ESSENTIAL
GENE

AR

DISEASES
Síndrome de insensibilidad completa a los andrógenos
SUMMARY

El síndrome de insensibilidad completa a los andrógenos (CAIS) es una forma del síndrome de insensibilidad a los andrógenos (AIS; véase este término), un trastorno del desarrollo sexual (DSD), caracterizado por la presencia de genitales externos femeninos en un individuo 46,XY con un desarrollo testicular normal pero con testículos no descendidos y sin respuesta a los niveles de andrógenos apropiados para su edad.

CLINICAL DESCRIPTION

La presentación típica es la amenorrea primaria en una mujer adolescente. El CAIS también puede presentarse en la infancia o en la niñez con una hernia inguinal o una inflamación labial que contiene un testículo. El desarrollo de las mamas en la pubertad es normal, pero el vello púbico y axilar está ausente o es escaso. Los genitales externos son normales en la mujer, pero los internos están ausentes. Los pacientes adultos son altos. Otras presentaciones pueden ser fortuitas, debido a un desajuste en el sexado prenatal (XY) y el fenotipo femenino al nacer, la historia de una reparación de hernia inguinal en una hermana mayor, o el desarrollo de un tumor pélvico en la vida adulta posterior.

Enfermedad de Kennedy
SUMMARY

La enfermedad de Kennedy, también conocida como atrofia muscular bulboespinal (BSMA), es una rara enfermedad de la neurona motora recesiva ligada al cromosoma X que se caracteriza por el desgaste muscular proximal y bulbar.

CLINICAL DESCRIPTION

El inicio de la enfermedad se produce entre los 30-60 años de edad. Las manifestaciones clínicas iniciales incluyen temblores, calambres musculares, espasmos musculares, fatiga y dificultad para hablar. Con la progresión de la enfermedad, los pacientes desarrollan además debilidad y desgaste de las extremidades y de los músculos bulbares, que se manifiestan como disartria, disfonía, mandíbula colgante, desgaste de la lengua, dificultad para masticar y deterioro de la movilidad. El deterioro intelectual es mínimo o nulo. En las fases terminales de la enfermedad, algunos pacientes pueden ser incapaces de tragar o respirar. Las manifestaciones no neurológicas incluyen la ginecomastia, el hipogonadismo (que conduce a la infertilidad y la impotencia) y, en casos raros, la contractura de Dupuytren o la hernia inguinal.

Síndrome de insensibilidad parcial a los andrógenos
SUMMARY

Un trastorno del desarrollo sexual (DSD) distinto del AIS completo (CAIS) caracterizado por la presencia de un desarrollo genital anormal en un individuo 46,XY con un desarrollo testicular normal y una respuesta parcial a los niveles de andrógenos apropiados para la edad.

CLINICAL DESCRIPTION

Los pacientes tienen un aspecto genital muy variable. La forma prototípica de presentación es una hipospadias severa, micropene y escroto bífido en el que los testículos pueden o no estar descendidos. En la forma más grave de PAIS, los pacientes tienen genitales externos femeninos con clitoromegalia, fusión labial parcial e hinchazón labial que comprende los testículos. En el extremo más leve del espectro, denominado MAIS (AIS leve o mínimo), se trata de un varón con ginecomastia en la pubertad o un adulto que presenta infertilidad por factor masculino.

Hipospadias posterior
SUMMARY

Malformación congénita del tracto urogenital, rara y no sindrómica, que afecta a los varones y se caracteriza por el desplazamiento penoscópico, escrotal o perineal del meato uretral, y se asocia habitualmente a la curvatura del pene. El escroto puede parecer bífido en los casos graves, y el niño también puede tener un micropene.

CLINICAL DESCRIPTION

Las consecuencias de la hipospadias, además de su aspecto, incluyen la pulverización del chorro urinario, la incapacidad de orinar en posición de pie y, más adelante, la curvatura, que si no se corrige, provoca dificultades durante el coito. Son más frecuentes los problemas de fertilidad y la disminución de la satisfacción con el aspecto genital. La hipospadias grave y los testículos no descendidos concomitantes se consideran un trastorno del desarrollo sexual (DSD) y deben remitirse a equipos multidisciplinarios especiales para una evaluación molecular y hormonal.

VARIANTS

NM_000044.4(AR):c.2567G>A ; NM_000044.4(AR):c.2395C>G ; NM_000044.4(AR):c.1771A>T ; NM_000044.4(AR):c.2391G>A ; c.340C>T ; NM_000044.4(AR):c.2650A>T ; NM_000044.4(AR):c.2323C>T

GENE

ATP7A

DISEASES
Enfermedad de Menkes
SUMMARY

Trastorno congénito raro del metabolismo del cobre con manifestaciones multisistémicas graves que se caracterizan principalmente por una neurodegeneración progresiva y marcadas anomalías del tejido conectivo. Un rasgo patognomónico es el típico pelo escaso y anormal de color acero.

CLINICAL DESCRIPTION

La enfermedad de Menkes (MD) se manifiesta en el periodo neonatal. La mayoría de los pacientes nacen a término con medidas de nacimiento adecuadas. Ocasionalmente se observan cefalohematomas y fracturas espontáneas al nacer. En el periodo neonatal temprano, los pacientes pueden presentar ictericia prolongada, hipotermia, hipoglucemia y dificultades de alimentación. También se han notificado pectus excavatum y hernias umbilicales e inguinales. La observación inicial a la edad de 1 a 2 meses suele ser un cabello inusualmente escaso y sin brillo en el cuero cabelludo. Es característico que el pelo aparezca hipopigmentado/despigmentado, se parezca a la lana de acero y sea friable, especialmente en las zonas del cuero cabelludo sometidas a fricción. Otros síntomas son retraso en el desarrollo, mala alimentación, vómitos y diarrea. Puede observarse la aparición de piel pálida, salientes frontales u occipitales, micrognatia y mejillas regordetas. Los pacientes desarrollan una disfunción motora gradual y convulsiones. La hipotonía muscular en los primeros años de vida es sustituida más tarde por espasticidad y debilidad de las extremidades. El curso clínico suele ser grave. Existen formas variables, siendo el síndrome del cuerno occipital (OHS) la forma más leve reconocida, que además se presenta con exostosis óseas prominentes y divertículos vesicales.

Síndrome del cuerno occipital
SUMMARY

Se trata de un raro trastorno congénito del metabolismo del cobre que se caracteriza principalmente por exostosis óseas (incluidos los patognomónicos cuernos occipitales), y manifestaciones del tejido conectivo con cutis laxa y divertículos vesicales. La afectación del sistema nervioso central es variable.

CLINICAL DESCRIPTION

La edad de aparición oscila entre la infancia y la niñez. Las observaciones al nacer pueden incluir cefalohematoma (12% de los casos), piel suelta y arrugada, y hernias umbilicales o inguinales. Alrededor de un tercio de todos los pacientes presentan principalmente una afectación del sistema nervioso central (hipotonía, retraso en el desarrollo y/o convulsiones). La presentación clínica inicial puede ocurrir más tarde con divertículos vesicales o manifestaciones esqueléticas. Los divertículos vesicales afectan a la mayoría de los pacientes (>80%) y pueden manifestarse mediante infecciones urinarias recurrentes o polaquiuria. La manifestación esquelética más típica (presente en el 96% de los pacientes) es una exostosis en el occipucio, en la inserción del músculo trapecio (cuerno occipital), pero también puede haber exostosis en la tibia y el radio. Otras características esqueléticas más variables son las clavículas en forma de martillo, la escoliosis, la deformidad del pectus, la coxa valga, la genua valga, así como las dislocaciones de la cabeza del radio. Otras manifestaciones esqueléticas menos frecuentes son el arqueo de los huesos largos, el ensanchamiento de la diáfisis media, el espolón metafisario, el redondeo de las alas ilíacas y, raramente, la osteopenia. Los rasgos faciales se vuelven distintivos con la edad e incluyen una cara larga (46%), orejas grandes (38%), mejillas caídas (45%) y pelo grueso (74%). La tricoscopia puede mostrar pili torti. La piel suele ser hiperextensible y blanda, con finas arrugas en las manos y los pies. La redundancia cutánea es notable en el vientre. La tortuosidad vascular es frecuente en las arterias intracraneales (65%), pero también puede afectar a la circulación cervical, esplénica y esplácnica e impone un riesgo de formación de aneurismas. En raras ocasiones puede producirse una dilatación y disección de la raíz aórtica. La mayoría de los pacientes (>90%) presentan disautonomía con hipotensión ortostática postural, inestabilidad térmica y diarrea crónica. Aproximadamente la mitad de los pacientes muestran un retraso en el desarrollo motor debido a la hipotonía muscular y a la hipermovilidad articular, y pueden manifestar una torpeza inusual. Se ha registrado una neuropatía motora distal en al menos un paciente. Alrededor de la mitad de los pacientes presentan una discapacidad intelectual (DI) que suele ser leve, pero puede producirse un deterioro de moderado a grave.

Atrofia muscular distal ligada al X tipo 3
SUMMARY

La atrofia muscular espinal distal ligada al cromosoma X de tipo 3 es una neuropatía motora distal hereditaria poco frecuente que se caracteriza por una atrofia y una debilidad lentamente progresivas de los músculos distales de manos y pies con reflejos tendinosos profundos normales o ausencia de reflejos en los tobillos y una pérdida sensorial mínima o nula, a veces una debilidad proximal leve en las piernas y los pies y deformidades en las manos en los varones.

CLINICAL DESCRIPTION

El trastorno se transmitía con un patrón de herencia recesivo ligado al cromosoma X. En 6 de los 9 pacientes examinados, la edad de inicio oscilaba entre 1 y 10 años, y el primer síntoma detectado fue la deformidad del pie (pie cavo o pie varo); en otros 2 individuos se notificó inestabilidad de la marcha. Posteriormente, se observó debilidad y atrofia de los miembros inferiores distales y, por último, se afectaron las manos. A pesar de la gran variabilidad clínica, la progresión de la enfermedad fue muy lenta y la marcha independiente se mantuvo incluso en edades avanzadas. No había deterioro cognitivo, piramidal ni sensorial. La EMG mostró una denervación crónica, la biopsia muscular mostró un patrón neurogénico y la biopsia del nervio sural fue normal.

VARIANTS

NM_000052.6(ATP7A):c.3915_3921delCTCCCCA ; c.3257_3258del ; NM_000052.6(ATP7A):c.1974_1977dupGTTT ; NM_000052.6(ATP7A):c.1639C>T ; c.3294+2T>G ; NM_000052.6(ATP7A):c.3911A>G ; NM_000052.6(ATP7A):c.2938C>T

GENE

BTK

DISEASES
Estatura baja por deficiencia aislada de la hormona del crecimiento con hipogammaglobulinemia ligada al X
SUMMARY

La IGHD3 se caracteriza por una agammaglobulinemia y un número notablemente reducido de células B, baja estatura, retraso en la edad ósea y buena respuesta al tratamiento con la hormona del crecimiento.

CLINICAL DESCRIPTION

La agammaglobulinemia ligada al cromosoma X es una inmunodeficiencia caracterizada por la incapacidad de producir linfocitos B maduros y asociada a un fallo en el reordenamiento de la cadena pesada de Ig. El defecto de este trastorno reside en la BTK, también conocida como BPK o ATK, un regulador clave en el desarrollo de las células B. La forma ligada al cromosoma X representa aproximadamente entre el 85 y el 90% de los casos de este trastorno.

VARIANTS

NM_000061.2(BTK):c.763C>T ; NM_000061.2(BTK):c.1766A>G ; NM_000061.2(BTK):c.919A>G ; NM_000061.2(BTK):c.1906G>T ; NM_000061.2(BTK):c.718G>T ; NM_000061.2(BTK):c.755G>A ; NM_000061.2(BTK):c.862C>T ; NM_000061.2(BTK):c.1559G>A ; NM_000061.2(BTK):c.1516T>C ; NM_000061.2(BTK):c.1082A>G ; NM_000061.2(BTK):c.1838G>A ; NM_000061.2(BTK):c.1773C>A ; NM_000061.2(BTK):c.1125T>G ; NM_000061.2(BTK):c.1288A>G ; NM_000061.2(BTK):c.338T>A ; NM_000061.2(BTK):c.1889T>A ; NM_000061.2(BTK):c.1558C>T ; NM_000061.2(BTK):c.1001A>C ; NM_000061.2(BTK):c.1820C>A ; NM_000061.2(BTK):c.1506C>A ; NM_000061.2(BTK):c.1275C>A ; NM_000061.2(BTK):c.1223T>C

GENE

CFTR

DISEASES
Fibrosis quística
SUMMARY

Trastorno pulmonar genético poco frecuente, caracterizado por sudoración, secreciones mucosas espesas que provocan enfermedades multisistémicas, infecciones crónicas de los pulmones, diarrea voluminosa y baja estatura.

CLINICAL DESCRIPTION

La FQ es crónica y suele ser progresiva. Los síntomas suelen comenzar al nacer y afectan a los pulmones y al tracto gastrointestinal. Una presentación común puede incluir secreciones espesas e infecciones crónicas en el pulmón, diarrea voluminosa y baja estatura. Las secreciones anormales en las vías respiratorias, la inflamación y las infecciones conducen a la bronquiectasia y a la muerte temprana. La diabetes relacionada con la fibrosis quística (CFRD) es muy frecuente, llegando a casi el 50% de los pacientes que sobreviven hasta los 50 años. La esterilidad masculina es frecuente. Los individuos con fenotipos leves pueden tener síntomas respiratorios leves o ausentes en la infancia, pero algunos pueden tener infertilidad o pueden desarrollar bronquiectasias o pancreatitis más adelante. Estos individuos suelen ser diagnosticados mediante cribado neonatal, pero pueden ser diagnosticados más tarde en la vida.

Queratodermia palmoplantar acuagénica
SUMMARY

Enfermedad cutánea poco frecuente que se caracteriza por arrugas transitorias en la piel, edema, formación de pápulas blanquecinas, prurito, sensación de quemazón o dolor, en las palmas de las manos y/o las plantas de los pies en respuesta al contacto con el agua. La duración de la exposición y la temperatura del agua afectan a la velocidad de desarrollo y a la intensidad de las lesiones. Esta afección es más común en las mujeres que en los hombres y se da con frecuencia en pacientes con fibrosis quística.

CLINICAL DESCRIPTION

Ausencia bilateral congénita de los conductos deferentes
SUMMARY

La ausencia bilateral congénita de los conductos deferentes (CBAVD) es una enfermedad que conduce a la infertilidad masculina.

CLINICAL DESCRIPTION

Los pacientes infértiles con CBAVD producen pequeños volúmenes de esperma ácido (<1 ml con un pH<7,0).

Pancreatitis crónica hereditaria
SUMMARY

Una rara enfermedad gastroenterológica caracterizada por pancreatitis aguda recurrente y/o pancreatitis crónica en al menos 2 familiares de primer grado, o 3 o más familiares de segundo grado en 2 o más generaciones, para la que no se identifican factores predisponentes. Esta rara forma hereditaria de pancreatitis provoca daños irreversibles en los componentes exocrino y endocrino del páncreas.

CLINICAL DESCRIPTION

El inicio de la PCH suele ser temprano en la vida, durante la infancia y la adolescencia. La presentación clínica es muy variable e incluye dolor abdominal crónico o intermitente, de leve a grave, asociado a una insuficiencia pancreática exocrina, que conduce a una mala digestión y/o a una insuficiencia endocrina pancreática (intolerancia a la glucosa que progresa a diabetes mellitus de tipo 3c) en algunos casos. La enfermedad es lentamente progresiva. El riesgo de desarrollar un carcinoma pancreático después de los 50 años es elevado en los pacientes con HCP. Sin embargo, el aumento exacto del riesgo es difícil de evaluar.

Bronquiectasia idiopática
SUMMARY

La bronquiectasia idiopática (IB) es una enfermedad pulmonar progresiva caracterizada por la dilatación crónica de los bronquios y la destrucción de las paredes bronquiales en ausencia de cualquier causa subyacente (como una enfermedad postinfecciosa, aspiración, inmunodeficiencia, anomalías congénitas y anomalías ciliares).

CLINICAL DESCRIPTION

Infertilidad masculina con azoospermia u oligozoospermia debida a una mutación genética única
SUMMARY

La infertilidad masculina con azoospermia u oligospermia debida a una mutación de un solo gen es una infertilidad masculina genética rara debida a un trastorno espermático que se caracteriza por la ausencia de una cantidad medible de espermatozoides en el eyaculado (azoospermia), o un número de espermatozoides en el eyaculado inferior a 15 millones/mL (oligozoospermia), resultante de una mutación en un solo gen que se sabe que causa azoo o oligoespermia. La morfología del esperma puede ser normal.

CLINICAL DESCRIPTION

La aplasia bilateral congénita de los conductos deferentes (CBAVD), que conduce a la infertilidad masculina, puede ocurrir de forma aislada o como una manifestación de la fibrosis quística. Se ha comprobado que los varones con fibrosis quística son infértiles debido al fracaso del desarrollo normal de los conductos deferentes. Otros concluyeron que los cambios en los conductos de transporte del sistema genital masculino son responsables de la infertilidad y no son una anomalía del desarrollo, sino un cambio degenerativo debido a una obstrucción similar a la que se produce en el páncreas y las glándulas salivales en la fibrosis quística. 

VARIANTS

NM_000492.3(CFTR):c.571T>G (p.Phe191Val) ; NM_000492.3(CFTR):c.592G>A (p.Ala198Thr) ; NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) ; NM_000492.3(CFTR):c.1399C>T (p.Leu467Phe) ; NM_000492.3(CFTR):c.1684G>C (p.Val562Leu) ; NM_000492.3(CFTR):c.2249C>T (p.Pro750Leu) ; NM_000492.3(CFTR):c.2855T>C (p.Met952Thr) ; NM_000492.3(CFTR):c.2939T>A (p.Ile980Lys) ; NM_000492.3(CFTR):c.4056G>T (p.Gln1352His) ; NM_000492.3(CFTR):c.328G>T (p.Asp110Tyr) ; NM_000492.3(CFTR):c.445G>T (p.Gly149Ter) ; NM_000492.3(CFTR):c.1438G>T (p.Gly480Cys) ; NM_000492.3(CFTR):c.3067_3072delATAGTG (p.Ile1023_Val1024del) ; NM_000492.3(CFTR):c.3536_3539delCCAA (p.Thr1179Asnfs) ; NM_000492.3(CFTR):c.445G>A (p.Gly149Arg) ; NM_000492.4:c.115C>T ; NM_000492.4:c.178G>T ; NM_000492.4:c.200C>T ; NM_000492.4:c.223C>T ; NM_000492.4:c.254G>A ; NM_000492.4:c.262_263delTT ; NM_000492.4:c.273+1G>A ; NM_000492.4:c.274-1G>A ; NM_000492.4:c.274G>A ; NM_000492.4:c.274G>T ; NM_000492.4:c.292C>T ; NM_000492.4:c.328G>C ; NM_000492.4:c.349C>T ; NM_000492.4:c.366T>A ; NM_000492.4:c.442delA ; NM_000492.4:c.489+1G>T ; NM_000492.4:c.531delT ; NM_000048.4:c.532G>A ; NM_000492.4:c.577G>T ; NM_000492.4:c.579+1G>T ; NM_000492.4:c.579+3A>G ; NM_000492.4:c.579+5G>A ; NM_000492.4:c.595C>T ; NM_000492.4:c.613C>T ; NM_000492.4:c.617T>G ; NM_000492.4:c.658C>T ; c.708del ; NM_000492.4:c.720_741delAGGGAGAATGATGATGAAGTAC ; NM_000492.4:c.803delA ; NC_000007.14:g.117540159_117540161TCT[2] ; NM_000492.4:c.988G>T ; NM_000492.4:c.1000C>T ; NM_000492.4:c.1007T>A ; NM_000492.4:c.1013C>T ; NM_000492.4:c.1021_1022dupTC ; NM_000492.4:c.1021T>C ; NM_000492.4:c.1040G>A ; NM_000492.4:c.1040G>C ; NM_000492.4:c.1055G>A ; NM_000492.4:c.1081delT ; NM_000492.3(CFTR):c.1297_1303delTTCTCAC (p.Ser434Leufs) ; NM_000492.4:c.1327_1330dupGATA ; NM_000492.4:c.1340delA ; NM_000492.4:c.1364C>A ; NM_000492.4:c.1393-1G>A ; NM_000492.4:c.1397C>A ; NM_000492.4:c.1397C>G ; NM_000492.4:c.1400T>C ; NM_000492.4:c.1466C>A ; NM_000492.4:c.1475C>T ; NM_000492.4:c.1477C>T ; NM_000492.4:c.1519_1521delATC ; NM_000492.4:c.1521_1523delCTT ; NM_000492.4:c.1545_1546delTA ; NM_000492.4:c.1585-1G>A ; NM_000492.4:c.1624G>T ; NM_000492.4:c.1692delA ; NM_000492.3(CFTR):c.1706A>G (p.Tyr569Cys) ; NM_000492.4:c.1721C>A ; NM_000492.4:c.1766+1G>A ; NM_000492.3:c.1970delG ; NM_000492.4:c.2012delT ; NM_000492.4:c.2052dupA ; NM_000492.4:c.2052delA ; NM_000492.4:c.2125C>T ; NM_000492.4:c.2128A>T ; NM_000492.4:c.2175dupA ; NM_000492.4:c.2195T>G ; NM_000492.4:c.2215delG ; NM_000492.4:c.2537G>A ; NM_000492.3(CFTR):c.2538G>A (p.Trp846Ter) ; NM_000492.4:c.2551C>T ; NM_000492.4:c.2583delT ; NM_000492.4:c.2657+5G>A ; NM_000492.4:c.2668C>T ; NM_000492.4:c.2737_2738insG ; NM_000492.4:c.2739T>A ; NM_000492.4:c.2780T>C ; NM_000492.4:c.2834C>T ; NM_000492.3:c.2869_2870insG ; NM_000492.4:c.2875delG ; NM_000492.4:c.2908G>C ; NM_000492.4:c.2989-1G>A ; NM_000492.4:c.3140-26A>G ; NM_000492.4:c.3194T>C ; NM_000492.4:c.3196C>T ; NM_000492.4:c.3197G>A ; NM_000492.4:c.3230T>C ; NM_000492.4:c.3266G>A ; NM_000492.4:c.3276C>A ; NM_000492.4:c.3276C>G ; NM_000492.4:c.3302T>A ; NM_000492.4:c.3310G>T ; NM_000492.4:c.3528delC ; NM_000492.4:c.3587C>G ; NM_000492.4:c.3611G>A ; NM_000492.4:c.3612G>A ; NM_000492.4:c.3659delC ; NM_000492.4:c.3731G>A ; NM_000492.4:c.3744delA ; NM_000492.4:c.3752G>A ; NM_000492.4:c.3761T>G ; NM_000492.4:c.3764C>A ; NM_000492.4:c.3773dupT ; NM_000492.4:c.3846G>A ; NM_000492.4:c.3909C>G ; NM_000492.4:c.3937C>T ; NM_000492.4:c.4251delA ; NM_000492.3(CFTR):c.4426C>T (p.Gln1476Ter) ; NM_000492.4:c.2175dupA ; NM_000492.4:c.2175dupA ; NM_000492.4:c.4077_4080delTGTTinsAA

GENE

DKC1

DISEASES
Disqueratosis congénita
SUMMARY

Un raro síndrome de displasia ectodérmica que suele presentarse con la tríada clásica de displasia ungueal, cambios pigmentarios en la piel y leucoplasia oral, asociado a un alto riesgo de insuficiencia de la médula ósea (FMO) y cáncer.

CLINICAL DESCRIPTION

La DC tiene un amplio espectro fenotípico y una amplia edad de aparición. Clásicamente se manifiesta durante la infancia con la tríada de uñas displásicas, pigmentación reticular de encaje y atrofia de la piel a nivel del cuello y la parte superior del tórax, y leucoplasia oral. Los pacientes tienen un alto riesgo de padecer una FMO progresiva y pueden desarrollar un síndrome mielodisplásico o una leucemia mielógena aguda a cualquier edad (el riesgo aumenta con la edad). También existe un mayor riesgo de padecer tumores sólidos, normalmente carcinoma de células escamosas de cabeza y cuello o cáncer anogenital. Se han notificado otros hallazgos clínicos que pueden incluir: retraso en el desarrollo, baja estatura, microcefalia, blefaritis, epífora, enfermedad periodontal, taurodontismo, disminución de la relación dientes/raíz, estenosis esofágica, estenosis uretral, osteoporosis, necrosis avascular de fémur y/o húmero, encanecimiento prematuro del cabello/alopecia o pestañas anormales. Los pacientes con DC también pueden desarrollar fibrosis pulmonar, malformaciones arteriovenosas pulmonares, telangiectasias gastrointestinales y enfermedad hepática. Es importante tener en cuenta que las características clínicas de la CD progresan con el tiempo y que todas las características, incluida la tríada mucocutánea, pueden no estar presentes.

Síndrome de Hoyeraal-Hreidarsson
SUMMARY

Una discapacidad intelectual sindrómica ligada al cromosoma X, considerada una variante grave de la disqueratosis congénita, caracterizada por retraso del crecimiento intrauterino, microcefalia, hipoplasia cerebelosa, inmunodeficiencia combinada progresiva y anemia aplásica.

CLINICAL DESCRIPTION

La enfermedad suele presentarse en la primera infancia y afecta principalmente a los varones. El retraso del crecimiento suele ser de inicio prenatal. Otras manifestaciones clínicas incluyen microcefalia, lesiones mucocutáneas (hiperpigmentación, distrofia ungueal, leucoplasia premaligna que afecta a la mucosa oral y gastrointestinal), insuficiencia de la médula ósea de aparición temprana, inmunodeficiencia y pancitopenia. También se ha descrito una predisposición al cáncer.

VARIANTS

NM_001363.4(DKC1):c.91C>A ; NM_001363.4(DKC1):c.204C>A ; NM_001363.4(DKC1):c.91C>G ; NM_001363.4(DKC1):c.196A>G ; NM_001363.4(DKC1):c.200C>T ; NM_001363.4(DKC1):c.194G>C ; NM_001363.4(DKC1):c.214_215delCTinsTA

GENE

DMD

DISEASES
Distrofia muscular de Becker
SUMMARY

Distrofia muscular rara y genética que se caracteriza por una debilidad y atrofia muscular progresiva debida a la degeneración del músculo esquelético, liso y cardíaco.

CLINICAL DESCRIPTION

El inicio suele ser en la infancia, normalmente después de los 7 años de edad, pero puede ser posterior. Las características de presentación en los niños incluyen la marcha con los dedos del pie y/o calambres relacionados con el ejercicio, con o sin mioglobinuria. Algunos pacientes pueden presentar una rabdomiólisis aguda inducida por anestesia. En los pacientes de más edad, la cardiomiopatía puede ser la característica de presentación. A medida que la enfermedad progresa, la debilidad muscular provoca dificultades funcionales (dificultad para subir escaleras o levantarse de una silla). En raras ocasiones, la cardiomiopatía puede ser la característica de presentación. El examen clínico revela una pseudohipertrofia muscular de los músculos de la pantorrilla y puede haber atrofia de músculos más proximales, como el cuádriceps. La debilidad muscular es simétrica y proximal, y las extremidades inferiores están más afectadas que las superiores. Puede haber contracturas articulares, especialmente del tendón de Aquiles. Los músculos faciales, oftálmicos y bulbares no están afectados. La enfermedad es lentamente progresiva y alrededor del 40% de los pacientes afectados acabarán dependiendo de una silla de ruedas. En los pacientes dependientes de la silla de ruedas, se produce una insuficiencia respiratoria restrictiva debido a la debilidad de los músculos intercostales y del diafragma. La afectación cardíaca da lugar a una miocardiopatía dilatada, que puede ser desproporcionada con respecto a la afectación del músculo esquelético.

Distrofia muscular de Duchenne
SUMMARY

Distrofia muscular rara y genética que se caracteriza por una debilidad y atrofia muscular rápidamente progresiva debida a la degeneración del músculo esquelético, liso y cardíaco.

CLINICAL DESCRIPTION

El inicio se produce en la primera infancia, y los niños afectados pueden mostrar un retraso en la marcha (después de los 18 meses de edad) acompañado de un retraso en el habla y/o en el desarrollo global. El autismo y los problemas de comportamiento, como el TDAH (trastorno por déficit de atención e hiperactividad), la ansiedad y el trastorno obsesivo compulsivo, son relativamente frecuentes. Los niños con DMD no tratados rara vez alcanzan la capacidad de correr o saltar. La enfermedad progresa rápidamente y el niño desarrolla una marcha de pato y un signo de Gowers positivo. Subir escaleras se vuelve difícil y el niño se cae frecuentemente. La pérdida de la deambulación independiente se produce entre los 6 y los 13 años, siendo la media de 9,5 años en los pacientes no tratados con esteroides. Una vez perdida la deambulación, se desarrollan rápidamente contracturas articulares y escoliosis. Los pacientes no tratados mueren entre el final de la adolescencia y el principio de la veintena por insuficiencia respiratoria y/o cardiomiopatía.

Miocardiopatía dilatada familiar aislada
SUMMARY

Una rara miocardiopatía familiar caracterizada por la dilatación del ventrículo izquierdo y el deterioro progresivo de la función ventricular sistólica, en ausencia de condiciones de carga anormales o de una enfermedad arterial coronaria suficiente para causar un deterioro sistólico global. La enfermedad puede causar insuficiencia cardíaca o arritmia. La enfermedad es aislada cuando no hay manifestaciones cardíacas o extracardíacas adicionales atípicas

CLINICAL DESCRIPTION

.La enfermedad se define por la presencia de dos criterios clínicos principales: un acortamiento fraccional del ventrículo izquierdo (VI) inferior al 25% y/o una fracción de eyección del VI inferior al 45% con un diámetro diastólico final del VI superior al 117% del valor previsto (corregido por la edad y la superficie corporal según la fórmula de Henry), en ausencia de condiciones de carga anormales o de una enfermedad arterial coronaria suficiente para causar un deterioro sistólico global. La enfermedad puede desarrollarse a cualquier edad, en ambos sexos. La masa del VI suele estar muy aumentada en este trastorno, pero el grosor de la pared del VI es normal. Puede haber síntomas de insuficiencia cardíaca y arritmias. Otras presentaciones incluyen la detección incidental de cardiomegalia asintomática y síntomas relacionados con trastornos de la conducción coexistentes o complicaciones tromboembólicas. Normalmente, hay antecedentes de MCD en la familia.

Forma sintomática de distrofia muscular de Duchenne y Becker en mujeres portadoras
SUMMARY

Distrofia muscular genética rara que afecta a las mujeres portadoras y se caracteriza por grados variables de debilidad muscular debido a una miopatía esquelética progresiva, a veces asociada a una cardiomiopatía dilatada o a una dilatación del ventrículo izquierdo.

CLINICAL DESCRIPTION

Las mujeres portadoras sintomáticas suelen presentarse más tarde que los varones con DMD o DMO. La debilidad muscular es generalmente menos grave que en los varones afectados y suele ser proximal y, a diferencia de los varones, tiene una distribución asimétrica. Los miembros superiores pueden ser más débiles que los inferiores. También se han notificado mialgias y calambres. El nivel de creatina quinasa en suero está elevado. Algunos pacientes pueden presentar únicamente manifestaciones cardíacas.

Discapacidad intelectual no sindrómica ligada al X
SUMMARY

El síndrome de duplicación de MECP2 es un trastorno del neurodesarrollo ligado al cromosoma X que se caracteriza por un retraso mental de severo a profundo, hipotonía infantil, rasgos dismórficos leves, escaso desarrollo del habla, rasgos autistas, convulsiones, espasticidad progresiva e infecciones recurrentes. Sólo afecta a los varones, aunque las mujeres portadoras pueden presentar algunos rasgos neuropsiquiátricos leves, como ansiedad. Las duplicaciones submicroscópicas de Xq28 que engloban a MECP2 se consideran eventos no recurrentes, porque las ubicaciones de los puntos de rotura y los tamaños de los reordenamientos varían entre los individuos afectados.

CLINICAL DESCRIPTION

VARIANTS

c.3087G>A ; g.26102-57302794 ; NM_004006.2(DMD):c.8608C>T ; NM_004006.2(DMD):c.2804-1G>A ; NM_004006.2(DMD):c.8069T>G ; g.31645986-31773985 ; c.1664G>A ; NM_004006.2(DMD):c.4471_4472delAA ; NM_004006.2(DMD):c.5899C>T ; c.3076G>T ; NM_004006.2(DMD):c.9337C>T ; NM_004006.2(DMD):c.3432+3A>G ; NM_004006.2(DMD):c.4806A>T ; NM_004006.2(DMD):c.9361+1G>A ; c.171G>A ; NM_004006.2(DMD):c.2816T>A ; NM_004006.2(DMD):c.627delA ; NM_004006.2(DMD):c.10033C>T ; c.2380+2T>C ; NM_004006.2(DMD):c.2804-2A>T ; c.6936del ; NM_004006.2(DMD):c.2547delT ; c.2758C>T ; NM_004006.2(DMD):c.6000T>A ; c.220del ; g.32557406-32754551 ; c.1900_1903dup ; c.1734del ; NM_004006.2(DMD):c.1286C>A ; NM_004006.2(DMD):c.676_678delAAG ; NM_004006.2(DMD):c.3295C>T ; NM_004006.2(DMD):c.2125delC ; g.31540244-32059446 ; NM_004006.2(DMD):c.6986dupA ; NM_004006.2(DMD):c.8443C>T ; c.2803+1G>A ; c.2587del ; g.32341945-32596022 ; NM_004006.2(DMD):c.3432+1G>A ; c.2266_2267del ; c.2866C>T ; NM_004006.2(DMD):c.6238delC ; NM_004006.2(DMD):c.9650-2A>G ; g.31724913-31806626 ; NM_004006.2(DMD):c.9862G>T ; g.10679-36186635 ; NM_004006.2(DMD):c.8064_8065delTA ; NM_004006.2(DMD):c.1341_1342dupAG ; g.32203741-32353533 ; g.31744885-32562211 ; NM_004006.2(DMD):c.1012G>T ; c.3124A>T ; NM_004006.2(DMD):c.8652_8653delCT ; NM_004006.2(DMD):c.433C>T ; c.277C>T ; NM_004006.2:c.2169-3_2169-1delinsAA ; c.7764dup ; NM_004006.2(DMD):c.3276+1G>A ; g.32501716-32932295 ; g.31856886-32482971 ; NM_004006.2(DMD):c.10141C>T ; NM_004006.2(DMD):c.6906G>A ; NM_004006.2(DMD):c.1261C>T ; NM_004006.2(DMD):c.10086+1G>A ; NM_004006.2(DMD):c.10446_10447delCT ; NM_004006.2(DMD):c.2484T>G ; NM_004006.2(DMD):c.4375C>T ; g.251879-35885004 ; g.31745624-31876916 ; g.31121669-33339588 ; g.30093911-34060667 ; c.489G>A ; g.31180370-31206667 ; g.10679-52213731 ; c.4486del ; NM_004006.2(DMD):c.9164-1G>C ; NM_004006.2(DMD):c.9854_9863delTGAGACTGGA ; g.31632068-31954142 ; NM_004006.2(DMD):c.1371delG ; NM_004006.2(DMD):c.2281_2285delGAAAA ; c.5570_5571dup ; c.2929dup ; c.6964del ; NM_004006.2(DMD):c.6391_6392delCA ; c.1900A>T ; NM_004006.2(DMD):c.615T>A ; g.32631403-32907656 ; c.530+1del ; NM_004006.2(DMD):c.1048G>T ; NM_004006.2(DMD):c.2755A>T ; c.2479del ; NM_004006.2(DMD):c.3747delG ; NM_004006.2(DMD):c.2815_2816delTT ; c.4409_4412dup ; c.6943G>T ; c.977-1G>T ; NM_004006.2(DMD):c.6182delC ; NM_004006.2(DMD):c.4518+5G>A ; g.10701-49071220 ; g.251880-51643625 ; NM_004006.2(DMD):c.1529_1530delTC ; NM_004006.2(DMD):c.6373C>T ; g.32380341-32412502 ; NM_004006.2(DMD):c.2803+1G>T ; c.6340A>T ; NM_004006.2(DMD):c.5773G>T ; c.3697del ; g.32341945-32816915 ; c.6763-2A>G ; c.4735G>T ; c.5671A>T ; c.5807T>A ; g.31744863-31846787 ; g.31627435-31774446 ; g.31679229-31968838 ; NM_004006.2(DMD):c.1306dupG ; g.32697662-32699472 ; NM_004006.2(DMD):c.7682G>A ; c.4500del ; NM_004006.2(DMD):c.6392_6393insCA ; c.1159C>T ; NM_004006.2(DMD):c.137_138dupAT ; g.31444405-31806767 ; g.32452761-32645074 ; NM_004006.2(DMD):c.5530C>T ; NM_004006.2(DMD):c.6982A>T ; c.3022A>T ; c.2523del ; NM_004006.2(DMD):c.9568C>T ; g.31819658-31932544 ; NM_004006.2(DMD):c.583C>T ; c.8086del ; NM_004006.2(DMD):c.5363C>G ; g.31898812-32022323 ; NM_004006.2(DMD):c.4405C>T ; NM_004006.2(DMD):c.2332C>T ; NM_004006.2(DMD):c.4117C>T ; g.31679229-31932544 ; g.32662366-32758964 ; NM_004006.2(DMD):c.8656C>T ; NM_004006.2(DMD):c.2302C>T ; NM_004006.2(DMD):c.2380+1G>C ; c.6014_6017del ; c.204dup ; NM_004006.2(DMD):c.5353C>T ; NM_004006.2(DMD):c.6292C>T ; c.2137C>T ; NM_004006.2(DMD):c.2294_2297delCCAT ; c.5313dup ; c.199G>T ; g.32432957-32823439 ; g.32267823-32372572 ; NM_004006.2(DMD):c.3639dupA ; g.31147275-31173604 ; c.1193C>G ; c.6226G>T ; c.6834del ; g.13020141-143473520 ; NM_004006.2(DMD):c.10454delT ; g.31870708-32353592 ; NM_004006.2(DMD):c.8944C>T ; g.10701-53131191 ; NM_004006.2(DMD):c.7894C>T ; NM_004006.2(DMD):c.412_413delAA ; NM_004006.2(DMD):c.4843A>T ; NM_004006.2(DMD):c.1332-9A>G ; NM_004006.2(DMD):c.2650C>T ; NM_004006.2(DMD):c.8713C>T ; g.31874956-31932544 ; NM_004006.2(DMD):c.8374_8375delAA ; NM_004006.2(DMD):c.5554C>T ; NM_004006.2(DMD):c.7683G>A ; g.31518752-31636035 ; g.31609490-32699472 ; NM_004006.2(DMD):c.1070delC ; NM_004006.2(DMD):c.9361+1G>C ; g.31929292-31968838 ; g.32364355-32390415 ; NM_004006.2(DMD):c.133C>T ; g.32216645-32651039 ; NM_004006.2:c.3246_3247insTTTCTAAAAA ; NM_004006.2(DMD):c.1489C>T ; g.32275729-32353585 ; g.31695292-31840818 ; NM_004006.2(DMD):c.9564-1G>A ; NM_004006.2(DMD):c.3779_3785delCTTTGGAinsGG ; g.31773859-31932544 ; g.31627435-31932544 ; g.31836597-31932544 ; NM_004006.2(DMD):c.3121C>T ; NM_004006.2(DMD):c.5697delA ; NM_004006.2(DMD):c.7771G>T ; NM_004006.2(DMD):c.7922delA ; g.31640772-31665565 ; g.31431098-31525874 ; g.32411633-33020588 ; g.31121669-31134568 ; NM_004006.2(DMD):c.1886C>A ; g.31931923-31932544 ; g.31965009-31968838 ; g.33019769-33020588 ; NM_004006.2(DMD):c.5287C>T ; g.31189847-31945183 ; NM_004006.2(DMD):c.5640T>A ; g.31133877-31134568 ; g.32380341-32380904

GENE

EDA

DISEASES
NO RARO EN EUROPA: Hipodoncia
SUMMARY

CLINICAL DESCRIPTION

Oligodoncia
SUMMARY

La oligodoncia es una rara anomalía dental del desarrollo en humanos caracterizada por la ausencia de seis o más dientes.

CLINICAL DESCRIPTION

Las características clínicas de la oligodoncia incluyen la ausencia de seis o más dientes, la falta de desarrollo de la altura del hueso alveolar maxilar y mandibular y la reducción de la altura facial inferior. También se observan variaciones en la morfología de los dientes y problemas en el desarrollo, la erupción y la exfoliación de los mismos.

Displasia ectodérmica hipohidrótica ligada al X
SUMMARY

CLINICAL DESCRIPTION

La displasia ectodérmica hipohidrótica o anhidrótica (HED/EDA) se caracteriza por una tríada de signos que comprenden pelo escaso (hipotricosis), dientes anormales o ausentes (anodoncia o hipodoncia) e incapacidad para sudar (anhidrosis o hipohidrosis). Las manifestaciones clínicas típicas también incluyen la sequedad de la piel, los ojos, las vías respiratorias y las membranas mucosas, presumiblemente debido al desarrollo defectuoso de varias glándulas exocrinas. La displasia ectodérmica hipohidrótica puede asociarse a rasgos dismórficos (protuberancias en la frente, ojeras, nariz evertida y labios prominentes) y, en ocasiones, a la ausencia de pezones. La displasia ectodérmica 1, debida a una mutación en el gen EDA, es la forma más frecuente de displasia ectodérmica hipohidrótica.

Distrofia muscular de Emery-Dreifuss ligada al X
SUMMARY

CLINICAL DESCRIPTION

La tríada clínica se compone de contracturas articulares de los tendones de Aquiles, del codo y del cuello posterior (que comienzan durante la primera infancia y empeoran hasta provocar una limitación del movimiento articular). Presenta debilidad y atrofia muscular lentamente progresiva (al principio y generalmente con una distribución humeroperoneal, pero más tarde se vuelve más difusa). Anomalías cardíacas (defectos de conducción, alteraciones del ritmo y miocardiopatía dilatada) que suelen manifestarse entre la 2ª y la 3ª década de la vida y que pueden conducir a la muerte súbita (a veces la característica de presentación de la enfermedad) y a accidentes isquémicos por embolia. El curso y la gravedad de la enfermedad varían entre las familias y entre los pacientes de una misma familia.

VARIANTS

NM_001399.4(EDA):c.187G>A ; NM_001399.4(EDA):c.183C>G ; NM_001399.4(EDA):c.467G>A ; NM_001399.5(EDA):c.573_574insT ; NM_001399.4(EDA):c.463C>T ; NM_001399.4(EDA):c.466C>T ; NM_001399.4(EDA):c.671G>C ; NM_001399.4(EDA):c.826C>T ; NM_001399.4(EDA):c.1045G>A ; NM_001399.4(EDA):c.181T>C

GENE

EMD

DISEASES
SUMMARY

CLINICAL DESCRIPTION

VARIANTS

NM_000117.2(EMD):c.547C>A ; c.631_635del

GENE

F8

DISEASES
Hemofilia A leve
SUMMARY

La hemofilia A leve es una forma de hemofilia A (véase este término) caracterizada por una pequeña deficiencia de factor VIII que provoca hemorragias anormales como consecuencia de lesiones menores o tras una intervención quirúrgica o una extracción dental.

CLINICAL DESCRIPTION

La actividad biológica del factor VIII se sitúa entre el 5 y el 40%. No se producen hemorragias espontáneas.

Hemofilia A moderadamente grave
SUMMARY

La hemofilia A moderadamente grave es una forma de hemofilia A (véase este término) caracterizada por una deficiencia de factor VIII que provoca hemorragias anormales como consecuencia de lesiones menores o tras una intervención quirúrgica o una extracción dental.

CLINICAL DESCRIPTION

La actividad biológica del factor VIII se sitúa entre el 1% y el 5%. Las hemorragias espontáneas son raras.

Hemofilia severa A
SUMMARY

La hemofilia A grave es una forma de hemofilia A (véase este término) caracterizada por una gran deficiencia de factor VIII que provoca frecuentes hemorragias espontáneas y hemorragias anormales como consecuencia de lesiones menores, o tras una intervención quirúrgica o una extracción dental.

CLINICAL DESCRIPTION

La actividad biológica del factor VIII es inferior al 1%.

Forma sintomática de hemofilia A en mujeres portadoras
SUMMARY

La hemofilia A sintomática en mujeres portadoras es una forma de hemofilia A (véase este término) que se manifiesta en algunas mujeres con mutaciones en el gen F8 (Xq28), que codifica el factor VIII de coagulación.

CLINICAL DESCRIPTION

Los síntomas incluyen hemorragias anormales como resultado de lesiones menores, o tras una cirugía o una extracción dental. Ocasionalmente pueden producirse hemorragias espontáneas.

VARIANTS

NM_000132.3(F8):c.872A>G ; c.788-1G>C ; c.6130del ; c.3251C>G ; c.4339dup ; c.4382_4383del ; c.3152del ; c.1438_1439del ; c.6070dup ; NM_000132.3(F8):c.687_688delAG ; c.889del ; c.415C>T ; c.1941_1944del ; c.3833del ; c.985dup ; c.2373dup ; c.3053del ; c.4619del ; c.4935G>A ; c.446del ; c.355C>T ; NM_000132.3(F8):c.1630G>A ; c.3409_3410del ; c.4999del ; c.5243del ; c.1538-2A>T ; c.1165del ; c.4719_4729del ; c.4662_4663del ; c.3907_3911del ; c.3991_3992del ; c.1653T>G ; NM_000132.3(F8):c.6464_6465delAA ; c.63_64del ; c.4408G>T ; c.3385del ; c.3031A>T ; NM_000132.3(F8):c.5879G>T ; c.4035del ; NM_000132.3(F8):c.1293delG ; c.516del ; c.1904-1G>A ; c.6136dup ; c.3913C>T ; c.4474A>T ; c.616G>T ; c.4934G>A ; c.89del ; c.1990_1991del ; c.420T>A ; c.3735_3744delinsATTTCTTTTTCTTT ; c.3863dup ; c.4969C>T ; NM_000132.3(F8):c.404A>G ; c.5301C>A ; c.6089dup ; c.985del ; c.5348_5357del ; c.1357G>T ; c.5697del ; c.510del ; c.709C>T ; c.3624del ; c.3402del ; NM_000132.3(F8):c.943delG ; c.729del ; c.6120_6135del ; c.3607G>T ; c.566C>A ; c.4450del ; c.5964_5967dup ; c.3421C>T ; c.496-2A>G ; c.3417dup ; c.3298A>T ; c.4942C>T ; c.3982C>T ; c.4156C>T ; NM_000132.3(F8):c.907delG ; c.1996_1999dup ; c.560T>A ; NM_000132.3:c.770_771insCC ; c.628_635del ; c.6115+1G>A ; c.4006C>T ; c.169+1G>T ; NM_000132.3(F8):c.849delT ; c.3827C>G ; c.5343T>A ; c.392del ; c.3967C>T ; c.5254del ; c.120del ; c.1410_1413del ; c.173del ; c.2412_2421del ; c.4492del ; c.974_975del ; c.1925_1928del ; c.1675G>T ; c.6116-2A>G ; c.169+1G>A ; c.850G>T ; c.787+2T>C ; c.4895dup ; NM_000132.3(F8):c.986G>A ; c.4697_4701dup ; c.4430_4431del ; c.4926del ; c.3344del ; c.2409del ; c.3902del ; c.5220-1G>A ; c.3540del ; c.591G>A ; c.1338del ; c.3844A>T ; c.4658del ; NM_000132.3(F8):c.1952A>C ; c.519_523del ; c.6194G>A ; c.2404C>T ; NM_000132.3(F8):c.1988C>T ; c.4199del ; c.4549_4550del ; c.3964C>T ; c.1443+2T>C ; c.5689_5690del ; c.3500dup ; c.788-1G>A ; c.4339del ; c.1394C>G ; c.5010del ; c.4265_4266del ; c.3496A>T ; c.607del ; c.73del ; c.1336dup ; c.195C>A ; c.4922dup ; c.1189dup ; c.948_951del ; c.3631A>T ; c.525C>A ; c.935del ; c.1442_1443dup ; c.3565dup ; c.2058_2059del ; c.160_161del ; c.128dup ; c.4425_4426del ; c.5251A>T ; c.4841del ; c.4072C>T ; c.6078_6079del ; c.3651del ; c.3772del ; c.3302_3303del ; c.6250A>T ; c.4806del ; c.4094_4100del ; NM_000132.3(F8):c.6865C>T ; c.1A>G ; c.3371C>A ; c.3652del ; c.4687del ; c.4492_4496del ; c.4363C>T ; c.3203_3204del ; c.3493G>T ; c.1538-1G>T ; c.2384_2388del ; c.6099del ; c.4318del ; c.92del ; c.201_202dup ; c.335_336del ; c.2032A>T ; c.4694_4697del ; c.4814C>A ; c.2462_2463del ; NM_000132.3:c.3150_3151insTC ; c.4996C>T ; c.6084del ; c.1202G>A ; NM_000132.3(F8):c.3548_3549delAA ; c.3922G>T ; c.3736del ; c.5337del ; c.5675dup ; c.3860del ; c.4446dup ; c.2089_2090del ; c.452_462del ; c.4280del ; c.4345del ; c.4345G>T ; c.4542del ; c.4201C>T ; c.4242dup ; c.333del ; c.185C>G ; c.4460del ; NM_000132.3:c.514_515insTCAAGATA ; c.3300del ; c.871G>T ; NM_000132.3(F8):c.6263C>T ; c.482del ; NM_000132.3(F8):c.7031G>A ; c.4770T>A ; c.72del ; c.1175C>G ; c.1390G>T ; c.6253G>T ; c.3416_3417del ; NM_000132.3(F8):c.1596_1597insG ; c.796G>T ; c.3994_3997del ; c.5953del ; c.4519del ; c.472C>T ; c.2397del ; c.1203G>A ; c.465G>A ; c.5960_5961del ; c.1595G>A ; c.4895del ; c.5766C>A ; c.6116_6117del ; c.5696dup ; c.4561C>T ; c.4272del ; c.224del ; c.2419dup ; c.685_686del ; c.98G>A ; c.471G>A ; NM_000132.3(F8):c.4473C>A ; c.4712_4715del ; NM_000132.3(F8):c.1175C>A ; c.1560del ; NM_000132.3(F8):c.6016G>T ; c.4918G>T ; c.3490del ; c.1311del ; c.5923dup ; c.495+1G>A ; c.5914_5915del ; c.680G>A ; c.4987A>T ; c.6120T>A ; c.3984dup ; c.4483del ; c.4483G>T ; NM_000132.3:c.1440_1441insA ; c.4473C>G ; c.2338del ; c.4686del ; c.4103del ; NM_000132.3(F8):c.2029T>C ; c.1200_1201del ; c.4805_4806del ; c.1947_1950del ; c.4798A>T ; NM_000132.3(F8):c.6912_6916delAAATC ; NM_000132.3(F8):c.4858delC ; c.3224del ; NM_000132.3(F8):c.493C>T ; c.6273+1G>A ; NM_000132.3(F8):c.1214T>G ; c.4899del ; c.60del ; c.5227_5228del ; c.4241C>A ; c.5869C>T ; c.5752del ; c.788-1G>T ; c.96del ; c.2000del ; c.919del ; c.4423C>T ; c.4512del ; c.2360del ; NM_000132.3(F8):c.5719_5720insA ; c.1596G>A ; c.3505del ; c.5271del ; c.6115+2T>C ; c.583del ; c.695_698del ; c.4848del ; c.3887del ; c.3830del ; c.3168_3187del ; NM_000132.3(F8):c.1075_1078delAATG ; c.1996_1999del ; c.3710del ; NM_000132.3(F8):c.832G>A ; c.1331_1332del ; c.3766G>T ; c.514_515del ; c.3851_3852del ; c.1443+1G>A ; NM_000132.3(F8):c.1726G>T ; c.3756del ; NM_000132.3(F8):c.4293_4297delCTCTT ; c.355del ; c.334G>T ; c.4720del ; c.4543_4544delinsA ; c.2102_2106del ; c.4492_4493del ; NM_000132.3(F8):c.1078_1079delGA ; c.421G>T ; c.265+1G>T ; NM_000132.3(F8):c.6533G>A ; c.4672_4675del ; c.3255_3258del ; c.64_65del ; c.3289C>T ; NM_000132.3(F8):c.199_200delAA ; c.143+1G>A ; NM_000132.3(F8):c.822G>A ; c.788-2A>T

GENE

F9

DISEASES
Hemofilia B leve
SUMMARY

La hemofilia B leve es una forma de hemofilia B (véase este término) caracterizada por una pequeña deficiencia de factor IX que provoca una hemorragia anormal como resultado de lesiones menores, o tras una cirugía o extracción dental.

CLINICAL DESCRIPTION

La actividad biológica del factor IX se sitúa entre el 5 y el 40%. No se producen hemorragias espontáneas.

Hemofilia B moderadamente grave
SUMMARY

La hemofilia B moderadamente grave es una forma de hemofilia B (véase este término) caracterizada por una deficiencia de factor IX que provoca hemorragias anormales como consecuencia de lesiones menores o tras una intervención quirúrgica o una extracción dental.

CLINICAL DESCRIPTION

La actividad biológica del factor IX se sitúa entre el 1% y el 5%. Las hemorragias espontáneas son raras.

Hemofilia B grave
SUMMARY

La hemofilia B grave es una forma de hemofilia B (véase este término) caracterizada por una gran deficiencia de factor IX que provoca frecuentes hemorragias espontáneas y hemorragias anormales como consecuencia de lesiones menores, o tras una intervención quirúrgica o una extracción dental.

CLINICAL DESCRIPTION

La actividad biológica del factor IX es inferior al 1%.

Forma sintomática de hemofilia B en mujeres portadoras
SUMMARY

La hemofilia B sintomática en mujeres portadoras es una forma de hemofilia B (véase este término) que se manifiesta en algunas mujeres con mutaciones en el gen F9 (Xq28), que codifica el factor de coagulación IX.

CLINICAL DESCRIPTION

Los síntomas incluyen hemorragias anormales como resultado de lesiones menores, o después de una cirugía o extracción de dientes. Ocasionalmente pueden producirse hemorragias espontáneas.

VARIANTS

NM_000133.3(F9):c.1031T>C ; NM_000133.3(F9):c.79G>A ; NM_000133.3(F9):c.52T>C ; NM_000133.3(F9):c.1136G>A ; NM_000133.3(F9):c.82T>C ; NM_000133.3(F9):c.1150C>T

GENE

GJB2

DISEASES
Sordera neurosensorial autosómica dominante de tipo DFNA
SUMMARY

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.

CLINICAL DESCRIPTION

La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Sordera neurosensorial autosómica recesiva de tipo DFNB
SUMMARY

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica notificada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.

CLINICAL DESCRIPTION

La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

Queratodermia hereditaria mutilante
SUMMARY

La queratodermia hereditaria mutilante es un trastorno hereditario, difuso y mutilante de la queratodermia palmoplantar que se caracteriza por una queratosis palmoplantar severa con patrón de panal de abeja y pseudoainhumación de los dedos que lleva a la autoamputación, asociada a una pérdida auditiva neurosensorial congénita de leve a moderada. Otras características son la queratosis estrellada en las superficies extensoras de los dedos, los pies, los codos y las rodillas. También pueden asociarse la alopecia, la onicogrifosis, la distrofia ungueal o el hipocratismo, la paraplejia espástica y la miopatía.

CLINICAL DESCRIPTION

0

Síndrome de KID
SUMMARY

Un raro trastorno ectodérmico congénito caracterizado por queratitis vascularizante, lesiones cutáneas hiperqueratósicas y pérdida de audición

CLINICAL DESCRIPTION

.Los pacientes suelen presentar al nacer un eritema generalizado y escamas ictiosiformes. Las manifestaciones cutáneas son progresivas y la eritroqueratodermia se caracteriza por placas eritematosas y queratósicas bien delimitadas con aspecto verrugoso, localizadas predominantemente en la cara, el cuero cabelludo, las orejas, los codos y las rodillas. Otras alteraciones cutáneas son los surcos profundos alrededor de la boca, la hiperqueratosis palmoplantar (PPHK) con queratodermia en forma de grano de cuero, la HK folicular en el tronco y la HK en forma de pico (ictiosis de tipo histriónico) en algunos casos. Las lesiones cutáneas son propensas a la infección y se han descrito raros casos mortales de infecciones recurrentes graves con septicemia. También son frecuentes la distrofia de las uñas, la alopecia y la ausencia o escasez de cejas y pestañas. Los pacientes con Kid/HID tienen una mayor susceptibilidad a los carcinomas de células escamosas y de lengua. La pérdida de audición es congénita, normalmente neurosensorial, y suele ser profunda. Los hallazgos oculares pueden estar ausentes en algunos pacientes, pero cuando están presentes suelen aparecer durante la infancia o la adolescencia con fotofobia, queratitis puntiforme y vascularización corneal progresiva que conduce a la pérdida de visión. La pérdida combinada de visión y audición puede provocar un grave retraso en el desarrollo. En algunos casos se han descrito defectos cerebelosos y neuromusculares.

Síndrome de las almohadillas de los nudillos - leuconiquia - sordera sensorineural - hiperqueratosis palmoplantar
SUMMARY

Una rara enfermedad genética sindrómica de la sordera, caracterizada por nudillos simétricos o asimétricos (típicamente localizados en las articulaciones distales e interfalángicas), leuconiquia, queratodermia palmoplantar difusa y sordera neurosensorial congénita de leve a moderada.

CLINICAL DESCRIPTION

Una rara enfermedad genética sindrómica de la sordera, caracterizada por nudillos simétricos o asimétricos (típicamente localizados en las articulaciones distales e interfalángicas), leuconiquia, queratodermia palmoplantar difusa y sordera neurosensorial congénita de leve a moderada.

Queratodermia palmoplantar-síndrome de sordera
SUMMARY

El síndrome de queratodermia palmoplantar es un trastorno de queratinización caracterizado por queratodermia palmoplantar focal o difusa. Se observa una distribución en forma de parches con acentuación en los pies, los hipotenares y los arcos de los pies. La enfermedad se manifiesta en la infancia y se asocia a una pérdida de audición neurosensorial que muestra una edad de aparición variable. Debido a las similitudes genéticas y clínicas, se ha propuesto que el síndrome de queratodermia-sordera palmoplantar, el síndrome de almohadillas de nudillos-leuconiquia-sordera neurosensorial-hiperqueratosis palmoplantar y la queratodermia hereditaria mutilans pueden representar variantes de un amplio trastorno de sordera sindrómica con fenotipo heterogéneo. La enfermedad se transmite de forma autosómica dominante con penetrancia incompleta.

CLINICAL DESCRIPTION

Nevo ecrino poroqueratósico de los conductos ostiales y dérmicos
SUMMARY

CLINICAL DESCRIPTION

VARIANTS

NM_004004.5(GJB2):c.132G>A ; NM_004004.5(GJB2):c.416G>A ; NM_000151.4:c.229T>C ; c.516G>A ; NM_004004.5(GJB2):c.238C>T ; NM_004004.5(GJB2):c.269T>C ; NM_004004.5(GJB2):c.269dupT ; NM_004004.6:c.35delG ; c.402del ; c.310_323del ; NM_004004.5(GJB2):c.250G>C ; c.270dup ; NM_004004.6(GJB2):c.427C>T ; NM_004004.5(GJB2):c.313_326delAAGTTCATCAAGGG ; NM_004004.5(GJB2):c.334_335delAA ; NM_004004.5(GJB2):c.551G>C ; NM_004004.5(GJB2):c.235delC ; NM_004004.5(GJB2):c.365A>T ; NM_004004.5(GJB2):c.139G>T ; NM_004004.5(GJB2):c.299_300delAT ; NM_004004.5(GJB2):c.169C>T ; NM_004004.5(GJB2):c.550C>T ; NM_004004.5(GJB2):c.230G>A ; NM_004004.6(GJB2):c.299A>T ; NM_004004.5(GJB2):c.239A>C ; NM_004004.5(GJB2):c.617A>G ; NM_004004.5(GJB2):c.231G>A ; NM_004004.5(GJB2):c.358_360delGAG ; NM_004004.5(GJB2):c.250G>T ; NM_004004.6(GJB2):c.465T>A ; NM_004004.5(GJB2):c.176_191del16 ; NM_004004.6(GJB2):c.439G>A

GENE

HBA1 / HBA2

DISEASES
Síndrome de alfa-talasemia-discapacidad intelectual ligado al cromosoma 16
SUMMARY

Un raro defecto de desarrollo durante la embriogénesis, un síndrome de deleción genética contigua, es una forma de alfa-talasemia caracterizada por microcitosis, hipocromía, nivel normal de hemoglobina (Hb) o anemia leve, asociada a anomalías del desarrollo.

CLINICAL DESCRIPTION

La ATR-16 es una enfermedad congénita. Los pacientes presentan un rasgo de alfa-talasemia o una enfermedad leve de la hemoglobina H (enfermedad HbH) asociada a una discapacidad intelectual de leve a profunda (en la mayoría de los casos) y, en algunos casos, a rasgos dismórficos leves e inespecíficos (hipertelorismo leve, fisuras palpebrales inclinadas hacia abajo, puente nasal ancho o prominente, orejas pequeñas, cuello corto), microcefalia y baja estatura. Se han señalado anomalías genitales (hipospadias y criptorquidia) en los varones. El pie zambo es frecuente.

SUMMARY

Un raro defecto de desarrollo durante la embriogénesis, un síndrome de deleción genética contigua, es una forma de alfa-talasemia caracterizada por microcitosis, hipocromía, nivel normal de hemoglobina (Hb) o anemia leve, asociada a anomalías del desarrollo.

CLINICAL DESCRIPTION

La ATR-16 es una enfermedad congénita. Los pacientes presentan un rasgo de alfa-talasemia o una enfermedad leve de la hemoglobina H (enfermedad HbH) asociada a una discapacidad intelectual de leve a profunda (en la mayoría de los casos) y, en algunos casos, a rasgos dismórficos leves e inespecíficos (hipertelorismo leve, fisuras palpebrales inclinadas hacia abajo, puente nasal ancho o prominente, orejas pequeñas, cuello corto), microcefalia y baja estatura. Se han señalado anomalías genitales (hipospadias y criptorquidia) en los varones. El pie zambo es frecuente.

Hidrops fetal de Hb Bart
SUMMARY

Forma rara y grave de alfa-talasemia que casi siempre es letal. Se caracteriza por la aparición en el feto de edema generalizado, derrames pleurales y pericárdicos y anemia hipocrómica grave.

CLINICAL DESCRIPTION

Los fetos afectados sufren una anemia grave en el útero, lo que provoca una hipoxia tisular severa, insuficiencia cardíaca y una serie de anomalías del desarrollo asociadas a la hidropesía fetal (marcada hepatoesplenomegalia, anomalías urogenitales y de las extremidades). En los supervivientes, el periodo neonatal suele ser tormentoso, y el retraso del crecimiento y el neurodesarrollo son los principales resultados adversos a largo plazo. Las complicaciones maternas durante el embarazo incluyen preeclampsia, polihidramnios u oligohidramnios, hemorragia anteparto y parto prematuro. Aunque las transfusiones intrauterinas y los cuidados intensivos perinatales han conseguido aumentar la supervivencia del feto hasta el periodo perinatal, se suele recomendar la interrupción terapéutica temprana de los embarazos de riesgo debido a la gravedad del síndrome y al riesgo de complicaciones maternas potencialmente graves durante el embarazo.

SUMMARY

Forma rara y grave de alfa-talasemia que casi siempre es letal. Se caracteriza por la aparición en el feto de edema generalizado, derrames pleurales y pericárdicos y anemia hipocrómica grave.

CLINICAL DESCRIPTION

Los fetos afectados sufren una anemia grave en el útero, lo que provoca una hipoxia tisular severa, insuficiencia cardíaca y una serie de anomalías del desarrollo asociadas a la hidropesía fetal (marcada hepatoesplenomegalia, anomalías urogenitales y de las extremidades). En los supervivientes, el periodo neonatal suele ser tormentoso, y el retraso del crecimiento y el neurodesarrollo son los principales resultados adversos a largo plazo. Las complicaciones maternas durante el embarazo incluyen preeclampsia, polihidramnios u oligohidramnios, hemorragia anteparto y parto prematuro. Aunque las transfusiones intrauterinas y los cuidados intensivos perinatales han conseguido aumentar la supervivencia del feto hasta el periodo perinatal, se suele recomendar la interrupción terapéutica temprana de los embarazos de riesgo debido a la gravedad del síndrome y al riesgo de complicaciones maternas potencialmente graves durante el embarazo.

Enfermedad de la hemoglobina H
SUMMARY

La enfermedad de la hemoglobina H (HbH) es una forma de moderada a grave de alfa-talasemia (véase este término) caracterizada por una anemia hemolítica microcítica e hipocrómica pronunciada.

CLINICAL DESCRIPTION

Las características clínicas son muy variables y generalmente se desarrollan en los primeros años de vida. Los signos iniciales pueden notarse sólo durante los análisis hematológicos de rutina. Los pacientes presentan una anemia hemolítica microcítica hipocrómica variable, que no requiere transfusiones de sangre o las requiere ocasionalmente durante los episodios infecciosos, la exposición a agentes oxidantes o el embarazo. Es frecuente encontrar esplenomegalia. Las formas no delecionales de alfa-talasemia suelen presentar una anemia más grave, esplenomegalia, hepatomegalia, colelitiasis, retraso en el crecimiento, disminución de la densidad ósea; y requieren transfusiones más tempranas y frecuentes. Los cambios esqueléticos que afectan principalmente a la cara pueden ocurrir raramente en las formas no delecionales. La sobrecarga de hierro se desarrolla de forma secundaria al aumento de la absorción intestinal de hierro, incluso en ausencia de transfusión.

SUMMARY

La enfermedad de la hemoglobina H (HbH) es una forma de moderada a grave de alfa-talasemia (véase este término) caracterizada por una anemia hemolítica microcítica e hipocrómica pronunciada.

CLINICAL DESCRIPTION

Las características clínicas son muy variables y generalmente se desarrollan en los primeros años de vida. Los signos iniciales pueden notarse sólo durante los análisis hematológicos de rutina. Los pacientes presentan una anemia hemolítica microcítica hipocrómica variable, que no requiere transfusiones de sangre o las requiere ocasionalmente durante los episodios infecciosos, la exposición a agentes oxidantes o el embarazo. Es frecuente encontrar esplenomegalia. Las formas no delecionales de alfa-talasemia suelen presentar una anemia más grave, esplenomegalia, hepatomegalia, colelitiasis, retraso en el crecimiento, disminución de la densidad ósea; y requieren transfusiones más tempranas y frecuentes. Los cambios esqueléticos que afectan principalmente a la cara pueden ocurrir raramente en las formas no delecionales. La sobrecarga de hierro se desarrolla de forma secundaria al aumento de la absorción intestinal de hierro, incluso en ausencia de transfusión.

Enfermedad de la hemoglobina M
SUMMARY

Una rara hemoglobinopatía caracterizada por la presencia de variantes de la hemoglobina con anomalías estructurales en la porción de globina de la molécula que conducen a la auto-oxidación del hierro hemo, dando lugar a la metahemoglobinemia. Los pacientes presentan cianosis para la que no es necesario ningún tratamiento. El modo de herencia es autosómico dominante.

CLINICAL DESCRIPTION

La inmunodeficiencia combinada grave se refiere a un grupo genética y clínicamente heterogéneo de trastornos con una función inmunitaria celular y humoral defectuosa. Los pacientes con IDCG presentan en la infancia infecciones recurrentes y persistentes por organismos oportunistas, como Candida albicans, Pneumocystis carinii y citomegalovirus, entre muchos otros. Los análisis de laboratorio muestran una linfopenia profunda con disminución o ausencia de inmunoglobulinas. La característica común de todos los tipos de IDCG es la ausencia de inmunidad celular mediada por células T debido a un defecto en el desarrollo de las mismas. Sin tratamiento, los pacientes suelen morir en el primer año de vida. La prevalencia global de todos los tipos de IDCG es de aproximadamente 1 de cada 75.000 nacimientos.

SUMMARY

Una rara hemoglobinopatía caracterizada por la presencia de variantes de la hemoglobina con anomalías estructurales en la porción de globina de la molécula que conducen a la auto-oxidación del hierro hemo, dando lugar a la metahemoglobinemia. Los pacientes presentan cianosis para la que no es necesario ningún tratamiento. El modo de herencia es autosómico dominante.

CLINICAL DESCRIPTION

La inmunodeficiencia combinada grave se refiere a un grupo genética y clínicamente heterogéneo de trastornos con una función inmunitaria celular y humoral defectuosa. Los pacientes con IDCG presentan en la infancia infecciones recurrentes y persistentes por organismos oportunistas, como Candida albicans, Pneumocystis carinii y citomegalovirus, entre muchos otros. Los análisis de laboratorio muestran una linfopenia profunda con disminución o ausencia de inmunoglobulinas. La característica común de todos los tipos de IDCG es la ausencia de inmunidad celular mediada por células T debido a un defecto en el desarrollo de las mismas. Sin tratamiento, los pacientes suelen morir en el primer año de vida. La prevalencia global de todos los tipos de IDCG es de aproximadamente 1 de cada 75.000 nacimientos.

VARIANTS

--MED ; --SEA ; --THAI ; - α3.7 ; - α4.2 ; - α20.5 ; --FIL

GENE

HBB

DISEASES
Beta-talasemia intermedia
SUMMARY

La beta-talasemia (BT) intermedia es una forma de BT (véase este término) caracterizada por una anemia de leve a moderada que no requiere transfusiones o sólo las requiere ocasionalmente.

CLINICAL DESCRIPTION

La BT intermedia abarca un amplio espectro clínico, y los casos más graves se presentan entre los 2 y los 6 años de edad con anemia, aumento del tamaño del bazo y a veces del hígado, así como retraso en el crecimiento y el desarrollo. En otros casos, los pacientes son completamente asintomáticos hasta la vida adulta y sólo presentan una anemia leve. La hipertrofia de la médula eritroide, con la posibilidad de eritropoyesis extramedular, es frecuente y conduce a deformidades características del hueso y la cara, osteoporosis con fracturas patológicas de los huesos largos y formación de masas eritropoyéticas que afectan principalmente al bazo, el hígado, los ganglios linfáticos, el tórax y la columna vertebral. Con menor frecuencia, la hipertrofia de la médula eritroide puede causar problemas neurológicos (compresión de la médula espinal con paraplejia). Los pacientes también pueden desarrollar úlceras en las piernas y cálculos biliares. Se ha informado de una mayor predisposición a la trombosis frente a la BT mayor, especialmente después de la esplenectomía. Aunque los pacientes corren el riesgo de sufrir una sobrecarga de hierro, el hipogonadismo, el hipotiroidismo y la diabetes no son frecuentes. La afectación cardíaca también puede producirse como resultado de un estado de alto rendimiento e hipertensión pulmonar, mientras que la función sistólica del ventrículo izquierdo suele estar preservada.

Beta-talasemia mayor
SUMMARY

La beta-talasemia (BT) mayor es una forma grave de inicio temprano de la BT (véase este término) que se caracteriza por una anemia grave que requiere transfusiones regulares de glóbulos rojos.

CLINICAL DESCRIPTION

El inicio se produce durante la infancia con anemia grave, retraso en el desarrollo y palidez progresiva. Pueden aparecer problemas de alimentación, diarrea, irritabilidad, brotes recurrentes de fiebre y aumento progresivo del abdomen causado por esplenomegalia y hepatomegalia. Los pacientes no tratados o mal transfundidos presentan retraso del crecimiento, palidez, ictericia, mala musculatura, genu valgum, úlceras en las piernas, formación de masas debido a la hematopoyesis extramedular y cambios en el esqueleto, incluyendo deformidades en los huesos largos de las piernas y cambios craneofaciales típicos, como protuberancia del cráneo, eminencia malar prominente, depresión del puente de la nariz, tendencia a una inclinación mongólica del ojo e hipertrofia del maxilar, que tiende a exponer los dientes superiores. En los pacientes transfundidos regularmente, el crecimiento y el desarrollo tienden a ser normales, pero pueden surgir complicaciones relacionadas con la sobrecarga de hierro, como el retraso del crecimiento y el fracaso o el retraso de la maduración sexual. Las complicaciones de la sobrecarga de hierro de aparición más tardía incluyen miocardiopatía dilatada, arritmias, fibrosis hepática y cirrosis, diabetes mellitus e insuficiencia de las glándulas paratiroides, tiroides, hipófisis y, con menor frecuencia, suprarrenales. Otras complicaciones son el hiperesplenismo, la trombosis venosa y la osteoporosis.

Beta-talasemia delta
SUMMARY

La beta-talasemia delta es una forma de beta-talasemia (véase este término) caracterizada por la disminución o ausencia de la síntesis de las cadenas delta y beta de la globina con un aumento compensatorio de la expresión de la síntesis de la cadena gamma fetal.

CLINICAL DESCRIPTION

La forma heterocigótica de la enfermedad es clínicamente asintomática con microcitosis leve y sin elevación de la HbA2, mientras que los pocos pacientes homocigóticos tienen una presentación clínica leve. Cuando se hereda con beta-talasemia clásica heterocigota, los pacientes suelen tener el fenotipo de talasemia intermedia, pero en algunos casos se ha descrito el fenotipo de talasemia mayor.

Beta-talasemia dominante
SUMMARY

La beta-talasemia dominante es una forma de beta-talasemia (véase este término) que provoca una anemia de moderada a grave.

CLINICAL DESCRIPTION

Los pacientes presentan anemia de moderada a grave, ictericia y esplenomegalia.

Enfermedad de la hemoglobina C
SUMMARY

La enfermedad de la hemoglobina C (HbC) es una hemoglobinopatía caracterizada por la producción de una variante anormal de la hemoglobina conocida como hemoglobina C, sin manifestaciones clínicas o con manifestaciones clínicas leves (anemia hemolítica).

CLINICAL DESCRIPTION

Síndrome de hemoglobina C-beta-talasemia
SUMMARY

La hemoglobina C - beta-talasemia (HbC - BT) es una forma de beta-talasemia (véase este término) que provoca una anemia hemolítica moderada.

CLINICAL DESCRIPTION

Los pacientes suelen ser asintomáticos y se diagnostican durante las pruebas rutinarias. Cuando están presentes, las manifestaciones clínicas son anemia moderada y esplenomegalia.

Enfermedad de la hemoglobina D
SUMMARY

La enfermedad de la hemoglobina D (HbD) es una hemoglobinopatía caracterizada por la producción de una variante anormal de la hemoglobina conocida como hemoglobina D, con manifestaciones clínicas nulas o leves (esplenomegalia, anemia muy leve).

CLINICAL DESCRIPTION

Enfermedad de la hemoglobina E
SUMMARY

La enfermedad de la hemoglobina E (HbE) es una hemoglobinopatía caracterizada por la producción de una variante anormal de la hemoglobina conocida como hemoglobina E, con una presentación generalmente benigna y asintomática.

CLINICAL DESCRIPTION

Síndrome de hemoglobina E-beta-talasemia
SUMMARY

La hemoglobina E - beta-talasemia (HbE - BT) es una forma de beta-talasemia (ver este término) que da lugar a una presentación clínica de leve a grave que va desde una condición indistinguible de la beta-talasemia mayor hasta una forma leve de beta-talasemia intermedia (ver estos términos).

CLINICAL DESCRIPTION

La HbE - BT leve (alrededor del 15% de los casos) se caracteriza por niveles normales de Hb (9-12 g/dl) y los pacientes no suelen desarrollar síntomas clínicamente significativos. No es necesario ningún tratamiento. Las formas moderadamente graves (la mayoría de los casos) se caracterizan por una disminución de los niveles de Hb (6-8 g/dl) y las manifestaciones clínicas son similares a las de la beta-talasemia intermedia. No se requieren transfusiones a menos que las infecciones precipiten una mayor anemia. Puede producirse una sobrecarga de hierro. Las formas graves se caracterizan por niveles de Hb muy bajos (4-5 g/dl) y los pacientes presentan manifestaciones similares a las de la beta-talasemia mayor y son tratados como pacientes con talasemia mayor.

Síndrome de hemoglobina Lepore-beta-talasemia
SUMMARY

Una rara beta-talasemia asociada a otra anomalía de la hemoglobina caracterizada por la presencia de la variante de la hemoglobina Lepore en asociación con la beta-talasemia. La presentación clínica es muy variable, dependiendo del tipo de beta-talasemia, y va desde una anemia microcítica hipocrómica grave y una dependencia total de las transfusiones hasta una anemia moderada y compensada sin necesidad de transfusiones de sangre regulares.

CLINICAL DESCRIPTION

La metahemoglobinemia es una condición clínica en la que más del 1% de la hemoglobina se oxida a metahemoglobina, un tipo de hemoglobina que contiene la forma férrica (Fe3+) del hierro. Los pacientes con hemoglobina M son cianóticos pero, por lo demás, asintomáticos. Si la mutación se produce en la subunidad alfa de la hemoglobina, la cianosis es evidente al nacer, mientras que si la cadena beta está afectada, la cianosis aparece más tarde o se intensifica cuando aumenta la producción de la subunidad beta. Si un recién nacido es portador de una hemoglobina M fetal (subunidad gamma), la cianosis desaparece cuando se produce el cambio completo de gamma a beta.

Enfermedad de la hemoglobina M
SUMMARY

Una rara hemoglobinopatía caracterizada por la presencia de variantes de la hemoglobina con anomalías estructurales en la porción de globina de la molécula que conducen a la auto-oxidación del hierro hemo, dando lugar a la metahemoglobinemia. Los pacientes presentan cianosis para la que no es necesario ningún tratamiento. El modo de herencia es autosómico dominante.

CLINICAL DESCRIPTION

La inmunodeficiencia combinada grave se refiere a un grupo genética y clínicamente heterogéneo de trastornos con una función inmunitaria celular y humoral defectuosa. Los pacientes con IDCG presentan en la infancia infecciones recurrentes y persistentes por organismos oportunistas, como Candida albicans, Pneumocystis carinii y citomegalovirus, entre muchos otros. Los análisis de laboratorio muestran una linfopenia profunda con disminución o ausencia de inmunoglobulinas. La característica común de todos los tipos de IDCG es la ausencia de inmunidad celular mediada por células T debido a un defecto en el desarrollo de las mismas. Sin tratamiento, los pacientes suelen morir en el primer año de vida. La prevalencia global de todos los tipos de IDCG es de aproximadamente 1 de cada 75.000 nacimientos.

Persistencia hereditaria de la hemoglobina fetal - Síndrome de beta-talasemia
SUMMARY

La persistencia hereditaria de hemoglobina fetal (HPFH) asociada a la beta-talasemia (véase este término) se caracteriza por niveles elevados de hemoglobina (Hb) F y un número elevado de células que contienen Hb fetal.

CLINICAL DESCRIPTION

La asociación de la HPFH con la beta-talasemia mitiga las manifestaciones clínicas que varían desde un estado normal hasta la beta-talasemia intermedia (véase este término).

Síndrome de la enfermedad de células falciformes con persistencia hereditaria de la hemoglobina fetal
SUMMARY

Es una hemoglobinopatía genética rara que se caracteriza por un fenotipo clínico generalmente leve, niveles elevados de hemoglobina fetal y microcitosis e hipocromía leves. En algunos casos, se han notificado manifestaciones agudas de la enfermedad de células falciformes, concretamente el síndrome torácico agudo y la crisis de dolor agudo. El genotipo se caracteriza por la combinación de un alelo HbS y HbF; los síntomas dependen del grado de expresividad HbF:HbS, siendo asintomáticos los pacientes con más del 35% de expresión de HbF pancélica. Los pacientes sintomáticos tienen una expresión heterocelular de HbF.

CLINICAL DESCRIPTION

Una hemoglobinopatía genética poco frecuente que se caracteriza por un fenotipo clínico generalmente leve, niveles elevados de hemoglobina fetal y microcitosis e hipocromía leves. En algunos casos, se han notificado manifestaciones agudas de la enfermedad de células falciformes, a saber, síndrome torácico agudo y crisis de dolor agudo. El genotipo se caracteriza por la combinación de un alelo HbS y HbF; los síntomas dependen del grado de expresividad de HbF:HbS, siendo asintomáticos los pacientes con más de un 35% de expresión de HbF pancelular. Los pacientes sintomáticos tienen una expresión heterocelular de HbF.

Anemia falciforme
SUMMARY

Forma grave de la enfermedad de células falciformes (ECF) caracterizada por la homocigosis para el gen de la hemoglobina falciforme (HbS) y que se manifiesta de forma aguda con anemia grave, susceptibilidad a infecciones bacterianas graves y accidentes vasooclusivos isquémicos. Se trata de una enfermedad de los glóbulos rojos de origen genético que se manifiesta con una enfermedad hemolítica y una pérdida de deformabilidad de los glóbulos rojos que conduce a otros eventos oclusivos.

CLINICAL DESCRIPTION

La enfermedad no se manifiesta durante la vida fetal o hasta los tres primeros meses de vida debido a la presencia de altos niveles de hemoglobina fetal. Las manifestaciones clínicas evolucionan con la edad y son muy variables entre los individuos y en diferentes momentos. Además de la anemia y las infecciones bacterianas, los VOA causan isquemia focal hiperálgica (y a veces infarto) cuando se producen en el abdomen, el tórax o el esqueleto. Con el paso del tiempo, los AOV pueden comprometer la integridad de los tejidos u órganos.

Síndrome de la enfermedad de células falciformes-beta-talasemia
SUMMARY

Una rara hemoglobinopatía genética que afecta a los glóbulos rojos tanto en la producción de hemoglobina anormal, como en la disminución de la síntesis de las cadenas de beta globina. Las manifestaciones clínicas dependen de la cantidad de producción de cadenas de beta globina residuales, y son similares a las de la anemia falciforme, incluyendo anemia, oclusión vascular y sus complicaciones, episodios agudos de dolor, síndrome torácico agudo, hipertensión pulmonar, sepsis, lesión cerebral isquémica, crisis de secuestro esplénico y esplenomegalia.

CLINICAL DESCRIPTION

Una rara hemoglobinopatía genética que afecta a los glóbulos rojos tanto en la producción de hemoglobina anormal, como en la disminución de la síntesis de las cadenas de beta globina. Las manifestaciones clínicas dependen de la cantidad de producción residual de cadenas de beta globina, y son similares a las de la anemia falciforme, incluyendo anemia, oclusión vascular y sus complicaciones, episodios agudos de dolor, síndrome torácico agudo, hipertensión pulmonar, sepsis, lesión cerebral isquémica, crisis de secuestro esplénico y esplenomegalia.

Síndrome de la enfermedad de células falciformes-hemoglobina C
SUMMARY

Una rara hemoglobinopatía genética caracterizada por anemia, reticulocitosis y anomalías eritrocitarias que incluyen células en diana, células irreversiblemente falciformes y células con cristales. La evolución clínica es similar a la de la enfermedad de células falciformes, pero menos grave y con menos complicaciones. Los signos y síntomas pueden incluir episodios agudos de dolor, infarto esplénico y crisis de secuestro esplénico, síndrome torácico agudo, glomeruloesclerosis segmentaria focal, lesión cerebral isquémica, retinopatía periférica y osteonecrosis.

CLINICAL DESCRIPTION

VARIANTS

NM_000518.5(HBB):c.217dup (p.Ser73Lysfs) ; NC_000011.10:g.5226765_5226768del ; NM_000518.5(HBB):c.92+5G>A ; NM_000518.5(HBB):c.85dup (p.Leu29Profs) ; NM_000518.5(HBB):c.82G>T (p.Ala28Ser) ; NM_000518.4(HBB):c.364G>A (p.Glu122Lys) ; NM_000518.5(HBB):c.315+1G>A ; NM_000518.4(HBB):c.135delC (p.Phe46Leufs) ; NM_000518.5(HBB):c.118C>T (p.Gln40Ter) ; NM_000518.4(HBB):c.112delT (p.Trp38Glyfs) ; NM_000518.5(HBB):c.93-21G>A ; NM_000518.5(HBB):c.92+6T>C ; NM_000518.5(HBB):c.92+5G>C ; NM_000518.5(HBB):c.92+1G>A ; NM_000518.5(HBB):c.79G>A (p.Glu27Lys) ; NM_000518.5(HBB):c.59A>G (p.Asn20Ser) ; NM_000518.5(HBB):c.52A>T (p.Lys18Ter) ; NM_000518.4(HBB):c.27dupG (p.Ser10Valfs*14) ; NM_000518.5(HBB):c.20A>T (p.Glu7Val) ; NM_000518.4(HBB):c.19G>A (p.Glu7Lys)

GENE

IDS

DISEASES
Mucopolisacaridosis tipo 2, forma atenuada
SUMMARY

La mucopolisacaridosis tipo 2, forma atenuada (MPS2att), la forma menos grave de la MPS2 (véase este término), da lugar a una acumulación masiva de glucosaminoglicanos y a una amplia variedad de síntomas que incluyen facies distintiva, baja estatura, hallazgos cardiorrespiratorios y esqueléticos. Se diferencia de la mucopolisacaridosis tipo 2, forma grave (ver este término) por la ausencia de deterioro cognitivo.

CLINICAL DESCRIPTION

La MPS2att es clínicamente heterogénea y su tasa de progresión es muy variable. Los pacientes parecen sanos al nacer, con síntomas iniciales sutiles que aparecen entre los 18 meses y los 4 años de edad o incluso más tarde, en particular la hernia umbilical o inguinal. Una facies distintiva (engrosamiento de los labios y las fosas nasales, lengua agrandada y protuberante), se forma lentamente y puede observarse por primera vez a los 2-4 años de edad (a menudo no es evidente hasta más tarde). La inflamación del tracto respiratorio superior puede ser responsable de infecciones frecuentes, en particular otitis media; ronquidos excesivos y apnea del sueño; una voz ronca característica y pérdida progresiva de la audición. Durante la primera infancia, el crecimiento se retrasa y los pacientes tienen una estatura baja con disostosis múltiple y articulaciones rígidas que pueden hacer que el movimiento sea doloroso; también puede producirse una displasia de cadera. Las articulaciones de las falanges están universalmente contraídas, lo que da lugar a manos en forma de garra; es frecuente el síndrome del túnel carpiano. También puede producirse una paresia espástica debido a la compresión de la médula espinal en la región craneocervical. La presión ejercida sobre el nervio óptico puede conducir a la pérdida de visión y en algunos casos se ha informado de degeneración de la retina. Los pacientes de la MPS2att, en general, no presentan alteraciones cognitivas.

Mucopolisacaridosis tipo 2, forma grave
SUMMARY

Enfermedad rara por almacenamiento de lípidos lisosomales que se caracteriza por signos clínicos variables, dependiendo de la edad de inicio, como ictericia neonatal o colestasis prolongada e inexplicable, esplenomegalia aislada e inexplicable, y síntomas neurológicos progresivos, a menudo graves, como deterioro cognitivo, ataxia cerebelosa, parálisis de la mirada supranuclear vertical (PSVG), disartria, disfagia, distonía, convulsiones, cataplexia gelástica y trastornos psiquiátricos.

CLINICAL DESCRIPTION

La MPS2S se presenta con el espectro de síntomas observados en todos los casos de MSP2 (véase este término), a menudo con una presentación más temprana. Los pacientes con MPS2S presentan una disminución de la tasa de crecimiento a principios o mediados de la infancia, junto con dificultades respiratorias y un engrosamiento de los labios y las fosas nasales, así como una lengua agrandada y protuberante (facies distintiva), que puede hacerse evidente entre los 2 y los 4 años de edad. Los hitos psicomotores se retrasan y a menudo se produce una regresión. Entre los 2 y los 6 años, los pacientes empiezan a mostrar un comportamiento agresivo e hiperactivo, y a menudo carecen de sentido del peligro mientras siguen un curso de deterioro cognitivo progresivo. La visión puede verse afectada, y en la mayoría de los casos se produce una pérdida progresiva de la audición. Son frecuentes el engrosamiento del miocardio y la disfunción de las válvulas cardíacas. Aproximadamente el 60-80% de los pacientes con MPS2 tienen la forma grave de la enfermedad con implicaciones neurológicas.

VARIANTS

NM_000202.7(IDS):c.1505G>C ; c.278del ; NM_000202.7(IDS):c.317_318insTCAA ; NM_000202.6:c.388_389insG ; NM_000202.7(IDS):c.1122C>T ; NM_000202.7(IDS):c.597del ; NM_000202.7(IDS):c.208dupC ; NM_000202.7(IDS):c.1148delC ; NM_000202.7(IDS):c.514C>T ; NM_000202.7(IDS):c.690_691insT ; c.240+1G>A ; NM_000202.7(IDS):c.404A>G ; c.596_599del ; NM_000202.7(IDS):c.1508T>A ; NM_000202.7(IDS):c.998C>T ; NM_000202.7(IDS):c.587T>C

GENE

IL2RG

DISEASES
Síndrome de Omenn
SUMMARY

El síndrome de Omenn (OS) es una enfermedad inflamatoria caracterizada por eritrodermia, descamación, alopecia, diarrea crónica, retraso en el desarrollo, linfadenopatía y hepatoesplenomegalia, asociada a una inmunodeficiencia combinada grave (SCID; véase este término).

CLINICAL DESCRIPTION

El OS se presenta durante el primer año de vida con características de SCID, incluyendo diarrea crónica, neumonitis y retraso en el crecimiento. Además, los pacientes presentan síntomas inflamatorios que incluyen linfadenopatía, hepatoesplenomegalia y eritrodermia generalizada, que a menudo puede causar alopecia y pérdida de cejas y pestañas; la pérdida de proteínas puede provocar edema generalizado y alteraciones metabólicas. Los signos y síntomas del OS pueden evolucionar con el tiempo y pueden no aparecer simultáneamente. Algunos pacientes presentan algunos de estos síntomas, pero no todos, y pueden describirse como síndrome de Omenn atípico. El OS también puede estar asociado a trastornos sindrómicos, como la hipoplasia cartilaginosa (CHH), la deficiencia de adenosina deaminasa (ADA), la monosomía 22q11, el coloboma ocular, el síndrome CHARGE y la deficiencia de ligasa 4 (consulte estos términos).

Inmunodeficiencia combinada grave T-B+ por deficiencia de la cadena gamma
SUMMARY

La IDCG-X1 se manifiesta durante los primeros meses de vida con infecciones víricas, bacterianas o fúngicas graves y, a menudo, potencialmente mortales (por ejemplo, neumonitis por Pneumocystis jiroveci, infección por BCG diseminada si se ha vacunado previamente), y retraso en el desarrollo. La diarrea crónica es un hallazgo frecuente. Algunos pacientes pueden presentar erupciones cutáneas y anomalías de la función hepática. La enfermedad de injerto contra huésped asociada a la transfusión materno-fetal también se asocia a la enfermedad. Los hallazgos inmunológicos son linfopenia con ausencia de células T y NK, hipogammaglobulinemia y recuento normal o aumentado de células B.

CLINICAL DESCRIPTION

La IDCG-X1 se manifiesta durante los primeros meses de vida con infecciones víricas, bacterianas o fúngicas graves y, a menudo, potencialmente mortales (por ejemplo, neumonitis por Pneumocystis jiroveci, infección por BCG diseminada si se ha vacunado previamente), y retraso en el desarrollo. La diarrea crónica es un hallazgo frecuente. Algunos pacientes pueden presentar erupciones cutáneas y anomalías de la función hepática. La enfermedad de injerto contra huésped asociada a la transfusión materno-fetal también se asocia a la enfermedad. Los hallazgos inmunológicos son linfopenia con ausencia de células T y NK, hipogammaglobulinemia y recuento normal o aumentado de células B.

VARIANTS

NM_000206.2(IL2RG):c.341G>A ; NM_000206.2(IL2RG):c.355A>T ; NM_000206.2(IL2RG):c.452T>C ; NM_000206.2(IL2RG):c.854G>A ; NM_000206.2(IL2RG):c.664C>T ; NM_000206.2(IL2RG):c.454+1G>A ; NM_000206.2(IL2RG):c.343T>C ; NM_000206.2(IL2RG):c.186T>A

GENE

MECP2

DISEASES
Síndrome de Rett atípico
SUMMARY

Es un trastorno neurológico genético poco frecuente que se caracteriza por la presencia de dos o más de los criterios principales del síndrome de Rett clásico (pérdida de las habilidades adquiridas con las manos, pérdida del lenguaje hablado adquirido, anomalías de la marcha, movimientos estereotipados de las manos), un periodo de regresión seguido de recuperación o estabilización, y cinco de los once criterios de apoyo (dificultades respiratorias, bruxismo, alteración del patrón de sueño, tono muscular anormal, alteraciones vasomotoras periféricas, escoliosis/cifosis, retraso en el crecimiento, manos y pies pequeños y fríos, risas o gritos inapropiados, disminución de la sensación de dolor y comunicación ocular intensa). Al igual que el síndrome de Rett clásico, afecta casi exclusivamente a las niñas, mientras que el curso de la enfermedad puede ser más leve o más grave.

CLINICAL DESCRIPTION

Las formas atípicas pueden presentar un cuadro clínico más leve o más grave que el observado en el RTT típico. Se han definido varias subvariantes del RTT atípico. i) El tipo de convulsiones de inicio temprano (variante Hanefeld) se caracteriza por convulsiones en los primeros meses de vida con el posterior desarrollo de rasgos de RTT. ii) La variante congénita (variante Rolando) es la forma más grave de RTT atípico, con inicio de rasgos de RTT clásicos durante los tres primeros meses de vida. iii) La "forme fruste" es una variante más leve con inicio en la primera infancia y un curso incompleto y prolongado. iv) La forma de regresión en la última infancia se caracteriza por un perímetro cefálico normal y por una regresión más gradual y de inicio más tardío (en la última infancia) de las habilidades lingüísticas y motoras. v) La variante de habla preservada (variante PSD o Zappella) se caracteriza por la recuperación de algunas habilidades verbales y manuales.

NO RARA EN EUROPA: Autismo
SUMMARY

CLINICAL DESCRIPTION

El autismo, el trastorno generalizado del desarrollo (TGD) prototípico, suele manifestarse a los 3 años de edad. Se caracteriza por una tríada de comunicación verbal limitada o ausente, una falta de interacción social recíproca o de capacidad de respuesta, y patrones de intereses y comportamiento restringidos, estereotipados y ritualizados. El "trastorno del espectro autista", a veces denominado TEA, es un fenotipo más amplio que engloba los trastornos menos graves del síndrome de Asperger y el trastorno generalizado del desarrollo no especificado (TGD-NOS). El "fenotipo amplio del autismo" incluye a los individuos con algunos síntomas de autismo, pero que no cumplen todos los criterios para el autismo u otros trastornos. El retraso mental coexiste en aproximadamente dos tercios de los individuos con TEA, excepto en el caso del síndrome de Asperger, en el que el retraso mental está visiblemente ausente. Los estudios genéticos sobre el autismo suelen incluir a miembros de la familia con estos diagnósticos menos estrictos. 

Síndrome de Rett
SUMMARY

Trastorno grave y poco frecuente del neurodesarrollo ligado al cromosoma X, caracterizado por una rápida regresión del desarrollo en la infancia, pérdida parcial o completa de los movimientos intencionados de las manos, pérdida del habla, anomalías en la marcha y movimientos estereotipados de las manos, comúnmente asociados a una desaceleración del crecimiento de la cabeza, discapacidad intelectual grave, convulsiones y anomalías respiratorias. El trastorno tiene un curso clínico progresivo y puede asociar diversas comorbilidades, como enfermedades gastrointestinales, escoliosis y trastornos del comportamiento.

CLINICAL DESCRIPTION

El síndrome de Rett clásico o típico (RTT) afecta principalmente a las niñas y se caracteriza por un desarrollo psicomotor aparentemente normal durante los primeros 6-18 meses de vida, seguido de un estancamiento del desarrollo con una rápida regresión de las capacidades lingüísticas y motoras, y un posterior estancamiento a largo plazo de las habilidades. Los movimientos repetitivos y estereotipados de las manos sustituyen al uso intencionado de las mismas. Otros hallazgos incluyen rasgos autistas, ataques de pánico, bruxismo, apnea y/o hiperpnea episódica, ataxia y apraxia de la marcha, temblores, convulsiones (60-80%) y microcefalia adquirida. Existe una amplia variabilidad en la tasa de progresión de la enfermedad y en su gravedad. Se han descrito varios varones con un fenotipo comparable al de las mujeres con RTT clásico.

Encefalopatía neonatal grave con microcefalia
SUMMARY

La encefalopatía grave de inicio neonatal con microcefalia es una enfermedad monogénica rara con epilepsia caracterizada por encefalopatía de inicio neonatal, microcefalia, retraso grave del desarrollo o ausencia del mismo, anomalías respiratorias (incluyendo hipoventilación central y/o insuficiencia respiratoria), convulsiones intratables, tono muscular anormal y movimientos involuntarios. La muerte temprana es habitual.

CLINICAL DESCRIPTION

El gen MECP2 está mutado en el síndrome de Rett (RTT), un grave trastorno del neurodesarrollo que casi siempre se da en las mujeres. Aunque al principio se pensó que las mutaciones de MECP2 que causaban el síndrome de Rett eran letales en los varones, informes posteriores identificaron una encefalopatía neonatal grave en los hermanos varones supervivientes de pacientes con síndrome de Rett.

Lupus eritematoso sistémico
SUMMARY

El lupus eritematoso sistémico (LES) es una enfermedad autoinmune compleja caracterizada por la producción de autoanticuerpos contra moléculas nucleares, citoplasmáticas y de superficie celular que trascienden los límites específicos de los órganos. El depósito tisular de anticuerpos o complejos inmunes induce la inflamación y la posterior lesión de múltiples órganos y finalmente da lugar a las manifestaciones clínicas del LES, como glomerulonefritis, dermatitis, trombosis, vasculitis, convulsiones y artritis.

CLINICAL DESCRIPTION

Trisomía Xq28
SUMMARY

Las duplicaciones Xq distales se refieren a los trastornos cromosómicos resultantes de la afectación del brazo largo del cromosoma X (Xq). Las manifestaciones clínicas varían mucho en función del sexo del paciente y del contenido génico del segmento duplicado. La prevalencia de las duplicaciones Xq sigue siendo desconocida.

CLINICAL DESCRIPTION

Las duplicaciones distales más frecuentes implican el segmento Xq28 y dan lugar a un fenotipo reconocible que incluye rasgos faciales distintivos (cierre prematuro de las fontanelas o una sutura metópica estriada, una cara ancha con mejillas llenas, pliegues epicánticos, orejas grandes, una boca pequeña y abierta, anomalías en las orejas, una nariz puntiaguda, un paladar anormal e hipotonía facial), hipotonía axial importante, retraso grave del desarrollo, dificultades graves de alimentación, genitales anormales y susceptibilidad a las infecciones.

Síndrome de discapacidad intelectual-psicosis-macroorquidismo ligado al X
SUMMARY

Se trata de una discapacidad intelectual sindrómica ligada al cromosoma X que se caracteriza por un retraso en el desarrollo, un grado variable de discapacidad intelectual, retraso en el habla o ausencia de ésta, signos piramidales, temblor, macroorquidismo y problemas variables de humor y comportamiento, incluyendo psicosis y comportamientos de tipo autista. Los varones están afectados predominantemente, algunas mujeres muestran capacidades cognitivas inferiores.

CLINICAL DESCRIPTION

El gen MECP2 está mutado en el síndrome de Rett (RTT), un grave trastorno del neurodesarrollo que casi siempre se da en las mujeres. Los varones con mutaciones no asociadas a RTT en el gen MECP2 pueden mostrar una amplia variedad de fenotipos, incluyendo el retraso mental ligado al cromosoma X con espasticidad y otras características variables, descrito aquí, y el síndrome de retraso mental ligado al cromosoma X de Lubs (MRXSL). Los varones con mutaciones de MECP2 asociadas a RTT presentan una encefalopatía neonatal grave que suele ser letal (300673).

Discapacidad intelectual no sindrómica ligada al X
SUMMARY

El síndrome de duplicación de MECP2 es un trastorno del neurodesarrollo ligado al cromosoma X que se caracteriza por un retraso mental de severo a profundo, hipotonía infantil, rasgos dismórficos leves, escaso desarrollo del habla, rasgos autistas, convulsiones, espasticidad progresiva e infecciones recurrentes. Sólo afecta a los varones, aunque las mujeres portadoras pueden presentar algunos rasgos neuropsiquiátricos leves, como ansiedad. Las duplicaciones submicroscópicas de Xq28 que engloban a MECP2 se consideran eventos no recurrentes, porque las ubicaciones de los puntos de rotura y los tamaños de los reordenamientos varían entre los individuos afectados.

CLINICAL DESCRIPTION

VARIANTS

NM_004992.3(MECP2):c.964C>T ; NM_004992.3(MECP2):c.916C>T ; NM_004992.3(MECP2):c.215dupC ; NM_004992.3(MECP2):c.611C>G ; NM_004992.3(MECP2):c.502C>T ; NM_004992.3(MECP2):c.763C>T ; NM_004992.3(MECP2):c.730C>T ; NM_004992.3(MECP2):c.965C>T ; NM_004992.3(MECP2):c.674C>T ; NM_001110792.1(MECP2):c.916C>T ; NM_004992.3(MECP2):c.806delG ; NM_004992.3(MECP2):c.808C>T ; NM_004992.3(MECP2):c.753delC

GENE

MTM1

DISEASES
Miopatía centronuclear ligada al X
SUMMARY

Una rara miopatía congénita ligada al cromosoma X caracterizada por numerosos núcleos situados en el centro en la biopsia muscular y que se presenta al nacer con una marcada debilidad, hipotonía e insuficiencia respiratoria.

CLINICAL DESCRIPTION

La enfermedad se caracteriza por un fenotipo grave en los varones que se presentan al nacer con una marcada debilidad, hipotonía e insuficiencia respiratoria. Los signos de aparición prenatal son frecuentes y comprenden movimientos fetales reducidos y polihidramnios. En las radiografías de tórax del recién nacido se observa un adelgazamiento de las costillas. La asfixia al nacer puede ser la característica de presentación. Son frecuentes los antecedentes familiares de muertes neonatales masculinas o de abortos. Los bebés afectados suelen ser macrosómicos, con una longitud corporal superior al percentil 90 y un gran perímetro cefálico. La oftalmoplejía externa suele estar asociada. Los testículos no suelen descender. En algunos supervivientes a largo plazo se ha observado estenosis pilórica y hemangiomas cavernosos del hígado.

Miopatía miotubular ligada al cromosoma X - síndrome de genitales anormales
SUMMARY

La forma sintomática de la hemocromatosis de tipo 1 es una hemocromatosis hereditaria poco frecuente que se caracteriza por una absorción de hierro intestinal regulada de forma inadecuada, lo que conduce a un almacenamiento excesivo de hierro en varios órganos y se manifiesta con una amplia gama de signos y síntomas, como dolor abdominal, debilidad, letargo, pérdida de peso, niveles elevados de aminotransferasa sérica, aumento de la pigmentación de la piel y/o artropatía en las articulaciones metacarpofalángicas. Otras manifestaciones comúnmente asociadas incluyen hepatomegalia, cirrosis, fibrosis hepática, carcinoma hepatocelular, cardiomiopatía restrictiva y/o diabetes mellitus.

CLINICAL DESCRIPTION

Son frecuentes la diplejía facial y a menudo la oftalmoplejía externa. Los casos de recién nacidos se asemejan a los de la distrofia miotónica congénita; la distinción puede hacerse mediante el examen de su madre que, en esta última situación, mostrará invariablemente una leve debilidad facial y una miotonía clínica o eléctrica. El polihidramnios es una característica de ambas formas de miopatía congénita, es decir, la distrofia miotónica y la miopatía miotubular ligada al cromosoma X. 

VARIANTS

NM_000252.2(MTM1):c.1261-10A>G ; NM_000252.2(MTM1):c.969del ; c.461T>G ; NM_000252.2(MTM1):c.70C>T ; c.780T>A ; NM_000252.2(MTM1):c.595_599delCCTGC ; NM_000252.2(MTM1):c.1306_1310dupCCTAT ; NM_000252.2(MTM1):c.670C>T ; NM_000252.2(MTM1):c.721C>T ; NM_000252.2(MTM1):c.969dup ; NM_000252.2(MTM1):c.1357_1358delCC ; NM_000252.2(MTM1):c.1415_1416delGT ; NM_000252.2(MTM1):c.420C>G

GENE

NR0B1

DISEASES
Trastorno del desarrollo sexual testicular 46,XX
SUMMARY

Trastorno raro del desarrollo sexual (DSD) asociado a un cariotipo 46, XX y caracterizado por genitales externos masculinos, que van de normales a atípicos con deficiencia de testosterona asociada.

CLINICAL DESCRIPTION

El fenotipo clínico es variable, con características que incluyen: genitales externos masculinos normales a atípicos, testículos no descendidos con ausencia de estructuras müllerianas e infertilidad. La presentación depende de la presencia del gen SRY (región determinante del sexo del cromosoma Y). Los casos SRY positivos (80-90%) suelen ser hombres normales que se presentan después de la pubertad con estatura baja, vello púbico y tamaño del pene normales, pero testículos pequeños, ginecomastia y esterilidad relacionada con la azoospermia. También se han descrito testículos no descendidos e hipospadias. Por lo general, no hay preocupaciones sobre el papel y la identidad de género. Los individuos con SRY negativo (10-20%) suelen presentar al nacer características como hipospadias penoscrotal y testículos no descendidos. Las complicaciones a largo plazo debidas al hipogonadismo masculino incluyen: baja libido, disfunción eréctil, disminución de los caracteres sexuales secundarios, osteopenia y depresión.

Disgenesia gonadal completa 46,XY
SUMMARY

Trastorno raro del desarrollo sexual (DSD) asociado a anomalías en el desarrollo gonadal que dan lugar a la presencia de genitales externos e internos femeninos a pesar del cariotipo 46,XY.

CLINICAL DESCRIPTION

Las pacientes se presentan durante la adolescencia o al principio de la edad adulta con genitales externos femeninos normales, pero carecen de desarrollo puberal, aunque la adrenarquia es normal. Las gónadas en forma de raya no están completamente desarrolladas y se asocian a un mayor riesgo de tumores abdominales (más comúnmente disgerminoma; véase este término), que pueden ser la característica de presentación en algunos casos. La estatura es normal o superior a la normal, y no hay rasgos del síndrome de Turner (véase este término).

Disgenesia gonadal parcial 46,XY
SUMMARY

La disgenesia gonadal parcial 46,XY (PGD 46,XY) es un trastorno del desarrollo sexual (DSD) asociado a anomalías en el desarrollo gonadal que da lugar a una ambigüedad genital de grado variable que va desde un fenotipo casi femenino hasta un fenotipo casi masculino en un paciente portador de un cariotipo 46,XY masculino.

CLINICAL DESCRIPTION

El PGD 46,XY se caracteriza por genitales externos ambiguos con o sin estructuras müllerianas. El grado de ambigüedad genital varía a lo largo de un espectro, que va desde un fenotipo casi femenino con clitoromegalia en un extremo hasta un fenotipo casi masculino con hipospadias aislado en el otro. Muchos pacientes presentan genitales ambiguos o micropene severo asociado a una regresión completa del tejido testicular en uno o ambos lados. El síndrome de regresión testicular embrionaria (ETRS; véase este término) se considera parte del espectro clínico del DGP. Dependiendo de la mutación, los pacientes pueden presentar insuficiencia suprarrenal o afectación renal (es decir, tumores de Wilms o síndrome nefrótico). Los gonadoblastomas o los tumores de células germinales invasivos se producen en alrededor del 20-30% de los pacientes.

Hipoplasia suprarrenal congénita ligada al X
SUMMARY

Una rara enfermedad suprarrenal genética caracterizada por una insuficiencia suprarrenal primaria (IA) y/o hipogonadismo hipogonadotrópico (HH). Los pacientes varones suelen presentar IA con un inicio agudo en la infancia o un inicio insidioso en la niñez. Las características clínicas de la IA incluyen hiperpigmentación, vómitos, mala alimentación, retraso en el desarrollo, convulsiones, colapso vascular y, en ocasiones, muerte súbita. El HH se manifiesta más tarde como un retraso o detención de la pubertad. En raras ocasiones, los pacientes se vuelven sintomáticos en la edad adulta temprana con IA de inicio tardío, HH parcial y/o infertilidad. Histológicamente, las glándulas suprarrenales carecen de la zona cortical adulta permanente. Las células restantes son más grandes que las células suprarrenales fetales (''citomegálicas'') y contienen inclusiones nucleares características.

CLINICAL DESCRIPTION

La hipoplasia suprarrenal congénita (AHC) es un trastorno raro que puede heredarse con un patrón ligado al cromosoma X o autosómico recesivo. En la AHC ligada al cromosoma X, se produce una insuficiencia suprarrenal primaria porque las glándulas suprarrenales carecen de la zona cortical adulta permanente. Las células restantes se denominan "citomegálicas" porque son más grandes que las células suprarrenales fetales típicas. Los pacientes con AHC suelen presentarse en la primera infancia con insuficiencia suprarrenal primaria. El hipogonadismo hipogonadotrópico (HHG) es una característica distintiva del trastorno, y se reconoce durante la adolescencia debido a la ausencia o interrupción del desarrollo puberal normal. También se ha observado una espermatogénesis anormal en estos pacientes. Se han descrito formas más leves de la enfermedad, con insuficiencia suprarrenal que a veces se presenta en la infancia o incluso en la edad adulta temprana.

VARIANTS

NM_000475.4(NR0B1):c.788T>A ; NM_000475.4(NR0B1):c.704G>A ; NM_000475.4(NR0B1):c.591C>A ; NM_000475.4(NR0B1):c.847C>T ; NM_000475.4(NR0B1):c.513G>A ; NM_000475.4(NR0B1):c.873G>C ; c.388_389del ; NM_000475.4(NR0B1):c.813C>G ; NM_000475.4(NR0B1):c.1319A>T ; NM_000475.4(NR0B1):c.1316T>G ; NM_000475.4(NR0B1):c.800G>C ; NM_000475.4(NR0B1):c.1107G>A ; NM_000475.4(NR0B1):c.890T>C ; NM_000475.4(NR0B1):c.273C>A

GENE

OCRL

DISEASES
Enfermedad de Dent tipo 2
SUMMARY

La enfermedad de Dent tipo 2 es un tipo de enfermedad de Dent en la que los pacientes tienen las manifestaciones de la enfermedad de Dent tipo 1 asociadas a características extrarrenales.

CLINICAL DESCRIPTION

Todos ellos presentaban hipercalciuria y proteinuria de bajo peso molecular (BPM). Además, estos pacientes pueden presentar también nefrocalcinosis, nefrolitiasis, hematuria, hipofosfatemia y/o insuficiencia renal. Se ha observado que sólo una minoría (aproximadamente una cuarta parte) de estos pacientes presenta un déficit intelectual leve, hipotonía y cataratas subclínicas. La presencia de déficit intelectual y catarata subclínica eran tan leves que disuadieron a los clínicos de considerar el diagnóstico de síndrome de Lowe (véase este término), que se caracteriza por cataratas congénitas, retraso en los hitos motores, cierto grado de deterioro intelectual en casi todos los varones afectados, retraso en el crecimiento, raquitismo y tubulopatía proximal renal. Además, los pacientes con la enfermedad de Dent tipo 2 y un déficit intelectual leve eran adultos que, con el tiempo, no habían desarrollado características más manifiestas del síndrome de Lowe.

Síndrome oculocerebrorenal de Lowe
SUMMARY

Un raro trastorno multisistémico caracterizado por cataratas congénitas, glaucoma, discapacidad intelectual, convulsiones, retraso del crecimiento postnatal y disfunción tubular renal con insuficiencia renal crónica.

CLINICAL DESCRIPTION

El síndrome oculocerebrorrenal de Lowe (OCRL) es un trastorno congénito caracterizado por anomalías oculares (cataratas discoides congénitas bilaterales, glaucoma con o sin buftalmos, estrabismo, hipermetropía y queloides corneales y conjuntivales), afectación neurológica (retraso del desarrollo, convulsiones, hipotonía presente al nacer, normalmente con ausencia de reflejos tendinosos profundos), comportamiento estereotípico (rabietas, agresividad y comportamiento obsesivo compulsivo), retraso del crecimiento postnatal, discapacidad intelectual de leve a grave (coeficiente intelectual medio de 40-50), movimientos estereotípicos de las manos, disfunción renal de tipo Fanconi (acidosis tubular proximal; pérdida de fosfato que conduce al raquitismo renal, osteomalacia y fracturas patológicas) y disminución progresiva de la función renal que conduce a la insuficiencia renal terminal en la edad adulta. Las cataratas sutiles son hallazgos obligatorios en las mujeres portadoras después de la pubertad. Otras manifestaciones clínicas son el dismorfismo facial (protuberancia frontal, ojos hundidos, mejillas regordetas, tez clara), la tenosinovitis destructiva en pacientes de edad avanzada, la baja estatura, las anomalías mucocutáneas (quistes vellosos eruptivos, tricoepitiloma, exceso de pliegues cutáneos y quistes eruptivos en la cavidad oral), las malformaciones dentales, la criptorquidia y la tendencia a las hemorragias por disfunción plaquetaria.

VARIANTS

NM_000276.3(OCRL):c.2530C>T ; NM_000276.3(OCRL):c.1499G>A ; c.2379dup ; c.2511del ; NM_000276.3(OCRL):c.909_910delAG ; NM_000276.3(OCRL):c.2299C>T

GENE

OTC

DISEASES
Deficiencia de ornitina transcarbamilasa
SUMMARY

Trastorno genético poco frecuente del metabolismo del ciclo de la urea y de la desintoxicación del amoníaco, que se caracteriza por una enfermedad grave de aparición neonatal, principalmente en varones, o por formas de aparición posterior (parcial) de la enfermedad. Ambas presentan episodios de hiperamonemia que pueden ser mortales y que pueden provocar secuelas neurológicas.

CLINICAL DESCRIPTION

Los varones con el tipo grave de inicio neonatal son normales al nacer, pero desarrollan una mala succión, hipotonía y letargo al cabo de unos días, progresando rápidamente hacia la somnolencia y el coma. También puede haber convulsiones e hiperventilación. Si no se trata, se desarrollará una encefalopatía grave con un alto riesgo de muerte. Los pacientes con una forma más leve pueden presentarse a cualquier edad. En los bebés, los síntomas pueden ser inducidos al cambiar de la leche materna a la leche entera. En los niños y los adultos, los factores de estrés ambiental (es decir, el ayuno, la dieta rica en proteínas, el embarazo y el período posparto, las enfermedades intercurrentes, la cirugía) pueden desencadenar episodios de encefalopatía hiperamonémica junto con náuseas, vómitos, dolores de cabeza, comportamiento errático, delirio y combatividad. Estos episodios también pueden provocar un coma hiperamonémico. Las complicaciones neurológicas del coma hiperamonémico incluyen un retraso en el desarrollo y, en ocasiones, un deterioro cognitivo grave. Muchas mujeres portadoras son asintomáticas; sin embargo, pueden verse afectadas en la misma medida que los hombres si el grado de inactivación del alelo de la enfermedad en el cromosoma X es desfavorable. La coagulopatía es un hallazgo frecuente durante la descompensación metabólica y a veces evoluciona hacia una insuficiencia hepática aguda.

VARIANTS

NM_000531.5(OTC):c.238A>G ; NM_000531.5(OTC):c.460G>T ; NM_000531.5(OTC):c.275G>A ; NM_000531.5(OTC):c.674C>T ; NM_000531.5(OTC):c.118C>T ; NM_000531.5(OTC):c.259G>A ; NM_000531.5(OTC):c.148G>T ; NM_000531.5(OTC):c.119G>A ; NM_000531.5(OTC):c.245T>G ; NM_000531.5(OTC):c.563G>T ; NM_000531.5(OTC):c.332T>C ; NM_000531.5(OTC):c.617T>G ; NM_000531.5(OTC):c.77G>A ; NM_000531.5(OTC):c.646C>G ; NM_000531.5(OTC):c.134T>C ; NM_000531.5(OTC):c.829C>T ; NM_000531.5(OTC):c.421C>T ; NM_000531.5(OTC):c.717+2T>C

GENE

PDHA1

DISEASES
Síndrome de Leigh con leucodistrofia
SUMMARY

El síndrome de Leigh es un trastorno clínica y genéticamente heterogéneo que resulta de una generación de energía mitocondrial defectuosa. Suele presentarse como un trastorno neurodegenerativo grave y progresivo que se inicia en los primeros meses o años de vida y puede provocar la muerte prematura. Los individuos afectados suelen mostrar un retraso o regresión global del desarrollo, hipotonía, ataxia, distonía y anomalías oftalmológicas, como nistagmo o atrofia óptica. Los rasgos neurológicos se asocian con los hallazgos clásicos de hiperintensidades ponderadas en T2 en los ganglios basales y/o el tronco cerebral en las imágenes cerebrales. El síndrome de Leigh también puede tener efectos multisistémicos perjudiciales en los órganos cardíacos, hepáticos, gastrointestinales y renales. Los estudios bioquímicos en pacientes con síndrome de Leigh tienden a mostrar un aumento del lactato y anomalías en la fosforilación oxidativa mitocondrial.

CLINICAL DESCRIPTION

Deficiencia de piruvato deshidrogenasa E1-alfa
SUMMARY

Un trastorno que es la forma más frecuente de deficiencia de piruvato deshidrogenasa (PDHD), caracterizado por acidosis láctica variable, deterioro del desarrollo psicomotor, hipotonía y disfunción neurológica.

CLINICAL DESCRIPTION

Los síntomas de la deficiencia de BD suelen aparecer en los primeros meses de vida, pero también se ha informado de su aparición más tardía. Los individuos con una deficiencia profunda no tratada (menos del 10 % de la actividad media normal de la biotinidasa en suero) presentan resultados clínicos variables que incluyen convulsiones, hipotonía, erupción eczematoide, alopecia, ataxia, pérdida de audición, infecciones fúngicas y retraso en el desarrollo. Desde el punto de vista metabólico, los niños no tratados pueden presentar acidosis cetoláctica, acidemia orgánica (-uria) e hiperamonemia leve. Los individuos con BD parcial no tratada (entre el 10% y el 30% de la actividad media normal de la biotinidasa) pueden ser asintomáticos, pero durante períodos de estrés, como una enfermedad, fiebre o ayuno, pueden desarrollar síntomas similares a los de los individuos con BD profunda. Se ha demostrado que múltiples adultos con neuropatía óptica y/o neuropatía periférica, que a menudo se diagnostican erróneamente como esclerosis múltiple, tienen una deficiencia profunda de biotinidasa.

VARIANTS

NM_000284.3(PDHA1):c.773A>C ; NM_000284.3(PDHA1):c.787C>G

GENE

PRPS1

DISEASES
Ataxia letal con sordera y atrofia óptica
SUMMARY

El síndrome de Joubert con defecto hepático es un subtipo muy raro del síndrome de Joubert y trastornos relacionados (JSRD, véase este término) que se caracteriza por los rasgos neurológicos del JS asociados a la fibrosis hepática congénita (FHC).

CLINICAL DESCRIPTION

Otras manifestaciones son la flojera, la susceptibilidad a las infecciones y, más adelante, la tetraplejia flácida y la arreflexia.

Superactividad severa de la fosforibosilpirofosfato sintetasa
SUMMARY

Una forma grave de superactividad de la fosforibosilpirofosfato (PRPP), un trastorno del metabolismo de las purinas ligado al cromosoma X, caracterizado por una hiperuricemia e hiperuricosuria de aparición temprana, y que se manifiesta clínicamente con urolitiasis, gota y anomalías del neurodesarrollo consistentes en combinaciones variables de pérdida auditiva neurosensorial, hipotonía y ataxia.

CLINICAL DESCRIPTION

El fenotipo varía mucho entre los pacientes. La forma grave se manifiesta en la infancia o en los primeros años de la niñez (pero puede ocurrir antes), normalmente con cristaluria de ácido úrico y cálculos urinarios (en el riñón y/o en la vejiga), seguidos por el desarrollo de artritis gotosa y, finalmente, insuficiencia renal como resultado de la uropatía obstructiva por depósito de cristales de ácido úrico. Esta forma también presenta alteraciones neurológicas, principalmente pérdida de audición neurosensorial, hipotonía, ataxia, retraso en el desarrollo y/o discapacidad intelectual. También es posible una neuropatía axonal con desmielinización (notificada en una familia).

Enfermedad de Charcot-Marie-Tooth tipo 5 ligada al X
SUMMARY

La enfermedad de Charcot-Marie-Tooth tipo 5 ligada al cromosoma X es una neuropatía sensoriomotora periférica rara y genética que se caracteriza por un patrón de herencia recesivo ligado al cromosoma X y por la aparición en la infancia y la niñez de: 1) debilidad y atrofia muscular distal progresiva (que aparece primero y es más prominente en las extremidades inferiores que en las superiores) que suele manifestarse con caída de los pies y trastornos de la marcha, 2) pérdida auditiva neurosensorial bilateral y profunda prelingual y 3) neuropatía óptica progresiva. Las mujeres son asintomáticas y no muestran el fenotipo.

CLINICAL DESCRIPTION

La enfermedad de Charcot-Marie-Tooth tipo 5 ligada al cromosoma X es una neuropatía sensoriomotora periférica rara y genética que se caracteriza por un patrón de herencia recesivo ligado al cromosoma X y por la aparición desde la infancia hasta la niñez de: 1) debilidad y atrofia muscular distal progresiva (que aparece primero y es más prominente en las extremidades inferiores que en las superiores) que suele manifestarse con caída de los pies y trastornos de la marcha, 2) pérdida auditiva neurosensorial bilateral y profunda prelingual y 3) neuropatía óptica progresiva. Las mujeres son asintomáticas y no muestran el fenotipo.

Síndrome de discapacidad intelectual ligada al cromosoma X - espasticidad de las extremidades - distrofia de la retina - diabetes insípida
SUMMARY

El síndrome de discapacidad intelectual ligada al cromosoma X, espasticidad de las extremidades, distrofia de la retina y diabetes insípida es una enfermedad genética neurometabólica rara que se caracteriza por una discapacidad intelectual grave, cuadraparesia espástica, amaurosis congénita de Leber y diabetes insípida. Otras manifestaciones incluyen dismorfia facial (cráneo dolicocéfalo, hipertelorismo, ojos hundidos, narinas hipoplásicas, orejas de implantación baja), baja estatura, hipotonía troncal e hipertonía axial. Se han notificado anomalías cerebrales (por ejemplo, cuerpo calloso delgado con falta de istmo y esplenio cónico, hipoplasia o atrofia del quiasma óptico, ventrículos laterales prominentes, materia blanca disminuida), descritas en la resonancia magnética. En el examen rutinario del embarazo se observa una elevada fetoproteína prenatal y una restricción del crecimiento intrauterino.

CLINICAL DESCRIPTION

Sordera neurosensorial no sindrómica ligada al X tipo DFN
SUMMARY

La sordera es la forma más frecuente de déficit sensorial. En la gran mayoría de los casos, la sordera se denomina no sindrómica o aislada y la pérdida de audición es la única anomalía clínica señalada. En los países desarrollados, el 60-80% de los casos de pérdida de audición de inicio temprano son de origen genético.

CLINICAL DESCRIPTION

La mayoría de los casos que se presentan al nacer se refieren a una sordera perceptiva (con un origen neurosensorial asociado al oído interno) más que a una sordera conductiva (anomalías en la amplificación de las ondas sonoras entre el oído medio -tímpano y huesecillos auditivos- y el oído externo). Las formas autosómicas dominantes se caracterizan por una aparición muy temprana y una pérdida de audición bilateral con distintos grados de gravedad (que van de leves a profundos). No se detectan malformaciones del oído interno mediante una tomografía computarizada. Las mutaciones en el gen PDS son responsables del 7% de los casos de sordera infantil. En estos casos, la sordera se caracteriza por una pérdida de audición de inicio temprano, generalmente bilateral (pero a veces asimétrica) con transmisión autosómica recesiva. Esta forma de sordera siempre está asociada a malformaciones del oído interno que pueden detectarse mediante una tomografía computarizada. En casos raros, también puede haber una enfermedad de la glándula tiroides. En el caso de las formas de sordera autosómica dominante, las mutaciones en el gen COCH dan lugar a una sordera postlingual progresiva asociada a ataques graves de vértigo y acúfenos subjetivos. Esta forma de sordera debe distinguirse de la enfermedad de Meniere (véase este término). Las mutaciones autosómicas dominantes en el gen WFS1 causan una forma de pérdida auditiva que afecta principalmente a los sonidos de baja frecuencia o una sordera asociada a la atrofia óptica.

VARIANTS

NM_002764.3(PRPS1):c.193G>A ; NM_002764.3(PRPS1):c.344T>C ; NM_002764.3(PRPS1):c.916G>A ; NM_002764.3(PRPS1):c.398A>C ; NM_002764.3(PRPS1):c.869T>C

GENE

SLC6A8

DISEASES
Deficiencia del transportador de creatina ligada al X
SUMMARY

La deficiencia del transportador de creatina ligada al cromosoma X (CRTR-D) es un síndrome de deficiencia de creatina caracterizado clínicamente por un retraso global del desarrollo/discapacidad intelectual (DD/ID) con un importante retraso en el habla/lenguaje, comportamiento autista y convulsiones.

CLINICAL DESCRIPTION

La aparición de los síntomas se produce durante la infancia, normalmente antes de los 2 años. La enfermedad afecta principalmente a los varones, pero las mujeres también pueden presentar diversas combinaciones y gravedad de las manifestaciones de la enfermedad. La CRTR-D se caracteriza sistemáticamente por un déficit intelectual de leve a grave y un retraso en el habla y el lenguaje expresivos. Los trastornos del comportamiento (principalmente autismo e hiperactividad) están presentes en todos los individuos afectados. Los individuos afectados suelen sufrir convulsiones y pueden presentar un bajo aumento de peso, hipotonía muscular y escasa masa muscular. Se han descrito rasgos dismórficos sutiles como hipoplasia del tercio medio de la cara, cara larga y mentón prominente en varios pacientes varones afectados. Ocasionalmente también pueden aparecer síntomas epilépticos y extrapiramidales. En pacientes adultos, se han notificado trastornos cardíacos y gastrointestinales. Las mujeres portadoras suelen ser asintomáticas, pero en algunas se han descrito problemas de aprendizaje.

VARIANTS

NM_005629.3(SLC6A8):c.1540C>T ; NM_005629.3(SLC6A8):c.1222_1224delTTC ; NM_005629.3(SLC6A8):c.1011C>G ; NM_005629.3(SLC6A8):c.1141G>C ; NM_005629.3(SLC6A8):c.321_323delCTT ; NM_005629.3(SLC6A8):c.395G>T

GENE

SMN1

DISEASES
Atrofia muscular espinal proximal tipo 1
SUMMARY

Una rara atrofia muscular espinal proximal de origen genético, caracterizada por la degeneración de las motoneuronas alfa en las astas anteriores de la médula espinal y el tronco cerebral inferior, que se manifiesta con el inicio de una debilidad muscular grave y progresiva en los primeros 6 meses de vida y que se presenta con hipotonía y debilidad graves y generalizadas. La disfagia y el deterioro respiratorio también pueden estar presentes en el momento de la presentación o aparecer en una fase posterior. Clásicamente, antes de la llegada de las terapias recientes, los pacientes de tipo 1 nunca lograban sentarse sin apoyo.

CLINICAL DESCRIPTION

El inicio de la enfermedad se produce antes de los 6 meses de edad. La debilidad muscular severa y simétrica afecta predominantemente a las extremidades proximales, pero a menudo también afecta a las extremidades. El llanto es débil. Son frecuentes la mala capacidad de succión y la reducción de la deglución, lo que provoca dificultades en la alimentación. Los reflejos tendinosos profundos están ausentes. Los pacientes presentan una respiración paradójica, un tórax en forma de campana y desarrollan una insuficiencia respiratoria. Pueden presentarse contracturas leves (de las rodillas y, más raramente, de los codos) y escoliosis. Clásicamente, los pacientes no podían lograr sentarse sin apoyo, pero esto ha cambiado tras la disponibilidad de nuevos tratamientos.

Atrofia muscular espinal proximal tipo 2
SUMMARY

Atrofia muscular espinal proximal, rara y genética, caracterizada por la degeneración de las motoneuronas alfa en las astas anteriores de la médula espinal y el tronco cerebral inferior, que se manifiesta con un inicio entre los 6 y los 18 meses de edad, con debilidad muscular proximal progresiva, hipotonía de leve a moderada y temblor polimioclónico de los dedos, con arreflexia. Los hitos motrices se limitan clásicamente a la sedestación o la bipedestación independientes.

CLINICAL DESCRIPTION

La aparición de la enfermedad se produce entre los 6 y los 18 meses de edad. Clásicamente, antes de la llegada de las nuevas terapias, los niños afectados consiguen sentarse de forma independiente y pueden adquirir la bipedestación, pero no adquieren la marcha independiente. La debilidad muscular proximal progresiva es simétrica y mayor en las piernas que en los brazos. El temblor de los dedos es frecuente. La escoliosis, las contracturas articulares y las anquilosis de la mandíbula son muy frecuentes. La debilidad muscular respiratoria progresiva puede conducir a una enfermedad pulmonar restrictiva. La cognición es normal.

Atrofia muscular espinal proximal tipo 3
SUMMARY

Atrofia muscular espinal proximal, rara y genética, caracterizada por la degeneración de las motoneuronas alfa en las astas anteriores de la médula espinal y el tronco cerebral inferior, que se manifiesta con la aparición de una debilidad muscular proximal progresiva (piernas mayores que brazos) entre los 18 meses y la edad adulta. El desarrollo motor es heterogéneo pero la marcha es típicamente adquirida.

CLINICAL DESCRIPTION

La enfermedad se manifiesta entre los 18 meses de edad y la edad adulta, y suele presentarse con caídas frecuentes, dificultad para subir escalones y debilidad proximal. Los pacientes se subdividen en función de la edad de aparición: la aparición temprana se produce entre los 18 meses y los 3 años de edad (tipo 3a) y se asocia con una meseta en el desarrollo motor, reflejos reducidos o ausentes, temblor polimioclónico de los dedos y, con frecuencia, pérdida de la deambulación antes o alrededor de la pubertad. La aparición más tardía (tipo 3b), entre los 3 y los 21 años de edad, se asocia con un deterioro comparativamente más leve de la función motora gruesa. La debilidad muscular afecta predominantemente a las piernas y a los músculos de la cadera y luego progresa hacia los hombros y los brazos. Es habitual que se produzcan anomalías en la marcha para compensar la debilidad. Normalmente, los pacientes no padecen escoliosis ni debilidad muscular respiratoria, pero éstas pueden ser una característica tras la pérdida de la deambulación. La cognición es normal.

Atrofia muscular espinal proximal tipo 4
SUMMARY

Atrofia muscular espinal proximal, rara y genética, caracterizada por la degeneración de las motoneuronas alfa en las astas anteriores de la médula espinal y el tronco cerebral inferior, que se manifiesta con una debilidad muscular proximal leve, lentamente progresiva, de inicio en la edad adulta.

CLINICAL DESCRIPTION

La enfermedad suele aparecer en la segunda o tercera década de la vida. La debilidad muscular afecta predominantemente a las piernas y a los músculos de la cadera y luego progresa hacia los hombros y los brazos. Es frecuente la marcha de pato. Puede haber temblor de dedos, fasciculación e hipertrofia de pantorrillas. El cuadro clínico es similar al de la AME tipo 3, pero la debilidad motora es menos grave. La cognición no se ve afectada.

VARIANTS

functional copy number loss

GENE

WAS

DISEASES
Síndrome de Wiskott-Aldrich
SUMMARY

El xeroderma pigmentoso (XP) es una genodermatosis rara que se caracteriza por una extrema sensibilidad a los cambios inducidos por los rayos ultravioleta (UV) en la piel y los ojos, y por múltiples cánceres de piel. Se subdivide en 8 grupos de complementación, según el gen afectado: XP clásico (XPA a XPG) y XP variante (XPV) (ver estos términos).

CLINICAL DESCRIPTION

El WAS suele manifestarse en la infancia, pero también puede aparecer durante el periodo neonatal. En la mayoría de los casos las primeras características clínicas son manifestaciones hemorrágicas con petequias, hematomas, púrpura, epistaxis, hemorragia oral, diarrea con sangre y hemorragia intracraneal. El eczema agudo o crónico es el segundo hallazgo característico del WAS. Debido a la inmunodeficiencia combinada, la mayoría de los pacientes presentan también infecciones de las vías respiratorias, intestinales o cutáneas causadas por gérmenes habituales u oportunistas. Las manifestaciones autoinmunes se observan en aproximadamente el 40% de los casos e incluyen anemia hemolítica autoinmune, neutropenia, vasculitis, enfermedad inflamatoria intestinal, enfermedad renal y artritis. Los pacientes con WAS tienen un mayor riesgo de desarrollar tumores (principalmente linfomas de células B) a cualquier edad.

Neutropenia congénita grave ligada al X
SUMMARY

La neutropenia congénita grave ligada al cromosoma X es un síndrome de inmunodeficiencia caracterizado por infecciones bacterianas graves recurrentes, neutropenia congénita grave y monocitopenia. Se ha descrito en cinco varones que abarcan tres generaciones de una familia. Se transmite como un rasgo recesivo ligado al cromosoma X y está causado por mutaciones en el gen WAS, que codifica la proteína WASP.

CLINICAL DESCRIPTION

Síndrome de inmunodeficiencia ligado al cromosoma X, caracterizado por infecciones bacterianas graves recurrentes, neutropenia congénita grave y monocitopenia. Aunque la herencia ligada al cromosoma X y los cambios en los subconjuntos de linfocitos no se conocían como características de la neutropenia congénita grave, los varones afectados en este pedigrí tenían un mayor número de linfocitos T CD8+ activados en la sangre periférica, lo que daba lugar a una disminución de la relación CD4+/CD8+ de 0,5 o menos. Los niveles de inmunoglobulina y la activación de los linfocitos T eran normales. Las plaquetas no estaban disminuidas y no había antecedentes de eczema en los individuos afectados. El examen de la médula ósea demostró una detención de la maduración en el estadio de promielocitos/mielocitos, sin anomalías graves en la megacariopoyesis o la eritropoyesis.

Trombocitopenia ligada al X con plaquetas normales
SUMMARY

La tirosinemia tipo 1 (HTI) es un error congénito del catabolismo de la tirosina causado por una actividad defectuosa de la fumarilacetoacetato hidrolasa (FAH) y se caracteriza por una enfermedad hepática progresiva, disfunción tubular renal, crisis similares a la porfiria y una mejora espectacular del pronóstico tras el tratamiento con nitisinona.

CLINICAL DESCRIPTION

VARIANTS

NM_000377.2(WAS):c.814T>C ; NM_000377.2(WAS):c.173C>G ; NM_000377.2(WAS):c.881T>C ; NM_000377.2(WAS):c.1442T>A ; NM_000377.2(WAS):c.134C>T ; NM_000377.2(WAS):c.809T>C

GENE

FMR1

DISEASES
Síndrome de X frágil
SUMMARY

Es una enfermedad de origen genético poco frecuente que cursa con discapacidad intelectual de leve a grave, pudiendo asociar trastornos de conducta y rasgos físicos característicos incluyendo frente ancha, orejas prominentes y grandes, hiperextensibilidad de las articulaciones de los dedos de las manos, pies planos con pronación y, en varones adolescentes y adultos, macroorquidia.

CLINICAL DESCRIPTION

El síndrome de X frágil (SXF) se presenta con un fenotipo clínico variable. En varones, la enfermedad debuta durante la infancia, con retraso de los hitos del desarrollo motor. La discapacidad intelectual puede presentar una gravedad variable, pudiendo incluir afectación de la memoria de trabajo y a corto plazo, del funcionamiento ejecutivo, del lenguaje y de las habilidades visuoespaciales o numéricas. Los trastornos de la conducta pueden ser leves (como ansiedad o humor inestable) o graves (como agresividad o autismo). El comportamiento de tipo autista puede incluir aleteo de las manos, contacto visual reducido, morderse las manos, evitación de la mirada, fobia social, dificultades comunicativas y sociales, y defensa táctil. En mujeres, los trastornos intelectuales y de conducta suelen ser leves, consistiendo, por lo general, en timidez, ansiedad social y problemas de aprendizaje leves con un CI normal, aunque el 25% de las mujeres afectadas presenta un CI inferior a 70. El trastorno por déficit de atención con hiperactividad (TDAH) está presente en más del 89% de los varones y del 30% de las mujeres, y la desinhibición conductual es muy frecuente. También se puede observar otitis recurrentes (60%) y crisis epilépticas (16-20%).

Síndrome de ataxia/temblor asociado al X frágil
SUMMARY

El síndrome de temblor/ataxia asociado a X frágil (FXTAS) es un trastorno neurodegenerativo que se caracteriza por un temblor intencional y ataxia de la marcha progresivos de aparición tardía.

CLINICAL DESCRIPTION

La edad de aparición del temblor y/o de la ataxia en varones ronda los 60 años. La presentación clínica es heterogénea, con manifestaciones dominantes variables que incluyen: temblor intencional, marcha atáxica cerebelosa progresiva, disfunción ejecutiva frontal, deterioro cognitivo, neuropatía periférica, y disautonomía. Entre otros signos se incluyen parkinsonismo leve y manifestaciones psiquiátricas (depresión, ansiedad, agitación) con una posible progresión a demencia. Las mujeres portadoras tienen generalmente manifestaciones menos graves que los varones, pero también tienen un riesgo incrementado de fallo ovárico primario, dolor muscular crónico, e hipotiroidismo.

Forma sintomática del síndrome de X frágil en mujeres portadoras
SUMMARY

Enfermedad genética rara que se caracteriza por un fenotipo clínico variable que incluye rasgos similares pero que suele ser menos grave que en los varones afectados. Los pacientes pueden presentar una discapacidad intelectual de leve a límite, ansiedad, fobia social, mutismo selectivo, trastorno por déficit de atención e hiperactividad, déficit de lenguaje, signos y síntomas neurológicos (como convulsiones, hipotonía y clonus), anomalías oftalmológicas (estrabismo, errores de refracción) y dismorfismo facial (incluyendo cara larga, frente prominente, orejas grandes y prominentes y prognatismo mandibular).

CLINICAL DESCRIPTION

.

Síndrome de duplicación Xq27.3q28
SUMMARY

El síndrome de duplicación Xq27.3q28 es un síndrome descrito recientemente caracterizado por: estatura corta, hipogonadismo, retraso en el desarrollo y dismorfismo facial.

CLINICAL DESCRIPTION

El síndrome de duplicación Xq27.3q28 es un síndrome descrito recientemente caracterizado por: estatura corta, hipogonadismo, retraso en el desarrollo y dismorfismo facial.

VARIANTS

Premutation allele (CGG)n

900 828 420