anticuerpos o complejos inmunes induce la inflamación y la posterior lesión de múltiples órganos y finalmente da lugar a las manifestaciones clínicas del LES, como glomerulonefritis, dermatitis, trombosis, vasculitis, convulsiones y artritis.



Trisomía Xq28

Las duplicaciones Xq distales se refieren a los trastornos cromosómicos resultantes de la afectación del brazo largo del cromosoma X (Xq). Las manifestaciones clínicas varían mucho en función del sexo del paciente y del contenido génico del segmento duplicado. La prevalencia de las duplicaciones Xq sigue siendo desconocida.


Las duplicaciones distales más frecuentes implican el segmento Xq28 y dan lugar a un fenotipo reconocible que incluye rasgos faciales distintivos (cierre prematuro de las fontanelas o una sutura metópica estriada, una cara ancha con mejillas llenas, pliegues epicánticos, orejas grandes, una boca pequeña y abierta, anomalías en las orejas, una nariz puntiaguda, un paladar anormal e hipotonía facial), hipotonía axial importante, retraso grave del desarrollo, dificultades graves de alimentación, genitales anormales y susceptibilidad a las infecciones.

Síndrome de discapacidad intelectual-psicosis-macroorquidismo ligado al X

Se trata de una discapacidad intelectual sindrómica ligada al cromosoma X que se caracteriza por un retraso en el desarrollo, un grado variable de discapacidad intelectual, retraso en el habla o ausencia de ésta, signos piramidales, temblor, macroorquidismo y problemas variables de humor y comportamiento, incluyendo psicosis y comportamientos de tipo autista. Los varones están afectados predominantemente, algunas mujeres muestran capacidades cognitivas inferiores.


El gen MECP2 está mutado en el síndrome de Rett (RTT), un grave trastorno del neurodesarrollo que casi siempre se da en las mujeres. Los varones con mutaciones no asociadas a RTT en el gen MECP2 pueden mostrar una amplia variedad de fenotipos, incluyendo el retraso mental ligado al cromosoma X con espasticidad y otras características variables, descrito aquí, y el síndrome de retraso mental ligado al cromosoma X de Lubs (MRXSL). Los varones con mutaciones de MECP2 asociadas a RTT presentan una encefalopatía neonatal grave que suele ser letal (300673).

Discapacidad intelectual no sindrómica ligada al X

El síndrome de duplicación de MECP2 es un trastorno del neurodesarrollo ligado al cromosoma X que se caracteriza por un retraso mental de severo a profundo, hipotonía infantil, rasgos dismórficos leves, escaso desarrollo del habla, rasgos autistas, convulsiones, espasticidad progresiva e infecciones recurrentes. Sólo afecta a los varones, aunque las mujeres portadoras pueden presentar algunos rasgos neuropsiquiátricos leves, como ansiedad. Las duplicaciones submicroscópicas de Xq28 que engloban a MECP2 se consideran eventos no recurrentes, porque las ubicaciones de los puntos de rotura y los tamaños de los reordenamientos varían entre los individuos afectados.




NM_004992.3(MECP2):c.964C>T ; NM_004992.3(MECP2):c.916C>T ; NM_004992.3(MECP2):c.215dupC ; NM_004992.3(MECP2):c.611C>G ; NM_004992.3(MECP2):c.502C>T ; NM_004992.3(MECP2):c.763C>T ; NM_004992.3(MECP2):c.730C>T ; NM_004992.3(MECP2):c.965C>T ; NM_004992.3(MECP2):c.674C>T ; NM_001110792.1(MECP2):c.916C>T ; NM_004992.3(MECP2):c.806delG ; NM_004992.3(MECP2):c.808C>T ; NM_004992.3(MECP2):c.753delC ; NM_004992.3(MECP2):c.964C>T ; NM_004992.3(MECP2):c.916C>T ; NM_004992.3(MECP2):c.215dupC ; NM_004992.3(MECP2):c.611C>G ; NM_004992.3(MECP2):c.502C>T ; NM_004992.3(MECP2):c.763C>T ; NM_004992.3(MECP2):c.730C>T ; NM_004992.3(MECP2):c.965C>T ; NM_004992.3(MECP2):c.674C>T ; NM_001110792.1(MECP2):c.916C>T ; NM_004992.3(MECP2):c.806delG ; NM_004992.3(MECP2):c.808C>T ; NM_004992.3(MECP2):c.753delC



Enfermedad de Beh�et



La aparición es más frecuente en adultos (media de 30 años), pero se han descrito casos pediátricos. Los episodios recidivantes de aftas orales redondas con bordes eritematosos y elevados (1-3 cm de diámetro) pueden ir acompañados de aftas genitales (>50% de los casos); las características cutáneas pueden incluir pseudofoliculitis y eritema nodoso. Los trastornos oculares (uveítis posterior, vasculitis retiniana) se producen en más del 50% de los pacientes con EB. Las artralgias y/o artritis no erosivas, asimétricas, que afectan principalmente a las grandes articulaciones (rodillas, tobillos, etc.) son frecuentes (45%) y pueden aparecer como síntoma inicial. La vasculitis en la EB es más frecuente en el sistema venoso, donde pueden producirse trombos en los territorios femoro-ilíaco, de la vena cava superior e inferior y cerebral. Las trombosis arteriales más raras y los aneurismas afectan principalmente a los vasos pulmonares y a la aorta. Las manifestaciones neurológicas (neuro-BD) son frecuentes (>20%), y pueden incluir cefalea, fiebre, signos piramidales con hemiparesia, daños en los nervios craneales, meningitis, cambios de comportamiento y disfunción de los esfínteres. Las lesiones aftosas y/o ulcerosas pueden afectar a todo el tracto digestivo, pero principalmente al íleo-cecal y al colon ascendente, pudiendo provocar hemorragias y perforaciones.

Fiebre mediterránea familiar

La fiebre mediterránea familiar (FMF) es un trastorno autoinflamatorio caracterizado por episodios cortos y recurrentes de fiebre y serositis que provocan dolor en el abdomen, el pecho, las articulaciones y los músculos.


El inicio de la enfermedad suele producirse antes de los 30 años, y un inicio más temprano corresponde a un fenotipo más grave. La FMF puede dividirse en dos tipos: FMF tipo 1 y 2. El tipo 1 se caracteriza por ataques (tan frecuentes como una vez a la semana o cada pocos años) de fiebre y serositis que duran de 1 a 4 días y se resuelven espontáneamente. El estrés, la exposición al frío, las comidas ricas en grasas, las infecciones, ciertos medicamentos y los ciclos menstruales son posibles desencadenantes de los ataques. Los síntomas leves (mialgia, cefalea, náuseas, disnea, artralgia, lumbalgia, astenia y ansiedad) preceden a los ataques y duran unas 17 horas. Los ataques se manifiestan con fiebre (38°C-40°C que dura entre 12 y 72 horas y no responde a los antibióticos), dolor abdominal difuso o localizado (a menudo imitando un abdomen agudo), estreñimiento (diarrea en los niños), artralgias (en las grandes articulaciones), artritis (en las articulaciones de las extremidades superiores/inferiores/rodillas) y dolor torácico causado por pleuritis y/o pericarditis (véase este término). En el 7-40% de los pacientes también hay afectación cutánea. La amiloidosis tipo AA (véase este término) puede ser una complicación grave a largo plazo. La FMF tipo 2 describe un fenotipo en el que la amiloidosis es la primera y única manifestación de la enfermedad.

Hidrartrosis intermitente

Enfermedad reumatológica poco frecuente que se caracteriza por episodios recurrentes y autorremitentes de artritis monoarticular aguda, a menudo con una periodicidad fija, que suele afectar a la rodilla o a otra articulación grande, y que desarrolla un derrame en un plazo de 12 a 24 horas con un dolor de leve a moderado y signos mínimos de inflamación. Los ataques duran de tres a cinco días y pueden ser paralelos a la menstruación en las mujeres. Los síntomas sistémicos están ausentes y no se producen daños en las articulaciones.


La talasemia delta-beta es un trastorno de la hemoglobina caracterizado por la disminución o ausencia de la síntesis de las cadenas delta y beta de la globina con un aumento compensatorio de la expresión de la síntesis de la cadena gamma fetal del cromosoma afectado. Los individuos con talasemia delta-beta tienen una anemia hipocrómica y microcítica y un aumento de la HbF, que puede mitigar la anemia dependiendo del nivel de HbF. La talasemia delta-beta y algunas formas de HPFH son el resultado de deleciones dentro del grupo de genes de la beta-globina en el cromosoma 11p15; esto se ha denominado HPFH "delecional". La HPFH también puede ser el resultado de mutaciones puntuales en las regiones promotoras de los genes de la gammaglobulina HBG1 y HBG2; esto se ha denominado HPFH "no delecional".

Síndrome de Sweet

Enfermedad inflamatoria rara que se caracteriza por la aparición brusca de pápulas, placas y nódulos dolorosos, edematosos y eritematosos en la piel, y que suele ir acompañada de fiebre y neutrofilia con una densa infiltración de neutrófilos maduros que suelen localizarse en la dermis superior. La enfermedad se asocia clásicamente con enfermedades inflamatorias, el embarazo, infecciones (sobre todo del tracto respiratorio superior) o la vacunación, pero puede ser idiopática, asociada a una neoplasia hematológica o visceral, o inducida por fármacos.


El síndrome de Sweet clásico (SSC) suele presentarse en mujeres de entre 30 y 50 años, suele ir precedido de una infección de las vías respiratorias superiores y puede estar asociado a una enfermedad inflamatoria intestinal. Se caracteriza por la aparición brusca de placas o nódulos eritematosos dolorosos, pero también se describen pústulas y bullas. Se observa fiebre en el 30 al 80% de los casos. Aproximadamente un tercio de los pacientes con CSS experimentan recurrencia de la dermatosis. El síndrome de Sweet asociado a malignidad (MASS) puede ocurrir como un síndrome paraneoplásico en pacientes con un cáncer establecido o en individuos cuya discrasia hematológica o tumor sólido relacionado con el síndrome de Sweet no se había descubierto previamente; el MASS se relaciona más comúnmente con la leucemia mielógena aguda. La dermatosis puede preceder, seguir o aparecer simultáneamente con el diagnóstico del cáncer del paciente. Por lo tanto, el MASS puede ser el presagio cutáneo de una neoplasia visceral no diagnosticada en un individuo previamente libre de cáncer o de una recidiva de cáncer no sospechada en un paciente oncológico. El síndrome de Sweet inducido por fármacos (DISS) se produce con mayor frecuencia en pacientes que han sido tratados con factor estimulante de colonias de granulocitos, aunque también se han asociado numerosos medicamentos con el DISS.


NM_000243.2(MEFV):c.2082G>A ; c.163dup ; NM_000243.2(MEFV):c.1437C>G ; NM_000243.2(MEFV):c.2040G>A ; NM_000243.2(MEFV):c.2040G>C ; NM_000243.2(MEFV):c.2080A>G ; c.1141C>T ; NM_000243.2(MEFV):c.2282G>A ; NM_000243.2(MEFV):c.2076_2078delAAT ; c.656dup ; NM_000243.2(MEFV):c.1958G>A ; NM_000243.2(MEFV):c.2177T>C ; NM_000243.2(MEFV):c.2082G>A ; c.163dup ; NM_000243.2(MEFV):c.1437C>G ; NM_000243.2(MEFV):c.2040G>A ; NM_000243.2(MEFV):c.2040G>C ; NM_000243.2(MEFV):c.2080A>G ; c.1141C>T ; NM_000243.2(MEFV):c.2282G>A ; NM_000243.2(MEFV):c.2076_2078delAAT ; c.656dup ; NM_000243.2(MEFV):c.1958G>A ; NM_000243.2(MEFV):c.2177T>C



Enfermedad CLN7

Las lipofuscinosis ceroideas neuronales infantiles tardías (LINCL) son un grupo genéticamente heterogéneo de lipofuscinosis ceroideas neuronales (NCL; véase este término) que se caracterizan por aparecer durante la infancia o la niñez temprana con un deterioro de las capacidades mentales y motoras, epilepsia y pérdida de visión por degeneración de la retina.


Los síntomas clínicos iniciales son el deterioro motor y/o cognitivo o la epilepsia, pero la edad media de inicio y la velocidad de progresión pueden variar en función del defecto genético subyacente. Los pacientes con LINCL clásico suelen presentar un estancamiento del desarrollo mental o la aparición de epilepsia grave alrededor del tercer año de vida. El trastorno progresa hasta la pérdida completa de casi todas las capacidades motoras y mentales antes de la edad escolar. Como la pérdida visual no es un hallazgo prominente en las primeras etapas del curso de la enfermedad, a menudo no se reconoce. También se han descrito en la literatura diversas formas variantes (vLINCL) en las que la edad media de inicio suele variar entre los 2 y los 7 años y que suelen manifestarse con epilepsia grave seguida de deterioro cognitivo y motor y pérdida de visión.


NM_152778.2(MFSD8):c.929G>A ; c.1090del ; NM_152778.2(MFSD8):c.894T>G ; NM_152778.2(MFSD8):c.881C>A ; NM_152778.2(MFSD8):c.1286G>A ; NM_152778.2(MFSD8):c.1235C>T ; c.1525_1526del ; c.999-2A>G ; NM_152778.2(MFSD8):c.929G>A ; c.1090del ; NM_152778.2(MFSD8):c.894T>G ; NM_152778.2(MFSD8):c.881C>A ; NM_152778.2(MFSD8):c.1286G>A ; NM_152778.2(MFSD8):c.1235C>T ; c.1525_1526del ; c.999-2A>G



Síndrome de Bardet-Biedl

El síndrome de Bardet-Biedl (BBS) es una ciliopatía con afectación multisistémica.


Este trastorno se caracteriza por una combinación de signos clínicos: obesidad, retinopatía pigmentaria, polidactilia post-axial, riñones poliquísticos, hipogenitalismo y problemas de aprendizaje, muchos de los cuales aparecen varios años después del inicio de la enfermedad. La expresión clínica es variable, pero la mayoría de los pacientes manifiestan la mayoría de los signos clínicos durante el curso de la enfermedad. La retinopatía pigmentaria es el único signo clínico constante después de la infancia. El BBS también puede estar asociado a otras manifestaciones, como la diabetes, la hipertensión, la cardiopatía congénita y la enfermedad de Hirschsprung (véase este término).

Síndrome de McKusick-Kaufman

Síndrome genético de anomalías congénitas múltiples, poco frecuente, que se caracteriza por malformaciones genitourinarias (hidrometrocolpos en las hembras y en los machos, hipospadias glanulares y rafe escrotal prominente) , polidactilia postaxial que puede afectar a una o varias extremidades y, en menor medida, defectos cardíacos. El hidrometrocolpos se debe a una obstrucción congénita, a un himen imperforado o a una atresia vaginal, y provoca una masa palpable y posiblemente hidronefrosis. Otras anomalías notificadas ocasionalmente son la atresia coanal, la displasia hipofisaria, la atresia esofágica y la fístula traqueoesofágica distal, la enfermedad de Hirschsprung, las anomalías vertebrales y la hidropesía fetal. El trastorno es alélico con Bardet-Biedl, y como se ha observado cierto solapamiento fenotípico, los pacientes deben ser reevaluados en la infancia posterior para detectar retinistis pigmentosas y otros signos del síndrome de Bardet-Biedl.


Síndrome genético de anomalías congénitas múltiples, poco frecuente, que se caracteriza por malformaciones genitourinarias (hidrometrocolpos en las mujeres y en los varones, hipospadias glanulares y rafe escrotal prominente) , polidactilia postaxial que puede afectar sólo a una o varias extremidades, y en menor medida defectos cardíacos. El hidrometrocolpos se debe a una obstrucción congénita, a un himen imperforado o a una atresia vaginal, y provoca una masa palpable y posiblemente hidronefrosis. Otras anomalías notificadas ocasionalmente son la atresia coanal, la displasia hipofisaria, la atresia esofágica y la fístula traqueoesofágica distal, la enfermedad de Hirschsprung, las anomalías vertebrales y la hidropesía fetal. El trastorno es alélico con Bardet-Biedl, y como se ha observado cierto solapamiento fenotípico, los pacientes deben ser reevaluados en la infancia posterior para detectar retinistis pigmentosas y otros signos del síndrome de Bardet-Biedl.


c.353del ; NC_000020.11:g.10407663_10407664del ; c.1436C>G ; c.353del ; NC_000020.11:g.10407663_10407664del ; c.1436C>G



Síndrome de Bardet-Biedl

El síndrome de Bardet-Biedl (BBS) es una ciliopatía con afectación multisistémica.


Este trastorno se caracteriza por una combinación de signos clínicos: obesidad, retinopatía pigmentaria, polidactilia post-axial, riñones poliquísticos, hipogenitalismo y problemas de aprendizaje, muchos de los cuales aparecen varios años después del inicio de la enfermedad. La expresión clínica es variable, pero la mayoría de los pacientes manifiestan la mayoría de los signos clínicos durante el curso de la enfermedad. La retinopatía pigmentaria es el único signo clínico constante después de la infancia. El BBS también puede estar asociado a otras manifestaciones, como la diabetes, la hipertensión, la cardiopatía congénita y la enfermedad de Hirschsprung (véase este término).

Síndrome de Joubert

Una rara ataxia cerebelosa congénita autosómica recesiva que se caracteriza por una malformación congénita del tronco cerebral y una agenesia o hipoplasia del vermis cerebeloso que da lugar a un patrón respiratorio anormal, nistagmo, hipotonía, ataxia y retraso en la consecución de los hitos motores.


El inicio de la enfermedad es prenatal, aunque la presentación clínica es típicamente en el periodo neonatal con un patrón respiratorio irregular (taquipnea y/o apnea episódica), y nistagmo. Durante la infancia, puede aparecer hipotonía. Más adelante puede aparecer ataxia cerebelosa (marcha tambaleante y desequilibrio). Es frecuente el retraso en la adquisición de los hitos motores. Las capacidades cognitivas son variables, desde un déficit intelectual grave hasta una inteligencia normal. El examen neurooftalmológico puede mostrar apraxia oculomotora. En algunos casos, se producen convulsiones. Un examen minucioso de la cara suele mostrar un aspecto característico: cabeza grande, frente prominente, cejas altas y redondeadas, pliegues epicánticos, ptosis (ocasionalmente), nariz respingona con orificios nasales prominentes, boca abierta (que tiende a tener una forma ovalada al principio, un aspecto "romboide" después y, finalmente, puede parecer triangular con ángulos hacia abajo), protrusión de la lengua y movimientos rítmicos de la misma, y ocasionalmente orejas de implantación baja e inclinadas. Otros rasgos que a veces presenta el síndrome de Joubert son la distrofia de la retina, la hepatopatía, la nefronopatía y la polidactilia.

Síndrome de Joubert con defecto ocular

El síndrome de Joubert con defecto ocular es, junto con el JS puro, el subtipo más frecuente del síndrome de Joubert y trastornos relacionados (JSRD; véanse estos términos) caracterizado por los rasgos neurológicos del JS asociados a la distrofia de la retina.


La edad de aparición y la gravedad de la afectación de la retina son variables, y van desde la ceguera congénita en pacientes con amaurosis congénita de Leber (LCA, véase este término) hasta la retinopatía progresiva con conservación parcial de la visión.

Síndrome de Meckel

Trastorno genético de anomalías congénitas múltiples, raro y letal, que se caracteriza por la tríada de malformaciones cerebrales (principalmente encefalocele occipital), riñones grandes y poliquísticos y polidactilia, así como por anomalías asociadas que pueden incluir labio leporino/paladar hendido, anomalías cardíacas y genitales, malformaciones del sistema nervioso central (SNC), fibrosis hepática y displasia ósea.


Los fetos afectados por el síndrome de Meckel (MKS) sólo sobreviven entre unos días y unas semanas como máximo, o mueren en el útero. Las principales características del SNC incluyen encefalocele occipital, hidrocefalia, anencefalia, holoprosencefalia, así como Dandy-Walker. Los riñones grandes y poliquísticos con displasia quística son una característica constante del síndrome de Meckel. La disgenesia hepática y la fibrosis hepática son frecuentes. La polidactilia puede afectar a las cuatro extremidades y es típicamente postaxial (80%) o muy raramente preaxial. Los individuos afectados presentan hipoplasia pulmonar secundaria al oligohidramnios. Pueden observarse labio y paladar hendido, microftalmia y micrognatia. Las malformaciones cardíacas pueden incluir la comunicación interauricular, la coartación de la aorta, el conducto arterial persistente y la estenosis pulmonar valvular. Son frecuentes el desarrollo incompleto de los genitales internos y externos y la criptorquidia en los varones.


NM_017777.3(MKS1):c.1024+1G>A ; NM_017777.3(MKS1):c.508C>T ; NM_017777.3(MKS1):c.1024+1G>A ; NM_017777.3(MKS1):c.508C>T



Leucoencefalopatía megalencefálica con quistes subcorticales

La leucoencefalopatía megalencefálica con quistes subcorticales (MLC) es una forma de leucodistrofia que se caracteriza por una macrocefalia de inicio infantil, a menudo con signos neurológicos leves en el momento de la presentación (como un leve retraso motor), que empeoran con el tiempo, dando lugar a una mala deambulación, caídas, ataxia, espasticidad, aumento de las convulsiones y deterioro cognitivo. La resonancia magnética cerebral revela una materia blanca difusamente anormal y ligeramente inflamada, así como quistes subcorticales en las regiones temporal anterior y frontoparietal.


La leucoencefalopatía megalencefálica con quistes subcorticales (MLC) es una forma de leucodistrofia que se caracteriza por una macrocefalia de inicio infantil, a menudo con signos neurológicos leves en el momento de la presentación (como un leve retraso motor), que empeoran con el tiempo, dando lugar a una mala deambulación, caídas, ataxia, espasticidad, aumento de las convulsiones y deterioro cognitivo. La resonancia magnética cerebral revela una materia blanca difusamente anormal y ligeramente inflamada, así como quistes subcorticales en las regiones temporal anterior y frontoparietal.


NM_015166.3:c.274C>T ; NM_015166.3(MLC1):c.206C>T ; NM_015166.3(MLC1):c.423C>A ; NM_015166.3(MLC1):c.135dupC ; c.33dup ; c.424-2A>C ; NM_015166.3(MLC1):c.278C>T ; NM_015166.3(MLC1):c.422A>G ; NM_015166.3:c.274C>T ; NM_015166.3(MLC1):c.206C>T ; NM_015166.3(MLC1):c.423C>A ; NM_015166.3(MLC1):c.135dupC ; c.33dup ; c.424-2A>C ; NM_015166.3(MLC1):c.278C>T ; NM_015166.3(MLC1):c.422A>G



Aciduria malónica

La secuencia de acinesia/hipocinesia fetal (o síndrome de Peña-Shokeir tipo I) se caracteriza por múltiples contracturas articulares, anomalías faciales e hipoplasia pulmonar. Sea cual sea la causa, la característica común de esta secuencia es la disminución de la actividad fetal.


Esta enfermedad suele presentarse en la primera infancia y sus manifestaciones son variables. La mayoría de los pacientes presentan un retraso en el desarrollo con otras características que incluyen hipotonía, convulsiones, hipoglucemia, acidosis metabólica, cardiomiopatía y diarrea.


c.758del ; NM_012213.2(MLYCD):c.560C>G ; NM_012213.2(MLYCD):c.679_680insTGAAGC ; c.758del ; NM_012213.2(MLYCD):c.560C>G ; NM_012213.2(MLYCD):c.679_680insTGAAGC



Acidemia metilmalónica sensible a la vitamina B12, tipo cblA

La aciduria metilmalónica es un trastorno genéticamente heterogéneo del metabolismo del metilmalonato y la cobalamina (cbl; vitamina B12). Se han clasificado diferentes formas de aciduria metilmalónica aislada según los grupos de complementación de las células in vitro. Los pacientes con defectos en la síntesis de AdoCbl suelen responder a la terapia con vitamina B12 y se clasifican como tipo 'cbl': entre ellos se encuentran el cblA y el cblB, que está causado por una mutación en el gen MMAB en 12q24. Véase también el cblH, que puede ser un subconjunto del cblA. La forma "mut" de la MMA está causada por una mutación en el gen MUT del cromosoma 6p. En general, la forma mut de MMA no responde al tratamiento con vitamina B12.




NM_172250.2(MMAA):c.503delC ; c.811G>T ; NM_172250.3(MMAA):c.450dup ; NM_172250.2(MMAA):c.586C>T ; NM_172250.2(MMAA):c.620A>G ; NM_172250.2(MMAA):c.455delC ; NM_172250.2(MMAA):c.1034delT ; NM_172250.2(MMAA):c.387C>A ; NM_172250.3(MMAA):c.283C>T ; NM_172250.2(MMAA):c.503delC ; c.811G>T ; NM_172250.3(MMAA):c.450dup ; NM_172250.2(MMAA):c.586C>T ; NM_172250.2(MMAA):c.620A>G ; NM_172250.2(MMAA):c.455delC ; NM_172250.2(MMAA):c.1034delT ; NM_172250.2(MMAA):c.387C>A ; NM_172250.3(MMAA):c.283C>T



Acidemia metilmalónica sensible a la vitamina B12, tipo cblB

La aciduria metilmalónica es un trastorno genéticamente heterogéneo del metabolismo del metilmalonato y la cobalamina (cbl; vitamina B12). Se han clasificado diferentes formas de aciduria metilmalónica aislada según los grupos de complementación de las células in vitro. Los pacientes con defectos en la síntesis de AdoCbl suelen responder a la terapia con vitamina B12 y se clasifican como tipo "cbl": estos incluyen cblB y cblA (251100). El tipo cblA está causado por una mutación en el gen MMAA (607481). El tipo 'mut' (251000) está causado por una mutación en el gen MUT; en general, la forma mut de MMA no responde al tratamiento con vitamina B12.




NM_052845.3(MMAB):c.568C>T ; c.220G>T ; NM_052845.3(MMAB):c.197-1G>T ; c.197-1G>A ; NM_052845.3(MMAB):c.556C>T ; NM_052845.3(MMAB):c.700C>T ; NM_052845.3(MMAB):c.568C>T ; c.220G>T ; NM_052845.3(MMAB):c.197-1G>T ; c.197-1G>A ; NM_052845.3(MMAB):c.556C>T ; NM_052845.3(MMAB):c.700C>T



Acidemia metilmalónica con homocistinuria, tipo cblC

La acidemia metilmalónica de tipo cblC con homocistinuria es una forma de acidemia metilmalónica con homocistinuria (véase este término), un error congénito del metabolismo de la vitamina B12 (cobalamina) caracterizado por anemia megaloblástica, letargo, retraso en el crecimiento, retraso en el desarrollo, déficit intelectual y convulsiones.


La enfermedad se presenta típicamente con retraso en el desarrollo, deterioro neurológico agudo, déficit intelectual, letargo, convulsiones, microcefalia, retinopatía salina y signos de anemia megaloblástica (palidez, fatiga, anorexia). Son frecuentes las anomalías cerebrales graves, como hidrocefalia, anomalías de la sustancia blanca, atrofia cerebral y lesiones inusuales de los ganglios basales. El inicio del trastorno puede ser temprano (infantil) o tardío (juvenil o adulto), y la forma de inicio tardío se caracteriza por ataxia, demencia y psicosis.

Deficiencia de metilcobalamina tipo cblDv1

La homocistinuria sin aciduria metilmalónica es un error congénito del metabolismo de la vitamina B12 (cobalamina) que se caracteriza por anemia megaloblástica, encefalopatía y, a veces, retraso en el desarrollo, y que se asocia con homocistinuria e hiperhomocisteinemia. Existen tres tipos de homocistinuria sin aciduria metilmalónica: cblE, cblG y cblD-variante 1 (cblDv1).


La homocistinuria sin aciduria metilmalónica se manifiesta principalmente en la primera infancia con retraso en el crecimiento, anemia megaloblástica, retraso en el desarrollo, hipotonía, convulsiones y atrofia cerebral con anomalías en la materia blanca. Algunos pacientes pueden tener una expresión aguda en los primeros meses de vida, con vómitos, mala alimentación y letargo. Los pacientes desarrollan homocistinuria, hiperhomocisteinemia y, a veces, hipometioninemia. También se ha descrito un fenotipo clínico leve y una enfermedad de inicio tardío en ausencia de afectación neurológica para el trastorno cblE. En la cblG se ha observado la presentación en la edad adulta con ataxia, demencia o psicosis.

Acidemia metilmalónica con homocistinuria, tipo cblD

La acidemia metilmalónica tipo cblD con homocistinuria es una forma de acidemia metilmalónica con homocistinuria (véase este término), un error congénito del metabolismo de la vitamina B12 (cobalamina) caracterizado por manifestaciones bioquímicas, neurológicas y hematológicas variables.


Se han descrito tres presentaciones diferentes: la forma clásica con aciduria metilmalónica y homocistinuria combinadas; la variante 1 de cblD (cblDv1) con homocistinuria aislada; y la variante 2 de cblD (cblDv2) con aciduria metilmalónica aislada. La presentación clínica es extremadamente variable. El trastorno puede presentarse desde la primera infancia hasta la última. Los signos que se presentan son variables dependiendo del aspecto o aspectos del metabolismo de la cobalamina que estén afectados y pueden incluir retraso en el desarrollo, dificultades graves de aprendizaje, convulsiones, anomalías en el movimiento y la marcha, problemas de comportamiento y signos de anemia megaloblástica (palidez, fatiga, anorexia).

Acidemia metilmalónica sensible a la vitamina B12, tipo cblDv2

La encefalopatía por deficiencia de sulfito oxidasa es un raro trastorno neurometabólico caracterizado por convulsiones, encefalopatía progresiva y dislocación del cristalino.


Los pacientes suelen presentarse en la infancia o en la niñez temprana con características que incluyen letargo, retraso en el crecimiento, vómitos recurrentes, deshidratación, dificultad respiratoria, hipotonía muscular, hepatomegalia y coma. También pueden mostrar signos de anemia (no megaloblástica), presentar cetoacidosis y/o hiperamonemia potencialmente mortales, y retraso en el desarrollo y déficit intelectual, con un accidente metabólico que afecta al tronco cerebral. La AM conduce con frecuencia a una insuficiencia renal terminal en la adolescencia o en la edad adulta. Los pacientes con cblB suelen estar más afectados que los pacientes con cblA.


NM_015506.2(MMACHC):c.482G>A ; NM_015506.2(MMACHC):c.440G>C ; NM_015506.2(MMACHC):c.615C>G ; NM_015506.2(MMACHC):c.394C>T ; NM_015506.2(MMACHC):c.547_548delGT ; NM_015506.2(MMACHC):c.331C>T ; NM_015506.2(MMACHC):c.609G>A ; NM_015506.2(MMACHC):c.347T>C ; NM_015506.2(MMACHC):c.658_660delAAG ; NM_015506.2(MMACHC):c.481C>T ; NM_015506.2(MMACHC):c.688C>T ; NM_015506.2(MMACHC):c.608G>A ; NM_015506.2(MMACHC):c.388_390delTAC ; NM_015506.2(MMACHC):c.619dup ; NM_015506.2(MMACHC):c.615C>A ; NM_015506.2(MMACHC):c.482G>A ; NM_015506.2(MMACHC):c.440G>C ; NM_015506.2(MMACHC):c.615C>G ; NM_015506.2(MMACHC):c.394C>T ; NM_015506.2(MMACHC):c.547_548delGT ; NM_015506.2(MMACHC):c.331C>T ; NM_015506.2(MMACHC):c.609G>A ; NM_015506.2(MMACHC):c.347T>C ; NM_015506.2(MMACHC):c.658_660delAAG ; NM_015506.2(MMACHC):c.481C>T ; NM_015506.2(MMACHC):c.688C>T ; NM_015506.2(MMACHC):c.608G>A ; NM_015506.2(MMACHC):c.388_390delTAC ; NM_015506.2(MMACHC):c.619dup ; NM_015506.2(MMACHC):c.615C>A



Acidemia metilmalónica con homocistinuria, tipo cblC

La acidemia metilmalónica de tipo cblC con homocistinuria es una forma de acidemia metilmalónica con homocistinuria (véase este término), un error congénito del metabolismo de la vitamina B12 (cobalamina) caracterizado por anemia megaloblástica, letargo, retraso en el crecimiento, retraso en el desarrollo, déficit intelectual y convulsiones.


La enfermedad se presenta típicamente con retraso en el desarrollo, deterioro neurológico agudo, déficit intelectual, letargo, convulsiones, microcefalia, retinopatía salina y signos de anemia megaloblástica (palidez, fatiga, anorexia). Son frecuentes las anomalías cerebrales graves, como hidrocefalia, anomalías de la sustancia blanca, atrofia cerebral y lesiones inusuales de los ganglios basales. El inicio del trastorno puede ser temprano (infantil) o tardío (juvenil o adulto), y la forma de inicio tardío se caracteriza por ataxia, demencia y psicosis.

Deficiencia de metilcobalamina tipo cblDv1

La homocistinuria sin aciduria metilmalónica es un error congénito del metabolismo de la vitamina B12 (cobalamina) que se caracteriza por anemia megaloblástica, encefalopatía y, a veces, retraso en el desarrollo, y que se asocia con homocistinuria e hiperhomocisteinemia. Existen tres tipos de homocistinuria sin aciduria metilmalónica: cblE, cblG y cblD-variante 1 (cblDv1).


La homocistinuria sin aciduria metilmalónica se manifiesta principalmente en la primera infancia con retraso en el crecimiento, anemia megaloblástica, retraso en el desarrollo, hipotonía, convulsiones y atrofia cerebral con anomalías en la materia blanca. Algunos pacientes pueden tener una expresión aguda en los primeros meses de vida, con vómitos, mala alimentación y letargo. Los pacientes desarrollan homocistinuria, hiperhomocisteinemia y, a veces, hipometioninemia. También se ha descrito un fenotipo clínico leve y una enfermedad de inicio tardío en ausencia de afectación neurológica para el trastorno cblE. En la cblG se ha observado la presentación en la edad adulta con ataxia, demencia o psicosis.

Acidemia metilmalónica con homocistinuria, tipo cblD

La acidemia metilmalónica tipo cblD con homocistinuria es una forma de acidemia metilmalónica con homocistinuria (véase este término), un error congénito del metabolismo de la vitamina B12 (cobalamina) caracterizado por manifestaciones bioquímicas, neurológicas y hematológicas variables.


Se han descrito tres presentaciones diferentes: la forma clásica con aciduria metilmalónica y homocistinuria combinadas; la variante 1 de cblD (cblDv1) con homocistinuria aislada; y la variante 2 de cblD (cblDv2) con aciduria metilmalónica aislada. La presentación clínica es extremadamente variable. El trastorno puede presentarse desde la primera infancia hasta la última. Los signos que se presentan son variables dependiendo del aspecto o aspectos del metabolismo de la cobalamina que estén afectados y pueden incluir retraso en el desarrollo, dificultades graves de aprendizaje, convulsiones, anomalías en el movimiento y la marcha, problemas de comportamiento y signos de anemia megaloblástica (palidez, fatiga, anorexia).

Acidemia metilmalónica sensible a la vitamina B12, tipo cblDv2

La encefalopatía por deficiencia de sulfito oxidasa es un raro trastorno neurometabólico caracterizado por convulsiones, encefalopatía progresiva y dislocación del cristalino.


Los pacientes suelen presentarse en la infancia o en la niñez temprana con características que incluyen letargo, retraso en el crecimiento, vómitos recurrentes, deshidratación, dificultad respiratoria, hipotonía muscular, hepatomegalia y coma. También pueden mostrar signos de anemia (no megaloblástica), presentar cetoacidosis y/o hiperamonemia potencialmente mortales, y retraso en el desarrollo y déficit intelectual, con un accidente metabólico que afecta al tronco cerebral. La AM conduce con frecuencia a una insuficiencia renal terminal en la adolescencia o en la edad adulta. Los pacientes con cblB suelen estar más afectados que los pacientes con cblA.


NM_015702.2(MMADHC):c.776T>C ; NM_015702.2(MMADHC):c.748C>T ; NM_015702.2(MMADHC):c.545C>A ; c.478+1G>T ; NM_015702.3(MMADHC):c.419dup ; c.795dup ; NM_015702.2(MMADHC):c.746A>G ; NM_015702.2(MMADHC):c.57_64delCTCTTTAG ; NM_015702.2(MMADHC):c.776T>C ; NM_015702.2(MMADHC):c.748C>T ; NM_015702.2(MMADHC):c.545C>A ; c.478+1G>T ; NM_015702.3(MMADHC):c.419dup ; c.795dup ; NM_015702.2(MMADHC):c.746A>G ; NM_015702.2(MMADHC):c.57_64delCTCTTTAG



Acidemia metilmalónica resistente a la vitamina B12 tipo mut-

La acidemia metilmalónica resistente a vitamina B12 tipo mut- es un error innato del metabolismo que se caracteriza por comas cetoacidóticos recurrentes o vómitos transitorios, deshidratación, hipotonía y déficit intelectual, y que no responde a la administración de vitamina B12.


La enfermedad se presenta normalmente muy temprano en la vida (<1 a 4 semanas), aunque se han observado casos de aparición más tardía, con características que incluyen letargia, retraso en el crecimiento, vómitos recurrentes, deshidratación, dificultad respiratoria, hipotonía muscular, retraso del desarrollo, déficit intelectual, hepatomegalia y coma. Los pacientes pueden mostrar signos de anemia. También pueden tener cetoacidosis y/o hiperamonemia con un potencial riesgo vital, complicaciones renales y neurológicas, fallo metabólico y miocardipatía. La mut- es normalmente menos grave que la acidemia metilmalónica resistente a vitamina B12 tipo mut0 (consulte este término) y en algunos casos responde a la terapia con vitamina B12. Las complicaciones a largo plazo incluyen el fallo metabólico y el desarrollo de una insuficiencia renal terminal. Estas complicaciones son más frecuentes en mut0 que en mut-.


NM_000255.3(MMUT):c.2150G>T ; NM_000255.3(MMUT):c.1867G>A ; NM_000255.3(MMUT):c.91C>T ; NM_000255.3(MMUT):c.1106G>A ; NM_000255.3(MMUT):c.2080C>T ; NM_000255.3(MMUT):c.643G>A ; NM_000255.3(MMUT):c.278G>A ; NM_000255.3(MMUT):c.313T>C ; NM_000255.3(MMUT):c.1280G>A ; c.1181T>A ; NM_000255.3(MMUT):c.1399C>T ; NM_000255.3(MMUT):c.1741C>T ; NM_000255.3(MMUT):c.1924G>C ; NM_000255.3(MMUT):c.280G>A ; NM_000255.3(MMUT):c.914T>C ; NM_000255.3(MMUT):c.572C>A ; c.1658del ; NM_000255.3(MMUT):c.1207C>T ; NM_000255.3(MMUT):c.607G>A ; NM_000255.3(MMUT):c.1445-2A>G ; NM_000255.3(MMUT):c.671_678dup ; NM_000255.3(MMUT):c.655A>T ; NM_000255.3(MMUT):c.1420C>T ; NM_000255.3(MMUT):c.682C>T ; NM_000255.3(MMUT):c.2150G>T ; NM_000255.3(MMUT):c.1867G>A ; NM_000255.3(MMUT):c.91C>T ; NM_000255.3(MMUT):c.1106G>A ; NM_000255.3(MMUT):c.2080C>T ; NM_000255.3(MMUT):c.643G>A ; NM_000255.3(MMUT):c.278G>A ; NM_000255.3(MMUT):c.313T>C ; NM_000255.3(MMUT):c.1280G>A ; c.1181T>A ; NM_000255.3(MMUT):c.1399C>T ; NM_000255.3(MMUT):c.1741C>T ; NM_000255.3(MMUT):c.1924G>C ; NM_000255.3(MMUT):c.280G>A ; NM_000255.3(MMUT):c.914T>C ; NM_000255.3(MMUT):c.572C>A ; c.1658del ; NM_000255.3(MMUT):c.1207C>T ; NM_000255.3(MMUT):c.607G>A ; NM_000255.3(MMUT):c.1445-2A>G ; NM_000255.3(MMUT):c.671_678dup ; NM_000255.3(MMUT):c.655A>T ; NM_000255.3(MMUT):c.1420C>T ; NM_000255.3(MMUT):c.682C>T



Acidemia metilmalónica resistente a la vitamina B12 tipo mut 0

La acidemia metilmalónica resistente a vitamina B12 tipo mut0 es un error innato del metabolismo que se caracteriza por comas cetoacidóticos recurrentes o vómitos transitorios, deshidratación, hipotonía y déficit intelectual, y que no responde a la administración de vitamina B12.


La enfermedad se presenta normalmente muy temprano en la vida (<1 a 4 semanas), aunque se han observado casos poco frecuentes de aparición más tardía, con características que incluyen letargia, retraso en el crecimiento, vómitos recurrentes, deshidratación, dificultad respiratoria, hipotonía muscular, retraso del desarrollo, déficit intelectual, hepatomegalia y coma. Los pacientes pueden mostrar signos de anemia. También pueden tener cetoacidosis y/o hiperamonemia con un potencial riesgo vital, complicaciones renales y neurológicas, fallo metabólico y miocardiopatía.


c.397_406del ; NM_001075098.3(MOCS1):c.217C>T ; c.1027C>T ; NM_001075098.3(MOCS1):c.956G>A ; c.397_406del ; NM_001075098.3(MOCS1):c.217C>T ; c.1027C>T ; NM_001075098.3(MOCS1):c.956G>A




La MPI-CDG es una forma de trastornos congénitos de la glicosilación ligada al N, caracterizada por vómitos cíclicos, hipoglucemia profunda, retraso en el desarrollo, fibrosis hepática, complicaciones gastrointestinales (enteropatía perdedora de proteínas con hipoalbuminemia, hemorragia intestinal de origen difuso que pone en peligro la vida) y eventos trombóticos (deficiencia de proteínas C y S, niveles bajos de antitrombina III), mientras que el desarrollo neurológico y la capacidad cognitiva suelen ser normales. El curso clínico es variable incluso dentro de las familias. La enfermedad está causada por la pérdida de función del gen MPI (15q24.1).


La MPI-CDG es una forma de trastornos congénitos de la glicosilación ligada al N, caracterizada por vómitos cíclicos, hipoglucemia profunda, retraso en el desarrollo, fibrosis hepática, complicaciones gastrointestinales (enteropatía perdedora de proteínas con hipoalbuminemia, hemorragia intestinal de origen difuso que pone en peligro la vida) y eventos trombóticos (deficiencia de proteínas C y S, niveles bajos de antitrombina III), mientras que el desarrollo neurológico y la capacidad cognitiva suelen ser normales. El curso clínico es variable incluso dentro de las familias. La enfermedad está causada por la pérdida de función del gen MPI (15q24.1).


NM_002435.1(MPI):c.656G>A ; c.833_836del ; NM_002435.2(MPI):c.413T>C ; NM_002435.2(MPI):c.884G>A ; NM_002435.2(MPI):c.305C>T ; NM_002435.1(MPI):c.656G>A ; c.833_836del ; NM_002435.2(MPI):c.413T>C ; NM_002435.2(MPI):c.884G>A ; NM_002435.2(MPI):c.305C>T



Neurohepatopatía navajo

Enfermedad rara, potencialmente mortal, del síndrome de depleción del ADN mitocondrial, caracterizada por una neuropatía sensoriomotora grave y progresiva asociada a ulceración corneal, cicatrización o anestesia, mutilación acral, trastorno metabólico e inmunológico, y hepatopatía (que puede manifestarse con insuficiencia hepática fulminante, un síndrome similar al de Reye o una progresión indolente a cirrosis hepática, dependiendo de la forma clínica implicada), presente en la población nativa americana Navajo. La presentación clínica incluye retraso en el crecimiento, debilidad de las extremidades distales con reducción de la sensibilidad, contracturas de las extremidades con pérdida de funcionalidad, arreflexia, acidosis metabólica recurrente con enfermedades intercurrentes, anomalías inmunológicas que se manifiestan con infecciones sistémicas graves e infantilismo sexual.


Una enfermedad rara, potencialmente mortal, del síndrome de depleción del ADN mitocondrial, caracterizada por una neuropatía sensoriomotora grave y progresiva asociada a ulceración corneal, cicatrización o anestesia, mutilación acral, trastorno metabólico e inmunológico y hepatopatía (que puede manifestarse con insuficiencia hepática fulminante, un síndrome similar al de Reye o una progresión indolente hacia la cirrosis hepática, según la forma clínica de que se trate), presente en la población de nativos americanos navajos. La presentación clínica incluye retraso en el crecimiento, debilidad de las extremidades distales con reducción de la sensibilidad, contracturas de las extremidades con pérdida de funcionalidad, arreflexia, acidosis metabólica recurrente con enfermedades intercurrentes, anomalías inmunológicas que se manifiestan con infecciones sistémicas graves e infantilismo sexual.


NM_002437.4(MPV17):c.498C>A ; NM_002437.4(MPV17):c.70G>T ; NM_002437.4(MPV17):c.284dupG ; NM_002437.4(MPV17):c.359G>A ; c.462-2A>C ; NM_002437.4(MPV17):c.263_265delAGA ; NM_002437.4(MPV17):c.148C>T ; NM_002437.4(MPV17):c.149G>A ; NM_002437.4(MPV17):c.498C>A ; NM_002437.4(MPV17):c.70G>T ; NM_002437.4(MPV17):c.284dupG ; NM_002437.4(MPV17):c.359G>A ; c.462-2A>C ; NM_002437.4(MPV17):c.263_265delAGA ; NM_002437.4(MPV17):c.148C>T ; NM_002437.4(MPV17):c.149G>A



Espina bífida cervical abierta




Espina bífida cística cervical




Espina bífida cervicotorácica abierta




Espina bífida cística cervicotorácica




Homocistinuria por deficiencia de metileno tetrahidrofolato reductasa

La homocistinuria por deficiencia de metileno tetrahidrofolato reductasa (MTHFR) es un trastorno metabólico caracterizado por manifestaciones neurológicas.


El inicio suele producirse durante el primer año de vida con signos neurológicos graves, apnea recurrente, microcefalia y convulsiones. No hay anemia megaloblástica. Hay algunas formas con inicio durante la infancia, la adolescencia o la edad adulta que comienzan con regresión mental, ataxia y, con mayor frecuencia, trastornos psiquiátricos comunes de tipo esquizofrénico que pueden estar relacionados con accidentes cerebrovasculares. Se han descrito otros síntomas como la degeneración subaguda de la médula espinal.

Anencefalia aislada

Defecto del tubo neural. Esta malformación se caracteriza por la ausencia total o parcial de la bóveda craneal y de la piel que la cubre, faltando el cerebro o reduciéndolo a una pequeña masa. La mayoría de los casos nacen muertos, aunque se ha informado de que algunos bebés sobreviven unas horas o incluso unos días.


Los defectos del tubo neural tienen una incidencia al nacer de aproximadamente 1 de cada 1.000 en los caucásicos estadounidenses y son el segundo tipo de defecto de nacimiento más común después de los defectos cardíacos congénitos. Los defectos del tubo neural más comunes son la espina bífida abierta (mielomeningocele) y la anencefalia. Las mujeres con un nivel elevado de homocisteína en plasma, un nivel bajo de folato o un nivel bajo de vitamina B12 (cobalamina) tienen un mayor riesgo de tener un hijo con un defecto del tubo neural.

Exencefalia aislada

Un defecto del tubo neural. Esta malformación se caracteriza por la ausencia total o parcial de la bóveda craneal y de la piel que la cubre, faltando el cerebro o reduciéndolo a una pequeña masa. La mayoría de los casos nacen muertos, aunque se ha informado de que algunos bebés sobreviven unas horas o incluso unos días.


Los defectos del tubo neural tienen una incidencia al nacer de aproximadamente 1 de cada 1.000 en la población caucásica estadounidense y son el segundo tipo de defecto de nacimiento más común después de los defectos cardíacos congénitos. Los defectos del tubo neural más comunes son la espina bífida abierta (mielomeningocele) y la anencefalia. Las mujeres con un nivel elevado de homocisteína en plasma, un nivel bajo de folato o un nivel bajo de vitamina B12 (cobalamina) tienen un mayor riesgo de tener un hijo con un defecto del tubo neural.

Espina bífida lumbosacra abierta




Espina bífida cística lumbosacra




NO RARO EN EUROPA: Trombofilia no rara

La trombofilia es un trastorno multifactorial de formación inadecuada de coágulos que resulta de una interacción de factores predisponentes genéticos, adquiridos y circunstanciales. El tromboembolismo venoso se manifiesta más comúnmente como una trombosis venosa profunda, que puede progresar a una embolia pulmonar si el coágulo se desplaza y llega al pulmón. Otras manifestaciones son las trombosis de las venas cerebrales o viscerales y la pérdida recurrente del embarazo.



Espina bífida toracolumbosacra aperta




Espina bífida cística toracolumbosacra




Espina bífida abierta total




Espina bífida cística total




Espina bífida torácica superior abierta




Espina bífida cística torácica superior





c.3G>A ; NM_005957.4(MTHFR):c.968T>C ; c.562C>T ; NM_005957.4(MTHFR):c.547C>T ; c.1891del ; NM_005957.4(MTHFR):c.1743G>A ; NM_005957.4(MTHFR):c.971A>G ; c.3G>A ; NM_005957.4(MTHFR):c.968T>C ; c.562C>T ; NM_005957.4(MTHFR):c.547C>T ; c.1891del ; NM_005957.4(MTHFR):c.1743G>A ; NM_005957.4(MTHFR):c.971A>G



Miopatía centronuclear ligada al X

Una rara miopatía congénita ligada al cromosoma X caracterizada por numerosos núcleos situados en el centro en la biopsia muscular y que se presenta al nacer con una marcada debilidad, hipotonía e insuficiencia respiratoria.


La enfermedad se caracteriza por un fenotipo grave en los varones que se presentan al nacer con una marcada debilidad, hipotonía e insuficiencia respiratoria. Los signos de aparición prenatal son frecuentes y comprenden movimientos fetales reducidos y polihidramnios. En las radiografías de tórax del recién nacido se observa un adelgazamiento de las costillas. La asfixia al nacer puede ser la característica de presentación. Son frecuentes los antecedentes familiares de muertes neonatales masculinas o de abortos. Los bebés afectados suelen ser macrosómicos, con una longitud corporal superior al percentil 90 y un gran perímetro cefálico. La oftalmoplejía externa suele estar asociada. Los testículos no suelen descender. En algunos supervivientes a largo plazo se ha observado estenosis pilórica y hemangiomas cavernosos del hígado.

Miopatía miotubular ligada al cromosoma X - síndrome de genitales anormales

La forma sintomática de la hemocromatosis de tipo 1 es una hemocromatosis hereditaria poco frecuente que se caracteriza por una absorción de hierro intestinal regulada de forma inadecuada, lo que conduce a un almacenamiento excesivo de hierro en varios órganos y se manifiesta con una amplia gama de signos y síntomas, como dolor abdominal, debilidad, letargo, pérdida de peso, niveles elevados de aminotransferasa sérica, aumento de la pigmentación de la piel y/o artropatía en las articulaciones metacarpofalángicas. Otras manifestaciones comúnmente asociadas incluyen hepatomegalia, cirrosis, fibrosis hepática, carcinoma hepatocelular, cardiomiopatía restrictiva y/o diabetes mellitus.


Son frecuentes la diplejía facial y a menudo la oftalmoplejía externa. Los casos de recién nacidos se asemejan a los de la distrofia miotónica congénita; la distinción puede hacerse mediante el examen de su madre que, en esta última situación, mostrará invariablemente una leve debilidad facial y una miotonía clínica o eléctrica. El polihidramnios es una característica de ambas formas de miopatía congénita, es decir, la distrofia miotónica y la miopatía miotubular ligada al cromosoma X. 


NM_000252.2(MTM1):c.1261-10A>G ; NM_000252.2(MTM1):c.969del ; c.461T>G ; NM_000252.2(MTM1):c.70C>T ; c.780T>A ; NM_000252.2(MTM1):c.595_599delCCTGC ; NM_000252.2(MTM1):c.1306_1310dupCCTAT ; NM_000252.2(MTM1):c.670C>T ; NM_000252.2(MTM1):c.721C>T ; NM_000252.2(MTM1):c.969dup ; NM_000252.2(MTM1):c.1357_1358delCC ; NM_000252.2(MTM1):c.1415_1416delGT ; NM_000252.2(MTM1):c.420C>G ; NM_000252.2(MTM1):c.1261-10A>G ; NM_000252.2(MTM1):c.969del ; c.461T>G ; NM_000252.2(MTM1):c.70C>T ; c.780T>A ; NM_000252.2(MTM1):c.595_599delCCTGC ; NM_000252.2(MTM1):c.1306_1310dupCCTAT ; NM_000252.2(MTM1):c.670C>T ; NM_000252.2(MTM1):c.721C>T ; NM_000252.2(MTM1):c.969dup ; NM_000252.2(MTM1):c.1357_1358delCC ; NM_000252.2(MTM1):c.1415_1416delGT ; NM_000252.2(MTM1):c.420C>G




Una hipobetalipoproteinemia familiar grave caracterizada por niveles permanentemente bajos (por debajo del percentil 5) de apolipoproteína B y colesterol LDL, y por retraso en el crecimiento, malabsorción, hepatomegalia y manifestaciones neurológicas y neuromusculares.


La abetalipoproteinemia se manifiesta durante el primer año de vida o en la primera infancia. Suele estar asociada a un retraso del crecimiento, hepatomegalia con esteatosis, diarrea con esteatorrea y malabsorción de grasas. Puede producirse ataxia espástica, retinitis pigmentaria atípica, acantocitosis, un bajo nivel de vitaminas liposolubles y citolisis importante e incluso cirrosis.

NO ES RARO EN EUROPA: Hipobetalipoproteinemia familiar

Las características son el síndrome celíaco, la degeneración pigmentaria de la retina, la neuropatía atáxica progresiva y una peculiar malformación de los glóbulos rojos llamada acantocitosis. La absorción intestinal de lípidos es defectuosa, el colesterol sérico es muy bajo y la beta lipoproteína sérica está ausente.


La abetalipoproteinemia y la hipobetalipoproteinemia familiar son enfermedades raras que se caracterizan por la hipocolesterolemia y la mala absorción de vitaminas liposolubles, lo que provoca degeneración de la retina, neuropatía y coagulopatía. También es frecuente la esteatosis hepática. La causa fundamental de ambos trastornos es el empaquetamiento y la secreción inadecuados de las partículas que contienen apolipoproteína B. Los padres heterocigotos obligados de los pacientes con ABL suelen tener lípidos normales, lo que corresponde a una herencia autosómica recesiva, mientras que los padres heterocigotos obligados de los pacientes con FBHL suelen tener niveles medio normales de lipoproteínas que contienen apoB, lo que corresponde a una herencia autosómica codominante.


c.1867+1G>A ; NM_000253.3:c.2593G>T ; c.2031del ; NM_000253.3(MTTP):c.1769G>T ; NM_000253.3(MTTP):c.1619G>A ; NM_000253.3(MTTP):c.708_709del ; c.1867+1G>A ; NM_000253.3:c.2593G>T ; c.2031del ; NM_000253.3(MTTP):c.1769G>T ; NM_000253.3(MTTP):c.1619G>A ; NM_000253.3(MTTP):c.708_709del



Sordera neurosensorial autosómica recesiva de tipo DFNB

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.


NM_016239.4(MYO15A):c.3756+1G>T ; c.6046+2T>G ; NM_016239.4(MYO15A):c.10573del ; NM_016239.4(MYO15A):c.9958_9961del ; c.4751_4752dup ; NM_016239.3(MYO15A):c.3385C>T ; c.755dup ; NM_016239.3(MYO15A):c.8148G>T ; NM_016239.3(MYO15A):c.5492G>T ; c.8548C>T ; NM_016239.3(MYO15A):c.625G>T ; c.3693-2A>G ; NM_016239.4(MYO15A):c.3336del ; c.8410A>T ; c.6864_6874del ; c.8432_8450del ; c.5326C>T ; c.6004del ; NM_016239.3(MYO15A):c.3313G>T ; NM_016239.4(MYO15A):c.3756+1G>T ; c.6046+2T>G ; NM_016239.4(MYO15A):c.10573del ; NM_016239.4(MYO15A):c.9958_9961del ; c.4751_4752dup ; NM_016239.3(MYO15A):c.3385C>T ; c.755dup ; NM_016239.3(MYO15A):c.8148G>T ; NM_016239.3(MYO15A):c.5492G>T ; c.8548C>T ; NM_016239.3(MYO15A):c.625G>T ; c.3693-2A>G ; NM_016239.4(MYO15A):c.3336del ; c.8410A>T ; c.6864_6874del ; c.8432_8450del ; c.5326C>T ; c.6004del ; NM_016239.3(MYO15A):c.3313G>T



Sordera neurosensorial autosómica dominante de tipo DFNA

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Sordera neurosensorial autosómica recesiva de tipo DFNB

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.


La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Síndrome de Usher tipo 1

Una rara ciliopatía caracterizada por sordera congénita profunda, retinitis pigmentosa y disfunción vestibular. La retinosis pigmentaria provoca la pérdida de visión y se manifiesta generalmente como ceguera nocturna, campos visuales progresivamente constreñidos y deterioro de la agudeza visual. La disfunción vestibular, que es una característica definitoria de esta forma, se manifiesta como un retraso en el desarrollo motor, ya que los niños afectados tardan más en sentarse de forma independiente y en caminar. Más adelante, la disfunción vestibular provoca dificultades en las actividades que requieren equilibrio.


Una rara ciliopatía caracterizada por sordera congénita profunda, retinitis pigmentosa y disfunción vestibular. La retinosis pigmentaria provoca la pérdida de la visión y se manifiesta generalmente como ceguera nocturna, campos visuales progresivamente constreñidos y agudeza visual deteriorada. La disfunción vestibular, que es una característica definitoria de esta forma, se manifiesta como un retraso en el desarrollo motor, ya que los niños afectados tardan más en sentarse de forma independiente y en caminar. Más adelante, la disfunción vestibular provoca dificultades en las actividades que requieren equilibrio.

Síndrome de Usher tipo 2

Una rara ciliopatía caracterizada por sordera congénita de moderada a grave, retinitis pigmentaria que se desarrolla en la primera o segunda década, y función vestibular normal. La pérdida de audición neurosensorial bilateral congénita es de leve a moderada en las frecuencias bajas y de grave a profunda en las frecuencias altas. Otras manifestaciones son la ceguera nocturna, la constricción del campo visual (visión en túnel) y, más adelante, la disminución de la agudeza visual, que a veces termina con la percepción de la luz desnuda.


Una rara ciliopatía caracterizada por sordera congénita de moderada a grave, retinitis pigmentaria que se desarrolla en la primera o segunda década, y función vestibular normal. La pérdida de audición neurosensorial bilateral congénita es de leve a moderada en las frecuencias bajas y de grave a profunda en las frecuencias altas. Otras manifestaciones son la ceguera nocturna, la constricción del campo visual (visión en túnel) y, más adelante, la disminución de la agudeza visual, que a veces termina con la percepción de la luz desnuda.


c.1344-1G>A ; NM_000260.4:c.2476G>A ; NM_000260.3(MYO7A):c.133-2A>G ; NM_000260.3(MYO7A):c.634C>T ; NM_000260.3(MYO7A):c.6025delG ; NM_000260.3(MYO7A):c.494C>T ; NM_000260.3(MYO7A):c.3508G>A ; NM_000260.3(MYO7A):c.635G>A ; NM_000260.3(MYO7A):c.5824G>T ; NM_000260.3(MYO7A):c.5886_5889delCTTT ; NM_000260.3(MYO7A):c.5392C>T ; NM_000260.3(MYO7A):c.1996C>T ; NM_000260.3(MYO7A):c.3764delA ; NM_000260.3(MYO7A):c.731G>C ; NM_000260.3(MYO7A):c.4024delT ; c.3596dup ; NM_000260.3(MYO7A):c.1884C>A ; NM_000260.3(MYO7A):c.448C>T ; NM_000260.3(MYO7A):c.3504-1G>C ; c.5967C>G ; NM_000260.4:c.640G>A ; NM_000260.3(MYO7A):c.1184G>A ; NM_000260.3(MYO7A):c.3G>A ; NM_000260.3(MYO7A):c.3719G>A ; NM_000260.3(MYO7A):c.1797G>A ; c.1344-1G>A ; NM_000260.4:c.2476G>A ; NM_000260.3(MYO7A):c.133-2A>G ; NM_000260.3(MYO7A):c.634C>T ; NM_000260.3(MYO7A):c.6025delG ; NM_000260.3(MYO7A):c.494C>T ; NM_000260.3(MYO7A):c.3508G>A ; NM_000260.3(MYO7A):c.635G>A ; NM_000260.3(MYO7A):c.5824G>T ; NM_000260.3(MYO7A):c.5886_5889delCTTT ; NM_000260.3(MYO7A):c.5392C>T ; NM_000260.3(MYO7A):c.1996C>T ; NM_000260.3(MYO7A):c.3764delA ; NM_000260.3(MYO7A):c.731G>C ; NM_000260.3(MYO7A):c.4024delT ; c.3596dup ; NM_000260.3(MYO7A):c.1884C>A ; NM_000260.3(MYO7A):c.448C>T ; NM_000260.3(MYO7A):c.3504-1G>C ; c.5967C>G ; NM_000260.4:c.640G>A ; NM_000260.3(MYO7A):c.1184G>A ; NM_000260.3(MYO7A):c.3G>A ; NM_000260.3(MYO7A):c.3719G>A ; NM_000260.3(MYO7A):c.1797G>A



Hiperamonemia por deficiencia de N-acetilglutamato sintasa

La aciduria malónica es un trastorno metabólico causado por la deficiencia de malonil-CoA descarboxilasa (MCD).


La aparición se produce a cualquier edad, pero la presentación neonatal parece ser la más frecuente. Las manifestaciones clínicas son variables, pero los rasgos comunes incluyen vómitos, hiperactividad o letargo, diarrea, mala alimentación, convulsiones, hipotonía, retraso en el desarrollo psicomotor y dificultad respiratoria. La hiperamonemia suele ser grave y puede conducir a un coma hiperamonémico.


NM_153006.2(NAGS):c.1299G>C ; NM_153006.2(NAGS):c.1025del ; NM_153006.2(NAGS):c.916-2A>T ; NM_153006.3(NAGS):c.1307dup ; NM_153006.2(NAGS):c.1289T>C ; NM_153006.2(NAGS):c.971G>A ; NM_153006.2(NAGS):c.1299G>C ; NM_153006.2(NAGS):c.1025del ; NM_153006.2(NAGS):c.916-2A>T ; NM_153006.3(NAGS):c.1307dup ; NM_153006.2(NAGS):c.1289T>C ; NM_153006.2(NAGS):c.971G>A



Enfermedad de Charcot-Marie-Tooth tipo 4D

Por convención, la designación CMT4 se aplica a las formas autosómicas recesivas de la enfermedad desmielinizante de Charcot-Marie-Tooth, que es una neuropatía periférica caracterizada por una alteración motora y sensorial distal que provoca dificultades en la marcha y está asociada a deformidades del pie. Las velocidades de conducción del nervio motor están disminuidas y las biopsias del nervio sural muestran una pérdida de fibras mielinizadas. La edad de inicio y la gravedad son variables.


La enfermedad de Charcot-Marie-Tooth tipo 4D (CMT4D) es un subtipo de la enfermedad de Charcot-Marie-Tooth tipo 4 que se caracteriza por la aparición en la infancia de una neuropatía sensomotora desmielinizante grave que se manifiesta con debilidad y atrofia muscular distal, deficiencia auditiva neurosensorial que conduce a la sordera (normalmente en la tercera década), velocidades de conducción nerviosa gravemente reducidas y deformidades esqueléticas, especialmente en los pies. También se ha informado de atrofia de la lengua.


c.16C>T ; NM_001135242.1(NDRG1):c.442C>T ; c.928C>T ; c.-18-2_-18-1del ; c.16C>T ; NM_001135242.1(NDRG1):c.442C>T ; c.928C>T ; c.-18-2_-18-1del



Miopatía nemalina de inicio en la infancia

La miopatía nemalínica de inicio en la infancia, o miopatía nemalínica leve, es un tipo de miopatía nemalínica (NM; véanse estos términos) caracterizada por debilidad muscular distal y, en ocasiones, lentitud de la contracción muscular.


La NM de inicio en la infancia puede representar el 10-15% del total de casos. El inicio es alrededor de los 10 años de edad, con una presentación inicial de debilidad simétrica de la dorsiflexión del tobillo y la caída del pie, o una lentitud general de la contracción muscular. Todos los movimientos del tobillo y los músculos de las extremidades más proximales pueden estar alterados. La debilidad es lentamente progresiva. Los músculos faciales, respiratorios y cardíacos suelen ser normales, pero los pacientes son incapaces de saltar o correr debido a la debilidad o lentitud muscular.

Miopatía distal de la nebulina

La miopatía distal por nebulina es una miopatía distal rara, lentamente progresiva y autosómica recesiva que se caracteriza por la aparición temprana de una debilidad y atrofia muscular predominantemente distal que afecta a los músculos extensores de las piernas, los extensores de los dedos y los flexores del cuello. La histología muscular no siempre muestra bastones nemalinos.


La miopatía distal por nebulina se manifiesta inicialmente, en la primera infancia o en la juventud, por la caída del pie, pero los primeros síntomas pueden observarse a partir del año de edad. Los músculos más afectados son los dorsiflexores del tobillo, los extensores de los dedos y los flexores del cuello. Los pacientes no suelen ser capaces de caminar sobre los talones y, más adelante en el curso de la enfermedad, hay una leve afectación de los músculos proximales. Otras características adicionales son la debilidad facial moderada de aparición temprana y los problemas respiratorios leves, como la dificultad para respirar al realizar un ejercicio extenuante (aunque sólo se ha informado de un paciente que presenta una disminución de la capacidad vital). El músculo cardíaco no suele estar afectado, aunque se ha descrito una miocardiopatía en un paciente.

Miopatía nemalina intermedia

La miopatía nemalina intermedia es un tipo de miopatía nemalina (MN; véase este término) que presenta características de la MN típica (véase este término) en neonatos con una progresión más grave.


Los neonatos con NM intermedia presentan movimientos antigravitatorios espontáneos y una musculatura respiratoria activa, pero con una debilidad generalizada progresiva que impide alcanzar los hitos de la motricidad gruesa o conduce a la pérdida de la deambulación y/o la respiración independiente a los 11 años. Los niños suelen desarrollar contracturas articulares.

Síndrome de pterigión múltiple letal

Un raro síndrome genético de pterigión múltiple caracterizado por un retraso del crecimiento intrauterino, acinesia fetal, contracturas articulares múltiples que provocan artrogriposis severa y pterigión (palmeo) en múltiples articulaciones. El higroma quístico y/o la hidropesía fetal están casi siempre presentes.


El síndrome de pterigión múltiple letal (LMPS) se caracteriza por una deficiencia de crecimiento de inicio prenatal, pterigión presente en múltiples zonas (de la barbilla al esternón, cervical, axilar, humero-cubital, crural, poplítea y los tobillos) y contracturas de flexión que dan lugar a una artrogriposis grave. El edema subcutáneo varía desde la piel ligeramente edematosa hasta la hidropesía fetal con higroma quístico, hipoplasia pulmonar y oligo o polihidramnios. Las anomalías faciales incluyen hipertelorismo, fisuras palpebrales inclinadas hacia abajo, pliegues epicánticos, raíz nasal plana, microretrognatismo, microstomía, orejas malformadas de implantación baja y paladar hendido. Otras anomalías incluyen un tórax pequeño, volumen muscular reducido, criptorquidia, anomalías del sistema nervioso central (en particular hipoplasia cerebelosa, dilatación ventricular y polimicrogiria), crestas y pliegues dérmicos hipoplásicos y, con menor frecuencia, un hemangioma en la parte media de la cabeza, malrotación intestinal, hipoplasia cardíaca, hernia diafragmática, uropatía obstructiva, pies de balancín, microcefalia y/o hipoplasia cerebelosa y pontina.

Miopatía nemalina congénita grave

La miopatía nemalina congénita grave es una forma severa de miopatía nemalina (MN; véase este término) caracterizada por una hipotonía severa con poco movimiento espontáneo en los neonatos.


Los neonatos tienen dificultades de succión y deglución, y reflujo gastroesofágico, lo que provoca un retraso en el desarrollo. La afectación del diafragma y los músculos intercostales contribuye a la insuficiencia respiratoria. Pueden aparecer miocardiopatía y artrogriposis.

Miopatía nemalina típica

La miopatía nemalina típica es una forma neonatal moderada de miopatía nemalina (NM; véase este término) caracterizada por debilidad muscular facial y esquelética y una leve afectación respiratoria.


La enfermedad se inicia en el periodo neonatal. Los pacientes tienen la cara alargada, el paladar muy arqueado y el labio superior hundido. Las anomalías esqueléticas pueden incluir cifoescoliosis, pectus carinatum y pie cavo. En el primer año de vida, la hipotonía y la debilidad facial están presentes y a menudo contribuyen al retraso del crecimiento y del desarrollo motor. Los movimientos antigravitatorios están presentes y la afectación de los músculos respiratorios es frecuente. La hipoxia e hipercarbia nocturnas y las infecciones del tracto respiratorio inferior son manifestaciones comunes. Puede observarse hipermovilidad articular. En una minoría de niños la debilidad es más distal. La progresión es muy lenta o inexistente y la mayoría de los pacientes son capaces de llevar una vida activa e independiente.


c.24874-1G>A ; c.843T>G ; c.2173G>T ; c.21945+1G>A ; c.6105dup ; NM_001271208.1(NEB):c.24770_24771delTT ; c.24687_24688del ; NM_001271208.1(NEB):c.8031_8041delAAATAAACGAG ; NM_001271208.1(NEB):c.24094C>T ; c.12203_12204del ; NM_001271208.1(NEB):c.25279G>T ; NM_001164507.1(NEB):c.21076C>T ; ENST00000397345.7:c.25404+1_25404+2insATGGA ; NM_001271208.1(NEB):c.23526_23527delAG ; c.24874-1G>A ; c.843T>G ; c.2173G>T ; c.21945+1G>A ; c.6105dup ; NM_001271208.1(NEB):c.24770_24771delTT ; c.24687_24688del ; NM_001271208.1(NEB):c.8031_8041delAAATAAACGAG ; NM_001271208.1(NEB):c.24094C>T ; c.12203_12204del ; NM_001271208.1(NEB):c.25279G>T ; NM_001164507.1(NEB):c.21076C>T ; ENST00000397345.7:c.25404+1_25404+2insATGGA ; NM_001271208.1(NEB):c.23526_23527delAG



Enfermedad de Niemann-Pick tipo C, aparición neurológica adulta

Una rara enfermedad por almacenamiento de lípidos lisosomales que se caracteriza por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal o colestasis prolongada e inexplicable, esplenomegalia aislada e inexplicable, y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


El inicio y la presentación clínica son heterogéneos. La NPDC es clásicamente una enfermedad neurovisceral con hepatoesplenomegalia que suele preceder a los síntomas neurológicos, y que se presenta en la infancia o en la niñez, pero que puede ocurrir mucho más tarde. Algunos pacientes presentan una enfermedad pulmonar temprana y un pequeño subgrupo de pacientes puede desarrollar una insuficiencia hepática o respiratoria que se deteriora rápidamente en la primera infancia. La aparición neurológica varía entre la primera infancia y la edad adulta. Normalmente, la afectación neurológica es progresiva y consiste principalmente en distonía, ataxia cerebelosa, disartria, disfagia y demencia progresiva. La VSGP y la cataplexia (con o sin narcolepsia) son características. Los trastornos psiquiátricos son frecuentes en los pacientes de inicio tardío.

Enfermedad de Niemann-Pick tipo C, inicio neurológico juvenil

Una rara enfermedad por almacenamiento de lípidos lisosomales que se caracteriza por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal o colestasis prolongada e inexplicable, esplenomegalia aislada e inexplicable, y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


El inicio y la presentación clínica son heterogéneos. La NPDC es clásicamente una enfermedad neurovisceral con hepatoesplenomegalia que suele preceder a los síntomas neurológicos, y que se presenta en la infancia o en la niñez, pero que puede ocurrir mucho más tarde. Algunos pacientes presentan una enfermedad pulmonar temprana y un pequeño subgrupo de pacientes puede desarrollar una insuficiencia hepática o respiratoria que se deteriora rápidamente en la primera infancia. La aparición neurológica varía entre la primera infancia y la edad adulta. Normalmente, la afectación neurológica es progresiva y consiste principalmente en distonía, ataxia cerebelosa, disartria, disfagia y demencia progresiva. La VSGP y la cataplexia (con o sin narcolepsia) son características. Los trastornos psiquiátricos son frecuentes en los pacientes de inicio tardío.

Enfermedad de Niemann-Pick tipo C, aparición neurológica infantil tardía

Una rara enfermedad por almacenamiento de lípidos lisosomales que se caracteriza por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal o colestasis prolongada e inexplicable, esplenomegalia aislada e inexplicable, y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


El inicio y la presentación clínica son heterogéneos. La NPDC es clásicamente una enfermedad neurovisceral con hepatoesplenomegalia que suele preceder a los síntomas neurológicos, y que se presenta en la infancia o en la niñez, pero que puede ocurrir mucho más tarde. Algunos pacientes presentan una enfermedad pulmonar temprana y un pequeño subgrupo de pacientes puede desarrollar una insuficiencia hepática o respiratoria que se deteriora rápidamente en la primera infancia. La aparición neurológica varía entre la primera infancia y la edad adulta. Normalmente, la afectación neurológica es progresiva y consiste principalmente en distonía, ataxia cerebelosa, disartria, disfagia y demencia progresiva. La VSGP y la cataplexia (con o sin narcolepsia) son características. Los trastornos psiquiátricos son frecuentes en los pacientes de inicio tardío.

Enfermedad de Niemann-Pick tipo C, inicio neurológico infantil grave

Una rara enfermedad por almacenamiento de lípidos lisosomales caracterizada por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal o colestasis prolongada inexplicable, esplenomegalia aislada inexplicable y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


El inicio y la presentación clínica son heterogéneos. La NPDC es clásicamente una enfermedad neurovisceral con hepatoesplenomegalia que suele preceder a los síntomas neurológicos, y que se presenta en la infancia o en la niñez, pero que puede ocurrir mucho más tarde. Algunos pacientes presentan una enfermedad pulmonar temprana y un pequeño subgrupo de pacientes puede desarrollar una insuficiencia hepática o respiratoria que se deteriora rápidamente en la primera infancia. La aparición neurológica varía entre la primera infancia y la edad adulta. Normalmente, la afectación neurológica es progresiva y consiste principalmente en distonía, ataxia cerebelosa, disartria, disfagia y demencia progresiva. La VSGP y la cataplexia (con o sin narcolepsia) son características. Los trastornos psiquiátricos son frecuentes en los pacientes de inicio tardío.

Enfermedad de Niemann-Pick tipo C, forma perinatal grave

Una rara enfermedad por almacenamiento de lípidos lisosomales caracterizada por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal prolongada e inexplicable o colestasis, esplenomegalia aislada e inexplicable, y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


El inicio y la presentación clínica son heterogéneos. La PKAN es clásicamente una afección neurovisceral con hepatoesplenomegalia que suele preceder a los síntomas neurológicos, y que se presenta en la infancia o en la niñez, aunque puede ocurrir mucho más tarde. Algunos pacientes presentan una enfermedad pulmonar temprana y un pequeño subgrupo de pacientes puede desarrollar una insuficiencia hepática o respiratoria que se deteriora rápidamente en la primera infancia. La aparición neurológica varía entre la primera infancia y la edad adulta. Normalmente, la afectación neurológica es progresiva y consiste principalmente en distonía, ataxia cerebelosa, disartria, disfagia y demencia progresiva. La VSGP y la cataplexia (con o sin narcolepsia) son características. Los trastornos psiquiátricos son frecuentes en los pacientes de inicio tardío.


NM_000271.4(NPC1):c.3467A>G ; NM_000271.4(NPC1):c.3175C>T ; c.1042C>T ; NM_000271.4(NPC1):c.1628C>T ; NM_000271.4(NPC1):c.3611_3614del ; NM_000271.4(NPC1):c.2861C>T ; NM_000271.4(NPC1):c.2848G>A ; NM_000271.4(NPC1):c.3104C>T ; NM_000271.4(NPC1):c.530G>A ; NM_000271.4(NPC1):c.352_353delAG ; NM_000271.5:c.1211G>A ; NM_000271.4(NPC1):c.3662del ; NM_000271.4(NPC1):c.2324A>C ; NM_000271.4(NPC1):c.3182T>C ; NM_000271.4(NPC1):c.2932C>T ; NM_000271.4(NPC1):c.2974G>A ; NM_000271.4(NPC1):c.2072C>T ; NM_000271.4(NPC1):c.2873G>A ; NM_000271.4(NPC1):c.337T>C ; NM_000271.4(NPC1):c.2761C>T ; NM_000271.4(NPC1):c.2842G>A ; NM_000271.4(NPC1):c.3425T>C ; NM_000271.4(NPC1):c.3467A>G ; NM_000271.4(NPC1):c.3175C>T ; c.1042C>T ; NM_000271.4(NPC1):c.1628C>T ; NM_000271.4(NPC1):c.3611_3614del ; NM_000271.4(NPC1):c.2861C>T ; NM_000271.4(NPC1):c.2848G>A ; NM_000271.4(NPC1):c.3104C>T ; NM_000271.4(NPC1):c.530G>A ; NM_000271.4(NPC1):c.352_353delAG ; NM_000271.5:c.1211G>A ; NM_000271.4(NPC1):c.3662del ; NM_000271.4(NPC1):c.2324A>C ; NM_000271.4(NPC1):c.3182T>C ; NM_000271.4(NPC1):c.2932C>T ; NM_000271.4(NPC1):c.2974G>A ; NM_000271.4(NPC1):c.2072C>T ; NM_000271.4(NPC1):c.2873G>A ; NM_000271.4(NPC1):c.337T>C ; NM_000271.4(NPC1):c.2761C>T ; NM_000271.4(NPC1):c.2842G>A ; NM_000271.4(NPC1):c.3425T>C



Enfermedad de Niemann-Pick tipo C, aparición neurológica adulta

Una rara enfermedad por almacenamiento de lípidos lisosomales que se caracteriza por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal o colestasis prolongada e inexplicable, esplenomegalia aislada e inexplicable, y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


El inicio y la presentación clínica son heterogéneos. La NPDC es clásicamente una enfermedad neurovisceral con hepatoesplenomegalia que suele preceder a los síntomas neurológicos, y que se presenta en la infancia o en la niñez, pero que puede ocurrir mucho más tarde. Algunos pacientes presentan una enfermedad pulmonar temprana y un pequeño subgrupo de pacientes puede desarrollar una insuficiencia hepática o respiratoria que se deteriora rápidamente en la primera infancia. La aparición neurológica varía entre la primera infancia y la edad adulta. Normalmente, la afectación neurológica es progresiva y consiste principalmente en distonía, ataxia cerebelosa, disartria, disfagia y demencia progresiva. La VSGP y la cataplexia (con o sin narcolepsia) son características. Los trastornos psiquiátricos son frecuentes en los pacientes de inicio tardío.

Enfermedad de Niemann-Pick tipo C, inicio neurológico juvenil

Una rara enfermedad por almacenamiento de lípidos lisosomales que se caracteriza por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal o colestasis prolongada e inexplicable, esplenomegalia aislada e inexplicable, y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


El inicio y la presentación clínica son heterogéneos. La NPDC es clásicamente una enfermedad neurovisceral con hepatoesplenomegalia que suele preceder a los síntomas neurológicos, y que se presenta en la infancia o en la niñez, pero que puede ocurrir mucho más tarde. Algunos pacientes presentan una enfermedad pulmonar temprana y un pequeño subgrupo de pacientes puede desarrollar una insuficiencia hepática o respiratoria que se deteriora rápidamente en la primera infancia. La aparición neurológica varía entre la primera infancia y la edad adulta. Normalmente, la afectación neurológica es progresiva y consiste principalmente en distonía, ataxia cerebelosa, disartria, disfagia y demencia progresiva. La VSGP y la cataplexia (con o sin narcolepsia) son características. Los trastornos psiquiátricos son frecuentes en los pacientes de inicio tardío.

Enfermedad de Niemann-Pick tipo C, aparición neurológica infantil tardía

Una rara enfermedad por almacenamiento de lípidos lisosomales que se caracteriza por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal o colestasis prolongada e inexplicable, esplenomegalia aislada e inexplicable, y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


El inicio y la presentación clínica son heterogéneos. La NPDC es clásicamente una enfermedad neurovisceral con hepatoesplenomegalia que suele preceder a los síntomas neurológicos, y que se presenta en la infancia o en la niñez, pero que puede ocurrir mucho más tarde. Algunos pacientes presentan una enfermedad pulmonar temprana y un pequeño subgrupo de pacientes puede desarrollar una insuficiencia hepática o respiratoria que se deteriora rápidamente en la primera infancia. La aparición neurológica varía entre la primera infancia y la edad adulta. Normalmente, la afectación neurológica es progresiva y consiste principalmente en distonía, ataxia cerebelosa, disartria, disfagia y demencia progresiva. La VSGP y la cataplexia (con o sin narcolepsia) son características. Los trastornos psiquiátricos son frecuentes en los pacientes de inicio tardío.

Enfermedad de Niemann-Pick tipo C, inicio neurológico infantil grave

Una rara enfermedad por almacenamiento de lípidos lisosomales caracterizada por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal o colestasis prolongada inexplicable, esplenomegalia aislada inexplicable y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


El inicio y la presentación clínica son heterogéneos. La NPDC es clásicamente una enfermedad neurovisceral con hepatoesplenomegalia que suele preceder a los síntomas neurológicos, y que se presenta en la infancia o en la niñez, pero que puede ocurrir mucho más tarde. Algunos pacientes presentan una enfermedad pulmonar temprana y un pequeño subgrupo de pacientes puede desarrollar una insuficiencia hepática o respiratoria que se deteriora rápidamente en la primera infancia. La aparición neurológica varía entre la primera infancia y la edad adulta. Normalmente, la afectación neurológica es progresiva y consiste principalmente en distonía, ataxia cerebelosa, disartria, disfagia y demencia progresiva. La VSGP y la cataplexia (con o sin narcolepsia) son características. Los trastornos psiquiátricos son frecuentes en los pacientes de inicio tardío.

Enfermedad de Niemann-Pick tipo C, forma perinatal grave

Una rara enfermedad por almacenamiento de lípidos lisosomales caracterizada por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal prolongada e inexplicable o colestasis, esplenomegalia aislada e inexplicable, y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.


El inicio y la presentación clínica son heterogéneos. La PKAN es clásicamente una afección neurovisceral con hepatoesplenomegalia que suele preceder a los síntomas neurológicos, y que se presenta en la infancia o en la niñez, aunque puede ocurrir mucho más tarde. Algunos pacientes presentan una enfermedad pulmonar temprana y un pequeño subgrupo de pacientes puede desarrollar una insuficiencia hepática o respiratoria que se deteriora rápidamente en la primera infancia. La aparición neurológica varía entre la primera infancia y la edad adulta. Normalmente, la afectación neurológica es progresiva y consiste principalmente en distonía, ataxia cerebelosa, disartria, disfagia y demencia progresiva. La VSGP y la cataplexia (con o sin narcolepsia) son características. Los trastornos psiquiátricos son frecuentes en los pacientes de inicio tardío.


NM_006432.4(NPC2):c.358C>T ; NM_006432.3(NPC2):c.436C>T ; NM_006432.4(NPC2):c.115G>A ; NM_006432.4(NPC2):c.352G>T ; NM_006432.3(NPC2):c.58G>T ; NM_006432.3(NPC2):c.27delG ; NM_006432.4(NPC2):c.295T>C ; NM_006432.4(NPC2):c.358C>T ; NM_006432.3(NPC2):c.436C>T ; NM_006432.4(NPC2):c.115G>A ; NM_006432.4(NPC2):c.352G>T ; NM_006432.3(NPC2):c.58G>T ; NM_006432.3(NPC2):c.27delG ; NM_006432.4(NPC2):c.295T>C



Síndrome de Bardet-Biedl

El síndrome de Bardet-Biedl (BBS) es una ciliopatía con afectación multisistémica.


Este trastorno se caracteriza por una combinación de signos clínicos: obesidad, retinopatía pigmentaria, polidactilia post-axial, riñones poliquísticos, hipogenitalismo y problemas de aprendizaje, muchos de los cuales aparecen varios años después del inicio de la enfermedad. La expresión clínica es variable, pero la mayoría de los pacientes manifiestan la mayoría de los signos clínicos durante el curso de la enfermedad. La retinopatía pigmentaria es el único signo clínico constante después de la infancia. El BBS también puede estar asociado a otras manifestaciones, como la diabetes, la hipertensión, la cardiopatía congénita y la enfermedad de Hirschsprung (véase este término).

Síndrome de Joubert con defecto renal

El síndrome de Joubert con defecto renal es un subtipo poco frecuente del síndrome de Joubert y trastornos relacionados (JSRD, ver este término) caracterizado por los rasgos neurológicos del JS asociados a la enfermedad renal, en ausencia de retinopatía.


En la mayoría de los casos, la enfermedad renal se manifiesta como nefronoptisis juvenil, con inicio de los síntomas clínicos a finales de la primera década o principios de la segunda, aunque en casos raros puede haber NPH infantil, con inicio en los primeros años de vida.

Nefroftosis juvenil

Ciliopatía renal rara y genética que se caracteriza por una capacidad reducida de los riñones para concentrar solutos, nefritis tubulointersticial crónica, enfermedad renal quística y progresión a la enfermedad renal terminal (ESRD). Los tres subtipos clínicos se caracterizan por la edad de inicio de la ERS, que incluye la aparición infantil, juvenil y tardía.


La hiperoxaluria puede provocar cálculos renales, nefrocalcinosis y, en última instancia, insuficiencia renal y oxalosis sistémica. Los síntomas pueden aparecer a cualquier edad y pueden variar desde el retraso en el desarrollo infantil y la nefrocalcinosis cortical con insuficiencia renal hasta la hematuria, la nefrocalcinosis medular o la enfermedad de cálculos esporádica, incluso dentro de una misma familia. La PH1 es la forma más grave; en general, más del 70% de los pacientes con PH1 desarrollan una enfermedad renal terminal con el tiempo; esto puede ocurrir incluso en pacientes con enfermedad de cálculos esporádica. El almacenamiento de oxalato se produce en la insuficiencia renal grave y puede afectar a los huesos, los ojos, el corazón, las arterias y los nervios periféricos (oxalosis sistémica). La PH2 tiene un curso más benigno; no se ha descrito ninguna oxalosis infantil y la enfermedad renal terminal se produce a una edad relativamente tardía en aproximadamente el 20% de los pacientes. La PH3 es la más benigna, y hasta ahora sólo se han descrito algunos casos de insuficiencia renal y ninguna enfermedad renal terminal.

Síndrome de Senior-Loken

Se trata de una rara ciliopatía oculo-renal autosómica recesiva que se caracteriza por la asociación de nefronoptisis (NPHP), una enfermedad renal crónica, con distrofia de la retina.


La enfermedad se presenta típicamente en las dos primeras décadas de vida como una combinación de nefronoptisis (NPH) con degeneración de la retina. Dependiendo de los antecedentes genéticos, el trastorno visual o la enfermedad renal crónica determinan el cuadro clínico. La NPH suele presentar síntomas como poliuria, polidipsia, enuresis secundaria y anemia. La enfermedad renal crónica suele progresar lentamente hasta convertirse en una enfermedad renal terminal (ESKD). Las características oculares incluyen una pérdida visual grave congénita o de aparición temprana debida a una distrofia de la retina (amaurosis congénita de Leber) o un fenotipo más leve determinado por una restricción tubular de los campos visuales y ceguera nocturna de progresión lenta (degeneración tapeto-retiniana). La funduscopia revela diversos grados de alteraciones atróficas y pigmentarias de la retina. En raras ocasiones, pueden observarse otros signos clínicos adicionales como fibrosis hepática, obesidad y trastornos neurológicos.


c.1del ; NM_000272.3(NPHP1):c.1184dupC ; c.829C>T ; NM_000272.3(NPHP1):c.555dupA ; c.455C>G ; NM_000272.3(NPHP1):c.1884+1G>T ; NM_000272.3(NPHP1):c.80T>A ; c.1del ; NM_000272.3(NPHP1):c.1184dupC ; c.829C>T ; NM_000272.3(NPHP1):c.555dupA ; c.455C>G ; NM_000272.3(NPHP1):c.1884+1G>T ; NM_000272.3(NPHP1):c.80T>A



Síndrome nefrótico genético resistente a los esteroides

Un raro síndrome nefrótico hereditario caracterizado por proteinuria, hipoalbuminemia, edema e hiperlipidemia, con ausencia de respuesta a una prueba inicial de corticosteroides (es decir, síndrome nefrótico resistente a los esteroides; SRNS) y un curso generalmente complicado.


La aparición de la enfermedad puede producirse en cualquier momento entre el nacimiento y la edad adulta, pero se presenta predominantemente en poblaciones jóvenes. El síndrome nefrótico se define por una proteinuria grave (relación proteína/creatinina urinaria > 200 mg/mmol) con una albúmina sérica baja (<30 g/l) y posibles edemas. La biopsia muestra enfermedad con cambios mínimos (ECM), glomeruloesclerosis segmentaria focal (GFS) o, más raramente, esclerosis mesangial difusa (EMD), y borramiento del proceso podocitario del pie por microscopía electrónica. Es resistente a múltiples fármacos y suele progresar hasta la insuficiencia renal terminal; sin embargo, los pacientes tienen un riesgo muy bajo de recurrencia tras un trasplante de riñón.


NM_004646.3(NPHS1):c.3478C>T ; c.3109+1G>A ; NM_004646.3(NPHS1):c.1307_1308dupAC ; NM_004646.3(NPHS1):c.3325C>T ; NM_004646.3(NPHS1):c.2491C>T ; NM_004646.3(NPHS1):c.1481delC ; NM_004646.3(NPHS1):c.121_122delCT ; NM_004646.3(NPHS1):c.1715G>A ; NM_004646.3(NPHS1):c.2928G>T ; NM_004646.3(NPHS1):c.3478C>T ; c.3109+1G>A ; NM_004646.3(NPHS1):c.1307_1308dupAC ; NM_004646.3(NPHS1):c.3325C>T ; NM_004646.3(NPHS1):c.2491C>T ; NM_004646.3(NPHS1):c.1481delC ; NM_004646.3(NPHS1):c.121_122delCT ; NM_004646.3(NPHS1):c.1715G>A ; NM_004646.3(NPHS1):c.2928G>T



Trastorno del desarrollo sexual testicular 46,XX

Trastorno raro del desarrollo sexual (DSD) asociado a un cariotipo 46, XX y caracterizado por genitales externos masculinos, que van de normales a atípicos con deficiencia de testosterona asociada.


El fenotipo clínico es variable, con características que incluyen: genitales externos masculinos normales a atípicos, testículos no descendidos con ausencia de estructuras müllerianas e infertilidad. La presentación depende de la presencia del gen SRY (región determinante del sexo del cromosoma Y). Los casos SRY positivos (80-90%) suelen ser hombres normales que se presentan después de la pubertad con estatura baja, vello púbico y tamaño del pene normales, pero testículos pequeños, ginecomastia y esterilidad relacionada con la azoospermia. También se han descrito testículos no descendidos e hipospadias. Por lo general, no hay preocupaciones sobre el papel y la identidad de género. Los individuos con SRY negativo (10-20%) suelen presentar al nacer características como hipospadias penoscrotal y testículos no descendidos. Las complicaciones a largo plazo debidas al hipogonadismo masculino incluyen: baja libido, disfunción eréctil, disminución de los caracteres sexuales secundarios, osteopenia y depresión.

Disgenesia gonadal completa 46,XY

Trastorno raro del desarrollo sexual (DSD) asociado a anomalías en el desarrollo gonadal que dan lugar a la presencia de genitales externos e internos femeninos a pesar del cariotipo 46,XY.


Las pacientes se presentan durante la adolescencia o al principio de la edad adulta con genitales externos femeninos normales, pero carecen de desarrollo puberal, aunque la adrenarquia es normal. Las gónadas en forma de raya no están completamente desarrolladas y se asocian a un mayor riesgo de tumores abdominales (más comúnmente disgerminoma; véase este término), que pueden ser la característica de presentación en algunos casos. La estatura es normal o superior a la normal, y no hay rasgos del síndrome de Turner (véase este término).

Disgenesia gonadal parcial 46,XY

La disgenesia gonadal parcial 46,XY (PGD 46,XY) es un trastorno del desarrollo sexual (DSD) asociado a anomalías en el desarrollo gonadal que da lugar a una ambigüedad genital de grado variable que va desde un fenotipo casi femenino hasta un fenotipo casi masculino en un paciente portador de un cariotipo 46,XY masculino.


El PGD 46,XY se caracteriza por genitales externos ambiguos con o sin estructuras müllerianas. El grado de ambigüedad genital varía a lo largo de un espectro, que va desde un fenotipo casi femenino con clitoromegalia en un extremo hasta un fenotipo casi masculino con hipospadias aislado en el otro. Muchos pacientes presentan genitales ambiguos o micropene severo asociado a una regresión completa del tejido testicular en uno o ambos lados. El síndrome de regresión testicular embrionaria (ETRS; véase este término) se considera parte del espectro clínico del DGP. Dependiendo de la mutación, los pacientes pueden presentar insuficiencia suprarrenal o afectación renal (es decir, tumores de Wilms o síndrome nefrótico). Los gonadoblastomas o los tumores de células germinales invasivos se producen en alrededor del 20-30% de los pacientes.

Hipoplasia suprarrenal congénita ligada al X

Una rara enfermedad suprarrenal genética caracterizada por una insuficiencia suprarrenal primaria (IA) y/o hipogonadismo hipogonadotrópico (HH). Los pacientes varones suelen presentar IA con un inicio agudo en la infancia o un inicio insidioso en la niñez. Las características clínicas de la IA incluyen hiperpigmentación, vómitos, mala alimentación, retraso en el desarrollo, convulsiones, colapso vascular y, en ocasiones, muerte súbita. El HH se manifiesta más tarde como un retraso o detención de la pubertad. En raras ocasiones, los pacientes se vuelven sintomáticos en la edad adulta temprana con IA de inicio tardío, HH parcial y/o infertilidad. Histológicamente, las glándulas suprarrenales carecen de la zona cortical adulta permanente. Las células restantes son más grandes que las células suprarrenales fetales (''citomegálicas'') y contienen inclusiones nucleares características.


La hipoplasia suprarrenal congénita (AHC) es un trastorno raro que puede heredarse con un patrón ligado al cromosoma X o autosómico recesivo. En la AHC ligada al cromosoma X, se produce una insuficiencia suprarrenal primaria porque las glándulas suprarrenales carecen de la zona cortical adulta permanente. Las células restantes se denominan "citomegálicas" porque son más grandes que las células suprarrenales fetales típicas. Los pacientes con AHC suelen presentarse en la primera infancia con insuficiencia suprarrenal primaria. El hipogonadismo hipogonadotrópico (HHG) es una característica distintiva del trastorno, y se reconoce durante la adolescencia debido a la ausencia o interrupción del desarrollo puberal normal. También se ha observado una espermatogénesis anormal en estos pacientes. Se han descrito formas más leves de la enfermedad, con insuficiencia suprarrenal que a veces se presenta en la infancia o incluso en la edad adulta temprana.


NM_000475.4(NR0B1):c.788T>A ; NM_000475.4(NR0B1):c.704G>A ; NM_000475.4(NR0B1):c.591C>A ; NM_000475.4(NR0B1):c.847C>T ; NM_000475.4(NR0B1):c.513G>A ; NM_000475.4(NR0B1):c.873G>C ; c.388_389del ; NM_000475.4(NR0B1):c.813C>G ; NM_000475.4(NR0B1):c.1319A>T ; NM_000475.4(NR0B1):c.1316T>G ; NM_000475.4(NR0B1):c.800G>C ; NM_000475.4(NR0B1):c.1107G>A ; NM_000475.4(NR0B1):c.890T>C ; NM_000475.4(NR0B1):c.273C>A ; NM_000475.4(NR0B1):c.788T>A ; NM_000475.4(NR0B1):c.704G>A ; NM_000475.4(NR0B1):c.591C>A ; NM_000475.4(NR0B1):c.847C>T ; NM_000475.4(NR0B1):c.513G>A ; NM_000475.4(NR0B1):c.873G>C ; c.388_389del ; NM_000475.4(NR0B1):c.813C>G ; NM_000475.4(NR0B1):c.1319A>T ; NM_000475.4(NR0B1):c.1316T>G ; NM_000475.4(NR0B1):c.800G>C ; NM_000475.4(NR0B1):c.1107G>A ; NM_000475.4(NR0B1):c.890T>C ; NM_000475.4(NR0B1):c.273C>A



Síndrome de Goldmann-Favre

El síndrome de Goldmann-Favre (GFS) es una distrofia vitreorretiniana caracterizada por la aparición temprana de ceguera nocturna, agudeza visual bilateral reducida y hallazgos típicos del fondo de ojo (cambios degenerativos pigmentarios progresivos, edema macular, retinosquisis).


La aparición suele ser en la infancia. La GFS se manifiesta con una pérdida progresiva de la agudeza visual y ceguera nocturna. La visión periférica puede estar disminuida. La catarata es una complicación frecuente. Ocasionalmente se ha informado de atrofia óptica. Los cambios vítreos son degenerativos y pueden incluir hilos microfibrilares, licuefacción y desprendimiento vítreo posterior. Las características del fondo de ojo incluyen cambios pigmentarios anulares (depósitos de pigmento agrupados), retinosquisis central o periférica, edema macular cistoide. Las características del GFS suelen ser bilaterales y simétricas. El electrorretinograma (ERG) es anormal: tanto el ERG de bastones como el de conos están notablemente disminuidos y pueden ser indetectables. Los pacientes pueden tener una mayor sensibilidad a la luz azul debido a una mayor sensibilidad del cono S.

Retinitis pigmentaria

La retinosis pigmentaria (RP) es una distrofia hereditaria de la retina que conduce a la pérdida progresiva de los fotorreceptores y del epitelio pigmentario de la retina y que provoca la ceguera generalmente después de varias décadas.


La retinosis pigmentaria es lentamente progresiva pero implacable. Sin embargo, existe una amplia variabilidad en la edad de inicio, la tasa de progresión y las manifestaciones clínicas secundarias. Los individuos afectados suelen desarrollar primero ceguera nocturna (nictalopía) debido a la pérdida de la función de los bastones, a menudo en la adolescencia o antes. A continuación, desarrollan un deterioro del campo visual periférico y, con el tiempo, la pérdida de la visión central, normalmente en etapas tardías, a menudo en torno a la mediana edad. La pérdida de agudeza visual central puede producirse a cualquier edad como resultado de un edema macular cistoide o de la pérdida de fotorreceptores. Las cataratas subcapsulares posteriores son frecuentes y su gravedad depende de la edad. También puede encontrarse una reducción de la visión de los colores. El examen del fondo de ojo revela depósitos de pigmento de espícula ósea, vasos retinianos atenuados, atrofia de la retina y palidez del nervio óptico. La gravedad está parcialmente correlacionada con el patrón de herencia: los casos ligados al cromosoma X son los más graves, los casos autosómicos recesivos y de ocurrencia única tienen una gravedad intermedia, y los autosómicos dominantes son los más favorables.


NM_014249.3(NR2E3):c.226C>T ; NM_016346.4:c.119-2A>C ; c.298_299del ; NM_016346.3(NR2E3):c.1034_1038del ; NM_014249.4:c.932G>A ; NM_014249.3(NR2E3):c.226C>T ; NM_016346.4:c.119-2A>C ; c.298_299del ; NM_016346.3(NR2E3):c.1034_1038del ; NM_014249.4:c.932G>A



Carcinoma diferenciado de tiroides

Se trata de un carcinoma epitelial de tiroides poco frecuente, de crecimiento lento, que suele presentarse como una masa tiroidea asintomática y que se clasifica como cáncer papilar de tiroides (CPT), cáncer folicular de tiroides (CFT) o cáncer de tiroides de células de Hurthle (CTH).


El PTC, el FTC y el HCTC tienen presentaciones similares y constituyen alrededor del 75, 20 y 5 por ciento de los casos, respectivamente. Alrededor del 10% de los CTP se clasifican como variante de células altas, la más agresiva de los CTP. El HCTC suele considerarse ligeramente más agresivo que el PTC y el FTC. La edad de diagnóstico suele ser superior a los 30 años. La presentación suele ser un nódulo tiroideo asintomático. Las presentaciones raras pero preocupantes incluyen la ronquera debido a la parálisis de las cuerdas vocales y la obstrucción de las vías respiratorias o del esófago, y pueden sugerir una variante agresiva del DTC o del carcinoma anaplásico de tiroides. El CTD crece lentamente y las metástasis a distancia son raras en el momento de la presentación. El lugar de metástasis más frecuente son los ganglios linfáticos cervicales. Las metástasis a distancia a los pulmones o a los huesos son raras (alrededor del 5%). Los casos pediátricos son raros. Es más frecuente que se presenten con afectación de los ganglios linfáticos. A pesar de esta presentación aparentemente más agresiva, el pronóstico es excelente. Desde el punto de vista patológico, los CTP suelen estar compuestos por una mezcla de papilas y folículos, con frecuencia con núcleos relativamente grandes que contienen pliegues y un centro claro. Alrededor del 50% contienen depósitos de calcio. Se han descrito diferentes subtipos histológicos de PTC. Los FTC se caracterizan por los microfolículos y la presencia de invasión capsular y vascular. Los HCTC, patológicamente similares a los FTC, se distinguen por un citoplasma rico en mitocondrias y eosinófilo. La neoplasia folicular tiroidea no invasiva con características nucleares de tipo papilar (NIFTP) es una variante descrita recientemente; actualmente no está claro si se trata de una lesión premaligna o de una variante del CTD.

Carcinoma medular de tiroides familiar

La neoplasia endocrina múltiple de tipo IIA es un síndrome autosómico dominante de múltiples neoplasias endocrinas, incluyendo el carcinoma medular de tiroides (CMT), el feocromocitoma y los adenomas paratiroideos. MEN2B, caracterizado por MTC con o sin feocromocitoma y con anomalías clínicas características como ganglioneuromas de labios, lengua y colon, pero sin hiperparatiroidismo, también está causado por una mutación en el gen RET.



Neuropatía sensorial y autonómica hereditaria tipo 4